ID: 933215832

View in Genome Browser
Species Human (GRCh38)
Location 2:79629094-79629116
Sequence TAGGGGAAGCAATAAGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 382
Summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 347}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933215832_933215836 -8 Left 933215832 2:79629094-79629116 CCTTCCCCTTATTGCTTCCCCTA 0: 1
1: 0
2: 0
3: 34
4: 347
Right 933215836 2:79629109-79629131 TTCCCCTATGCCAGCCATATTGG 0: 1
1: 0
2: 2
3: 7
4: 113
933215832_933215841 3 Left 933215832 2:79629094-79629116 CCTTCCCCTTATTGCTTCCCCTA 0: 1
1: 0
2: 0
3: 34
4: 347
Right 933215841 2:79629120-79629142 CAGCCATATTGGCCCTCGTGTGG 0: 1
1: 0
2: 0
3: 2
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933215832 Original CRISPR TAGGGGAAGCAATAAGGGGA AGG (reversed) Intronic
900166782 1:1247104-1247126 TTGGGGAAGCAATGGGGGCAGGG - Intergenic
900287178 1:1907349-1907371 TGGAGGAGGCAATAAGGGGTGGG + Intergenic
900518950 1:3096417-3096439 TAGGGGAAGGAATGAGGTCATGG + Intronic
905256629 1:36688990-36689012 AAGGGGAAGGAATATGGGAAGGG + Intergenic
905807556 1:40887898-40887920 TATGGGAAGTAAGAAGTGGAGGG - Intergenic
907387493 1:54135665-54135687 TAGGGCATGGAATAGGGGGAGGG + Intronic
907556126 1:55345613-55345635 TTGGGGAATAAATATGGGGAGGG - Intergenic
907795609 1:57713532-57713554 AAAGGGAAGCTATAATGGGAAGG + Intronic
908162828 1:61427735-61427757 CAGGGGGAGCTAAAAGGGGAGGG + Intronic
908248120 1:62243859-62243881 TAGGGGAACCAATCAGAGTAGGG - Intronic
908657699 1:66405387-66405409 CAGGGGAAGCAATGACAGGAGGG - Intergenic
909713075 1:78674096-78674118 TAAGGGAAGAATGAAGGGGAAGG - Intergenic
910937260 1:92494524-92494546 TAGTGGAAGAAATAATGGGGTGG + Intergenic
911224634 1:95291626-95291648 TAGGGGAAGAAACAGGGAGAGGG + Intergenic
911620921 1:100065732-100065754 AAGGGGAAGAGAAAAGGGGAAGG - Intronic
911650422 1:100381873-100381895 TAGGGGAAGCAATCAAAAGAGGG + Intronic
911783006 1:101907554-101907576 TAGGGATAGCAAAGAGGGGACGG + Intronic
912466663 1:109879329-109879351 TGGGGGAATCATAAAGGGGAGGG + Intergenic
912523832 1:110266144-110266166 TAGGGGGAGAAATAATGGGCAGG + Intronic
912548710 1:110470140-110470162 TAGGGGAAGAAGGAAGGGAAGGG - Intergenic
913017790 1:114757177-114757199 AAGGGGAGACAATGAGGGGAAGG + Intronic
913511770 1:119568881-119568903 TGGGGGATGCCAGAAGGGGAGGG + Intergenic
913515992 1:119606211-119606233 TGGGGGATGCCAGAAGGGGAGGG + Intergenic
914846121 1:151284290-151284312 TCGGGAAAGCAAGATGGGGAGGG + Intronic
914936195 1:151982516-151982538 TAGGAGAACCAATCAGGAGAGGG - Intergenic
915493854 1:156267238-156267260 TATGGGAGGCAGTAAGGAGAAGG + Intronic
915719028 1:157970460-157970482 CAGGGGAAGAAAGAAGGGAATGG - Intergenic
916883771 1:169047444-169047466 TGGGTGAGGCACTAAGGGGATGG + Intergenic
917538803 1:175893979-175894001 TAGGGGAAGGGAGAAGAGGAAGG - Intergenic
919110888 1:193217436-193217458 TAGGGGAGCCAGAAAGGGGATGG + Intronic
919331536 1:196178248-196178270 TAGATGAGGCAATAAGGGTAAGG + Intergenic
919796671 1:201325220-201325242 TAGGGGAAGCACCAAGGGCAGGG + Intronic
920883619 1:209903250-209903272 CAGAGGGAGCAAGAAGGGGAGGG + Intergenic
920883948 1:209908342-209908364 AAGGGGAAGGAAGGAGGGGAAGG - Intergenic
921696238 1:218214321-218214343 TGGGGGAAGCCAGAAGGGGATGG - Intergenic
922931366 1:229392394-229392416 TAAGGGAAGCAGGAAAGGGAAGG - Intergenic
923109932 1:230882525-230882547 TGGGGGAAGCCAGAAGGGGATGG + Intergenic
1062975027 10:1676834-1676856 CAGGGGAAGCATGAAGAGGATGG + Intronic
1065045684 10:21746151-21746173 TAGGGGCAGCATAAAGGGCAGGG + Intergenic
1065286509 10:24192374-24192396 AAGGGGAAAGGATAAGGGGAAGG + Intronic
1068686808 10:59878888-59878910 TAGGCCAAGCCATAAGGGAAAGG + Intronic
1069595685 10:69668612-69668634 TATGGGAAGCAGTGATGGGAGGG + Intergenic
1070634502 10:78113586-78113608 TAGGGGAAGGAAGGAAGGGAGGG - Intergenic
1071867052 10:89746364-89746386 TATGGGGAGCCAGAAGGGGATGG + Intronic
1071941793 10:90598874-90598896 AAGAGAAAGCAATAATGGGAAGG + Intergenic
1072877734 10:99191048-99191070 AAGGGGAAAGAAGAAGGGGAAGG + Intronic
1073020874 10:100442679-100442701 TATGGTAAGCAAAGAGGGGAGGG - Intergenic
1073762838 10:106649039-106649061 TGGAGGAAGCCAGAAGGGGATGG - Intronic
1075083296 10:119397883-119397905 AAGGGGAGGCAACAAGGTGATGG - Intronic
1075221276 10:120587048-120587070 TAGGGGAAGGCATGAGGAGAAGG + Intronic
1075284476 10:121171766-121171788 GAGGGGAAGGAAGAAGGGGAAGG + Intergenic
1075533297 10:123248696-123248718 TACGGGAAGCCATAAGCAGAAGG + Intergenic
1076004816 10:126940024-126940046 GAGGAGAAGCAAGAAGGAGAAGG + Intronic
1076523175 10:131093725-131093747 TGGGGGAAGAAACAAGGGAAGGG - Intronic
1082196800 11:49316257-49316279 AAGGGGAAGGGGTAAGGGGAAGG + Intergenic
1084005512 11:66321378-66321400 AAGGAGAAGAAAGAAGGGGAAGG + Intergenic
1085246324 11:75104596-75104618 AAGGGGATGCAATAGGTGGAAGG + Intronic
1085886769 11:80531659-80531681 TGGGGGAAGCCAGAAGGGGATGG + Intergenic
1086676002 11:89607877-89607899 TCGGGGAAAAAATTAGGGGAGGG + Intergenic
1087782859 11:102319444-102319466 GAGTTGAAGCAATGAGGGGATGG + Intronic
1088280085 11:108126714-108126736 TAGGGATTGCAATAAAGGGAAGG + Intronic
1088350900 11:108886124-108886146 AAGGGGAGGGGATAAGGGGAAGG + Intronic
1089122618 11:116147994-116148016 TGGGGGAAGCCAGAAAGGGATGG - Intergenic
1089593768 11:119561554-119561576 GAGGGGAAGGAAAAAGAGGAAGG - Intergenic
1091077515 11:132634049-132634071 TAGCAGAAGCAAAAAGGGAAAGG + Intronic
1091192652 11:133707595-133707617 AAAGGGAAGAAAAAAGGGGAAGG + Intergenic
1091635624 12:2194372-2194394 GAGGGGGAGCAGGAAGGGGAAGG - Intronic
1092087246 12:5773215-5773237 ATGGGGAAGCAACAATGGGAGGG - Intronic
1092166821 12:6347726-6347748 GAGGGGAAGCAAGATGGGTAAGG - Exonic
1092518629 12:9242304-9242326 AAGAGGAAGAAATAAAGGGAGGG - Intergenic
1092881862 12:12892961-12892983 TGAGGGAAGGAATGAGGGGAAGG + Intronic
1092974337 12:13729804-13729826 AAGAGGAAGCCATATGGGGAGGG + Intronic
1093847477 12:23990570-23990592 TAGGAGAAGGAAGAATGGGAAGG - Intergenic
1094461479 12:30701124-30701146 AAGAGGAAGAAATAAAGGGATGG + Intergenic
1095785242 12:46102220-46102242 TGGGGGAAGCCAGAAGTGGATGG - Intergenic
1095856158 12:46863044-46863066 TTGGGGAAGAAATATGTGGATGG - Intergenic
1096155570 12:49339656-49339678 CAGGGGAAGCAATAAGGACCTGG - Intergenic
1097232971 12:57523181-57523203 TGGGCGAAGCACTGAGGGGAGGG - Intronic
1097977232 12:65699862-65699884 GAGGGGAAGAAAAAAGGAGAGGG - Intergenic
1099148041 12:79072905-79072927 TAGGTGAAGGAGTAAGGGGAAGG + Intronic
1099601104 12:84738826-84738848 TAGGAGAAGCAGTAAAGCGAAGG - Intergenic
1099989831 12:89709597-89709619 CAGGGGAAGGAAGAAAGGGAGGG - Intergenic
1101399926 12:104378306-104378328 TAGGGGACCCAGAAAGGGGAAGG + Intergenic
1101582152 12:106051001-106051023 TAGGGTGAGGAATGAGGGGAAGG + Intergenic
1103050606 12:117776163-117776185 GAGGGGAAGGAATATGGGGTTGG - Intronic
1103199414 12:119074637-119074659 TAGGGCAAGTAATAAGGTGCTGG - Intronic
1103582407 12:121925076-121925098 GAGGTGAGGCAAGAAGGGGAAGG - Intronic
1104673037 12:130693419-130693441 TAGGGCAAGCACAAAAGGGATGG + Intronic
1105673422 13:22644497-22644519 TGGCGGAAGCCAAAAGGGGATGG + Intergenic
1106662247 13:31811579-31811601 TAATGGAGGCAAGAAGGGGAGGG - Intergenic
1106762802 13:32883536-32883558 TAGGGGAAGGAATAAAGAGAAGG - Intergenic
1106800227 13:33248677-33248699 TATGGGAAGCAAAAGGGGAAAGG - Intronic
1106836826 13:33643829-33643851 TGGGGGAAGCAAGGAGGGCATGG - Intergenic
1107918961 13:45183457-45183479 AAAGGGAAGCAAGACGGGGAAGG + Intronic
1108958244 13:56187710-56187732 GAGGGGAAGCAAGAAAGAGAGGG - Intergenic
1110550570 13:76807052-76807074 TGGGGGAAGCAACAAGGTAAGGG + Intergenic
1111835666 13:93385552-93385574 TAGGGGTAGAAAGAAGTGGACGG + Intronic
1114262153 14:21044715-21044737 TAAAGGAAGAAAGAAGGGGATGG - Intronic
1114464664 14:22913076-22913098 TAGGGATAGAAGTAAGGGGAAGG + Intronic
1117998053 14:61496614-61496636 TATGGAAAGCACTAAGGGAAGGG - Intronic
1118107057 14:62671712-62671734 AAGGGGAAGCAATAGTGTGATGG + Intergenic
1118763528 14:68895136-68895158 TGGGAGAACCAATAAGGAGAAGG + Intronic
1119172317 14:72544757-72544779 CAGGGGAAGGAACAGGGGGATGG - Intronic
1120284442 14:82480485-82480507 GAGAGAAAGCAAGAAGGGGAGGG - Intergenic
1122647933 14:103207386-103207408 GAGGGGAAGGAGGAAGGGGAAGG - Intergenic
1123061107 14:105594892-105594914 TAGGGGAATGAAGAGGGGGATGG + Intergenic
1123085562 14:105715803-105715825 TAGGGGAATGAAGAGGGGGATGG + Intergenic
1125094725 15:35838126-35838148 TAAGGGAAGCCATAATGAGAAGG + Intergenic
1125217649 15:37295092-37295114 TAGGAAAAGCCCTAAGGGGATGG - Intergenic
1126067428 15:44836961-44836983 GAGGGGAAGGGATAAGGGGGTGG - Intergenic
1126092449 15:45063920-45063942 GAGGGGAAGGGATAAGGGGGTGG + Intronic
1126145474 15:45469369-45469391 GAGGGGAATGAATAAGGGCAGGG - Intergenic
1126572122 15:50163853-50163875 AAGGGGAAGGAAGAAGGGGAAGG - Intronic
1128679519 15:69637870-69637892 TAGGGGGAGCAATAAGAGATAGG - Intergenic
1129686665 15:77689869-77689891 AGGGGGAAGCAAGAAGGGGAAGG + Intronic
1130391812 15:83463066-83463088 TCAGGGAAGCATGAAGGGGAAGG + Intronic
1130511858 15:84595897-84595919 AAGGGGAAGGAAGAATGGGAAGG + Intergenic
1130688813 15:86062448-86062470 TGGGGGAAGCATTAAGTGGAAGG + Intergenic
1131881675 15:96868764-96868786 TCAGTGAAGCAATAAGTGGAAGG + Intergenic
1132257193 15:100385895-100385917 CAGTGGAAGCAATGTGGGGAAGG + Intergenic
1132523418 16:401820-401842 TCCGGGAAGCAATCAGGGCAGGG + Exonic
1133077058 16:3288271-3288293 TAGAGAAAGAAATTAGGGGAGGG - Intronic
1134599591 16:15523059-15523081 TGGGGGAAGCCAGAAGGGGATGG + Intronic
1135794513 16:25428441-25428463 AAGAGCAAGCAATAAGGGAATGG - Intergenic
1136408097 16:30060901-30060923 TAGGGGCTGCAGTGAGGGGAGGG - Intronic
1136574254 16:31113873-31113895 TAGGGGAAGTAGGAAGGGGAAGG + Intergenic
1137036490 16:35573920-35573942 TAGAGGCAGAGATAAGGGGATGG + Intergenic
1138849120 16:60605297-60605319 TAGGGGAAGCCAGATGGGGATGG + Intergenic
1139413904 16:66790252-66790274 GAAGGGAAGGAAAAAGGGGAGGG + Intronic
1142181404 16:88672638-88672660 CAGGGGAAGCAAAAAGGAGCTGG + Intergenic
1142766553 17:2067666-2067688 GAGGGGAAGGAAGACGGGGAGGG + Intronic
1142898155 17:2995551-2995573 TACGGGAACGAATATGGGGACGG - Intronic
1143519068 17:7435485-7435507 TATGGGAAGCAGTAAGGGTGGGG - Exonic
1144439770 17:15271291-15271313 TAGGGAAAGCAAGAGGGAGAGGG - Intergenic
1144620700 17:16816679-16816701 CAGGAGAAGGAAAAAGGGGAGGG + Intergenic
1144884942 17:18451468-18451490 CAGGAGAAGGAAAAAGGGGAGGG - Intergenic
1145147279 17:20492909-20492931 CAGGAGAAGGAAAAAGGGGAGGG + Intergenic
1146930931 17:36777288-36777310 TTGGGGAAACAAGAAGGTGAGGG + Intergenic
1147760544 17:42795149-42795171 GAGGGGAAGGAAGAAGTGGAGGG - Exonic
1148048599 17:44758720-44758742 TAGGGGAGGGAAGCAGGGGACGG - Intergenic
1148677199 17:49452313-49452335 CAGGGGAAGCAGGAAGGGCAGGG - Intronic
1150146431 17:62773488-62773510 AAGGGGAAGAAATAAGTGGAGGG + Intronic
1150597634 17:66620389-66620411 AAGGGGAAGCAATAAGTGGGAGG + Intronic
1152464686 17:80459123-80459145 TAGGGGAAGAAAAGAGGTGATGG - Intergenic
1152851262 17:82637731-82637753 TAGGGCAAGGTATTAGGGGAAGG + Intronic
1153703212 18:7717415-7717437 AAGGGGAGACAAAAAGGGGATGG - Intronic
1154144925 18:11859552-11859574 GAGGGGAAGGAACAAAGGGAAGG - Intronic
1155807111 18:30185151-30185173 AAGGGGAAGTGAAAAGGGGATGG - Intergenic
1156760542 18:40583705-40583727 TGGGGAAAGCCAGAAGGGGATGG + Intergenic
1157422681 18:47559574-47559596 AAGGGGAAGGAGAAAGGGGAAGG - Intergenic
1157686893 18:49650143-49650165 TAGGGGAAGAGGGAAGGGGAAGG + Intergenic
1159113571 18:64088311-64088333 TGGGAGAAGAAATAAGGAGATGG - Intergenic
1160611204 18:80086793-80086815 TAGGAGAAGCAGGATGGGGAGGG - Intronic
1162866190 19:13549011-13549033 CAGGGGTAGCAATAAGGAGCTGG - Intronic
1162884997 19:13690407-13690429 CAGGGTAATCAATAAGGGGATGG + Intergenic
1163004533 19:14389205-14389227 TAGGGGGAGGGAGAAGGGGAGGG + Intronic
1164680552 19:30131189-30131211 AAGGGGAAGGGAGAAGGGGAGGG - Intergenic
1164693277 19:30226223-30226245 TGGGGGGAGTAAAAAGGGGAGGG + Intergenic
1166088398 19:40492143-40492165 ATGGGGAAGCAACAAGGGGCAGG + Intronic
1166201214 19:41238968-41238990 AAAGGGAAGCTAGAAGGGGATGG + Intronic
1166542668 19:43615805-43615827 TAGGGCAAGGTATAAGGGAAGGG + Intronic
1167100110 19:47399390-47399412 TGGGGGAAGGAATATGGGGGAGG - Intergenic
924963423 2:55373-55395 AAGGGAAAGCAAGAAGGGGGTGG + Intergenic
926918860 2:17919280-17919302 TAGGGGAAGGAAGTGGGGGAAGG + Intronic
929836933 2:45410895-45410917 TAGGGAAAGGTATAGGGGGAAGG - Intronic
930957900 2:57226175-57226197 AAGAGGAAGCAATAATTGGACGG - Intergenic
931179373 2:59884372-59884394 TAGAGGAAACAACACGGGGAAGG - Intergenic
931183594 2:59928368-59928390 TAGGGCAAGCATTAAGAGGGAGG - Intergenic
931967677 2:67551338-67551360 AAGGAGAAGCAACAAGGAGAAGG + Intergenic
931984736 2:67730629-67730651 AAGGGAAAGCAATAAGGGATAGG + Intergenic
933171671 2:79132312-79132334 GAGGGGAAGCAAAATGGGAAGGG - Intergenic
933215832 2:79629094-79629116 TAGGGGAAGCAATAAGGGGAAGG - Intronic
933935308 2:87199097-87199119 CAGAGGAAGCAATAAGGTGGGGG + Intergenic
936122497 2:109758941-109758963 GAGGGGAAGAAAAAAGAGGAGGG + Intergenic
936222196 2:110612531-110612553 GAGGGGAAGAAAAAAGAGGAGGG - Intergenic
936357839 2:111766802-111766824 CAGAGGAAGCAATAAGGTGGGGG - Intronic
936645727 2:114367881-114367903 TAGGGAAAGAAGTAAGGCGAGGG + Intergenic
940152438 2:150617104-150617126 TAGGGGATGGATTAAAGGGAGGG - Intergenic
941142252 2:161799562-161799584 TAGAGGAAGGAATAAGAAGAAGG - Intronic
941186190 2:162324333-162324355 CAGGGGAAGTCAGAAGGGGATGG + Intronic
941901838 2:170686338-170686360 GAGGGGAAGAAAGGAGGGGAGGG + Intergenic
942812557 2:180016088-180016110 TAGGGGAAGGAAGTAGGGTAAGG + Intergenic
947052515 2:226062347-226062369 TGAGGGAACCAATAGGGGGAAGG + Intergenic
947906350 2:233766200-233766222 TGGGGGAAGCCAGAAGGGGATGG + Intronic
949038414 2:241832068-241832090 GAGGGGAGGCAGTGAGGGGAGGG + Intergenic
1168754325 20:305516-305538 TGGAGGAAGCCAGAAGGGGATGG - Intergenic
1169178628 20:3542567-3542589 AAGGGGAAGGAGAAAGGGGAAGG - Intronic
1169178632 20:3542580-3542602 AAGGGGAAGGGAGAAGGGGAAGG - Intronic
1169273950 20:4220889-4220911 GAGGGGAAGTAATAAGGGGTAGG + Exonic
1171301381 20:24063959-24063981 TTGGGGAAACAGGAAGGGGAGGG - Intergenic
1171386417 20:24772080-24772102 GAGGTGAAGCAAGGAGGGGATGG + Intergenic
1171504045 20:25618832-25618854 TCGGGGAGACAAGAAGGGGAAGG - Intronic
1172286668 20:33745476-33745498 TAGGGGATGCCAGACGGGGATGG + Intronic
1172641494 20:36442954-36442976 GAGGTGAAGCAATAAGGGTAGGG - Intronic
1172998676 20:39090174-39090196 TAGGGGAAGACAGGAGGGGATGG + Intergenic
1174336075 20:49861660-49861682 TAGGGGAGGGAAGAAGGGAATGG + Intronic
1174528073 20:51189542-51189564 TAGGGGAAGAGGTGAGGGGAAGG - Intergenic
1177587707 21:23119758-23119780 AAGTGGAAGCAAAAAGGTGAAGG - Intergenic
1177978837 21:27885344-27885366 GAGGGGAAGCAAGAAAGAGACGG + Intergenic
1178713608 21:34943075-34943097 TATGGAAAGCATAAAGGGGAAGG + Intronic
1178880257 21:36444258-36444280 GAGGGGAGGGAATTAGGGGATGG - Intergenic
1178953158 21:37001826-37001848 TAGAGGAAGTAATTTGGGGAAGG - Intergenic
1179427072 21:41290176-41290198 TAGGAAAAGAAATAAAGGGATGG - Intergenic
1179862863 21:44200009-44200031 TGGGGGAGGCCATAAAGGGAGGG - Intergenic
1180677807 22:17599965-17599987 GAGGGGAAGGAAGAAAGGGAGGG + Intronic
1180839609 22:18953139-18953161 TAGGGGAAGCTAGAAGGGGGTGG + Intergenic
1181062295 22:20287340-20287362 TAGGGGAAGCTAGAAGGGGGTGG - Intergenic
1181976863 22:26736557-26736579 ACAGGGAAGAAATAAGGGGAAGG - Intergenic
1182083437 22:27544853-27544875 TCTGGGAAGCAACATGGGGAGGG - Intergenic
1182841207 22:33391419-33391441 CAGGGGAAGCATTAGGGGAAGGG + Intronic
1183027494 22:35076687-35076709 GAGAAGAAGCAATCAGGGGAGGG + Intronic
1183746444 22:39694599-39694621 GAGGGGGAGGAATAAAGGGAGGG - Intergenic
1185184226 22:49383037-49383059 TAGGCGGATCATTAAGGGGAGGG - Intergenic
950342543 3:12260192-12260214 TGGGGGAGGCAAGGAGGGGAGGG + Intergenic
952181453 3:30920727-30920749 AAGGGGAACTGATAAGGGGATGG - Intergenic
952814377 3:37434535-37434557 GAGGGGAAAAAATAAGGGGGAGG - Intronic
952829133 3:37548921-37548943 TAGGGCAAGAAAAGAGGGGAAGG + Intronic
953581238 3:44158605-44158627 AAGGGGAAGGCATAAGGGAAGGG + Intergenic
954445571 3:50545008-50545030 TACTGGAACCAATAAGGGGGAGG + Intergenic
954452100 3:50577235-50577257 TGGGGGAAGCACTAATGGGAGGG - Intronic
954487972 3:50872762-50872784 AAGGGGAGGAAAGAAGGGGAAGG - Intronic
954690024 3:52390813-52390835 AAGGGGATGCAGTAAGGAGAGGG + Intronic
954901837 3:54026596-54026618 TAGGGGAAGAAGTACGTGGAGGG - Intergenic
955352366 3:58203265-58203287 TAGGGGGACCAAAAAGAGGATGG - Intronic
956894941 3:73649919-73649941 TAGGTCCAGCACTAAGGGGAGGG + Intergenic
958867620 3:99519435-99519457 TAGAGGAAGTAATGAGAGGAAGG - Intergenic
959716472 3:109439058-109439080 AAGGGGAAGAAAGAAGGGAATGG - Intergenic
961081310 3:124031506-124031528 TAGGCAAAGGATTAAGGGGAAGG + Intergenic
961615175 3:128173645-128173667 TAGGGGAACCGATAAGGAGAAGG - Intronic
961767585 3:129223510-129223532 TAGGGGATGAAATTAGGGTAAGG + Intergenic
963692735 3:148525328-148525350 GAGGGGAAGCAAGAAAGAGATGG - Intergenic
964624743 3:158748324-158748346 TCCAGGAAGGAATAAGGGGAAGG - Intronic
965177662 3:165356438-165356460 TAAGGGAAGAATTAAGAGGAGGG - Intergenic
965662747 3:171058977-171058999 CAGGGGAAGAGATAAGGGAAAGG + Intergenic
966530364 3:180972134-180972156 GAGGGGAGGAAAGAAGGGGAAGG - Intronic
968633282 4:1663900-1663922 TAGAGGAAACCATAAGGGGCAGG + Intronic
968708471 4:2095224-2095246 GAAGGGAAGCAAAAAGGGGAGGG + Intronic
968857509 4:3138155-3138177 AAGGGGAAGGGAAAAGGGGAAGG - Intronic
969543221 4:7806965-7806987 CGGGGGAAGGGATAAGGGGAAGG + Intronic
969551277 4:7869230-7869252 AAGGGGAAGGAGGAAGGGGAAGG + Intronic
970108349 4:12609882-12609904 TAATCGAAGCAATAAGGGGCGGG - Intergenic
971005476 4:22370002-22370024 AAGGGGAGCCAAAAAGGGGATGG - Intronic
973283034 4:48380925-48380947 TAGGGGAAGCTATATGGAAATGG - Intronic
977367283 4:96086381-96086403 TAGGGTGAGCAGAAAGGGGAGGG + Intergenic
978536904 4:109771961-109771983 TAGGAGAAGCAATCAGAGCACGG + Intronic
979468008 4:121062733-121062755 TAAGGGAAGCACTAAGGAAAAGG + Intronic
979919152 4:126477256-126477278 TAAGGGAAGAATTAAGGGAATGG - Intergenic
980406592 4:132360967-132360989 CAAGGGTAGCACTAAGGGGATGG - Intergenic
981537879 4:145819129-145819151 TAGGGGAAATAATGAGGGAAGGG + Intronic
983253826 4:165376402-165376424 GAGGTGAAGCAAGAAGTGGAGGG + Intronic
984566487 4:181336905-181336927 GAGGGGAAGGAAAAAGGGAAGGG + Intergenic
987923697 5:24314503-24314525 GAGGGGAAGCAAGAAAGAGACGG - Intergenic
988857901 5:35247037-35247059 GAGAGGAAGAAAGAAGGGGAGGG + Intergenic
989431748 5:41363633-41363655 TAGGTGAAACAATAATGAGATGG - Intronic
989690034 5:44131142-44131164 AAGTGGAAGCAACAAGGAGAAGG - Intergenic
989737133 5:44721319-44721341 TAGGGAAAGCATTAAGAGGGAGG + Intergenic
990182299 5:53174522-53174544 GAGGAGAAGGAAGAAGGGGAAGG + Intergenic
990557077 5:56948038-56948060 TGGGGGAAGGAAGAAGTGGATGG + Intronic
991646662 5:68807949-68807971 AAGGGGAAGGGAAAAGGGGAAGG + Intergenic
993379589 5:87191341-87191363 GAGGGGAAGAATTATGGGGAGGG + Intergenic
994695476 5:103068186-103068208 TAGGGGTAGCAAGTAAGGGAAGG + Intergenic
994752331 5:103753303-103753325 TAGGGAAAGCAATTAGGTAATGG + Intergenic
995083907 5:108086006-108086028 TAGGGGCAGAAAAAAGGGGCAGG - Intronic
995209571 5:109521897-109521919 AGGGGGAAGAAAGAAGGGGAAGG - Intergenic
996334170 5:122365155-122365177 TAGGGAAAGCAAAAAGAAGATGG - Intronic
998042597 5:138961898-138961920 TTGGAGAAGCTAAAAGGGGAAGG - Intronic
998042606 5:138962020-138962042 TTAAGGAAGCAATAAGGAGAAGG - Intronic
999448824 5:151663512-151663534 TGGGGGAAACACGAAGGGGAGGG + Exonic
1000119095 5:158179711-158179733 TAGGGAAAGCCAGAAGGTGAGGG - Intergenic
1000366395 5:160495114-160495136 TAGGGGAAGAAATAAAGATAAGG + Intergenic
1001527158 5:172437144-172437166 AAGGGAAAGCAACAAGGGCAAGG + Intronic
1002254782 5:177951026-177951048 AAAGGTAAACAATAAGGGGATGG - Intergenic
1002700583 5:181121754-181121776 TATGTAAAGCAATAAGAGGAGGG - Intergenic
1003342485 6:5235076-5235098 TAGGGGAAGTAATGATGGAAAGG - Intronic
1003809903 6:9767990-9768012 TGGGGGAAGCCAGAAAGGGATGG + Intronic
1004615427 6:17283376-17283398 CAAGGGAAGCATTAAGGGGTAGG + Intronic
1005945358 6:30591278-30591300 AAGGGGAAGAAATAAAGGAAAGG + Exonic
1007720255 6:43880899-43880921 TGGGGGAAGCAAGATGGGAAAGG + Intergenic
1009828484 6:68898301-68898323 TAGCTGAAACAAAAAGGGGAAGG - Intronic
1010383602 6:75252004-75252026 AAGTGGAAGAAATATGGGGAGGG + Intergenic
1010995146 6:82523919-82523941 CAGGGGAAGTCAGAAGGGGAGGG - Intergenic
1011931113 6:92714728-92714750 TAGAGCATGCAAAAAGGGGAGGG + Intergenic
1012499131 6:99869319-99869341 AAGGGGAAGCAACAATGAGAAGG + Intergenic
1012620499 6:101339125-101339147 AAGGGGAAGGAATAGTGGGAAGG - Intergenic
1012731458 6:102887704-102887726 TGGGGGAAGCCAGAAGGGGATGG + Intergenic
1012849559 6:104430303-104430325 TAAGAGAAACAATAAGGGCAAGG + Intergenic
1013343131 6:109235070-109235092 TTGGGGAAGCCATAATGGAAAGG - Intergenic
1013497104 6:110708416-110708438 TAGGTGGAGCTATAGGGGGAGGG - Intronic
1013788514 6:113809877-113809899 TAGAGGAAGAAAAAAGGGGAAGG - Intergenic
1014820932 6:125987643-125987665 TAGGGCAAGGAGTAAGAGGATGG + Intronic
1015018160 6:128439196-128439218 TATGTGAAGCAGGAAGGGGAAGG - Intronic
1017511461 6:155118115-155118137 TAGGGGAGGGTGTAAGGGGATGG + Intronic
1018954595 6:168400320-168400342 GAGAGGAAGCAATGAGGGGCAGG - Intergenic
1018963031 6:168462126-168462148 TAAGGGAAGAAATCAGAGGATGG - Intronic
1019322777 7:423104-423126 TAGGAGAAGCACGAAGGGGTGGG + Intergenic
1019919968 7:4157280-4157302 GAGGGGAAGGAAGAAAGGGAAGG + Intronic
1019941861 7:4298225-4298247 GAGGGGAAGGAATAAAGGAAGGG - Intergenic
1020036908 7:4969341-4969363 TAAGGGAAGGAGTAAGGGAAGGG + Intergenic
1021984216 7:26083517-26083539 GAGGGGAAGAAATGAAGGGAAGG + Intergenic
1022061345 7:26799011-26799033 GAAGGGAAGGAAAAAGGGGAGGG + Intronic
1022066301 7:26861662-26861684 TAGGGGAAGGAAAAAGGGAGAGG + Intronic
1023076768 7:36490987-36491009 CAGGGAAAGAAATAAGGGAAAGG - Intergenic
1023076784 7:36491134-36491156 CAGGGAAAGAAATAAGGGAAAGG - Intergenic
1023802762 7:43849318-43849340 TAGGGAAAGCTATGTGGGGAGGG - Intergenic
1023820447 7:43977665-43977687 GAGGGGAAGGAAGGAGGGGAAGG - Intergenic
1024714739 7:52064817-52064839 TAGGGTGAGCAATAATGGGGAGG - Intergenic
1024959330 7:54958174-54958196 TAGGAGAGGTATTAAGGGGATGG + Intergenic
1026346226 7:69476420-69476442 TGGGAGAAGCTCTAAGGGGAAGG + Intergenic
1026981450 7:74529118-74529140 TAGGGGAAGCACCAAGGGGGCGG + Intronic
1028046847 7:86130868-86130890 AAGGGGAAGTAAAAAGGGGACGG + Intergenic
1028275710 7:88854582-88854604 AAAGGGAAGGAATAAAGGGAAGG - Intronic
1028471586 7:91212206-91212228 TAGTAGAAGAAAGAAGGGGATGG + Intergenic
1028724423 7:94071159-94071181 TGGGGGAAGCCAGAGGGGGATGG + Intergenic
1029049517 7:97670022-97670044 TGGGGGAAGCAAGCAGGGAAGGG + Intergenic
1029546342 7:101212379-101212401 GAGGGGAAGACATAGGGGGATGG + Intronic
1030380259 7:108803248-108803270 TAAGGGAAGAAAGAAGGGGAAGG - Intergenic
1031236914 7:119188654-119188676 TTGGGGAAGAAATATGTGGATGG + Intergenic
1032123302 7:129172305-129172327 TAGGTAAAGCACTTAGGGGAGGG + Intergenic
1033804392 7:144937599-144937621 AAGGGGAAGCAGAAAGGGGAAGG - Intergenic
1033982615 7:147184725-147184747 AAGGAGAAGAAAGAAGGGGATGG + Intronic
1034866305 7:154645443-154645465 GAGGGGAAGGGAGAAGGGGAGGG - Intronic
1035726828 8:1829973-1829995 TAGCGGTAGCAAGAAGGAGAGGG + Intronic
1038483731 8:27919130-27919152 GAGGAGAAGGAAGAAGGGGATGG + Intronic
1040013680 8:42682973-42682995 CAGGGGAAGAGAGAAGGGGAAGG + Intergenic
1040413489 8:47178390-47178412 TAGGGGAAACAACGAGGGGGTGG - Intergenic
1041327706 8:56686861-56686883 TGAGGACAGCAATAAGGGGATGG + Intergenic
1041809106 8:61887540-61887562 TAGGGTCAGCATTAAGGAGATGG + Intergenic
1042936263 8:74061478-74061500 TGGAGGAAGAAATAAGGAGATGG + Intergenic
1043654535 8:82645908-82645930 TAGGGCAAGGAATAGGGGAAGGG + Intergenic
1044343208 8:91071060-91071082 AACAGGAACCAATAAGGGGATGG - Intronic
1046319490 8:112553595-112553617 CTGGGAAAGCCATAAGGGGAGGG - Intronic
1046506254 8:115141495-115141517 CAGAGGAAGCAATAACTGGAAGG + Intergenic
1046738150 8:117799670-117799692 GAGGGGAAGCAAGAAGGGATGGG - Exonic
1047023614 8:120804234-120804256 AAGAGGAAGGAATAAAGGGAGGG - Intronic
1047085178 8:121507873-121507895 TAGGGGAAAAAAAAAGGGGGGGG + Intergenic
1047879505 8:129178097-129178119 GAGAGGAAGCCATCAGGGGATGG - Intergenic
1048531403 8:135253523-135253545 TAGGGAAAGAAAGAAGAGGAGGG + Intergenic
1049314562 8:141956335-141956357 TAGTGAAAGGAAAAAGGGGATGG + Intergenic
1050000577 9:1073104-1073126 AAAGAGAAGCTATAAGGGGAAGG - Intergenic
1050202151 9:3157029-3157051 TGGGGGAAGCCAGAAGGGGATGG + Intergenic
1051475474 9:17503448-17503470 TAGAGGAACCAAAAAGGGTATGG - Exonic
1052497803 9:29249839-29249861 AAGGGGATGCAATAAGTTGATGG - Intergenic
1055199815 9:73646542-73646564 TGGGGGAAGCCAGAAGGGGATGG + Intergenic
1055919910 9:81449382-81449404 TAAAAGAAGCAAAAAGGGGAAGG - Intergenic
1056395819 9:86180277-86180299 CAGGGAAAGCAAGATGGGGAAGG - Intergenic
1057230210 9:93317316-93317338 TTGGGGAAGCAAACAAGGGAGGG + Intronic
1057626615 9:96683642-96683664 TAGGGAAGGCAATGAAGGGAGGG - Intergenic
1060416388 9:123433817-123433839 TGGGGAAAGCAGTCAGGGGAAGG - Intronic
1060732348 9:126046721-126046743 GAGGGGCAGGAAGAAGGGGAAGG - Intergenic
1061577775 9:131518299-131518321 TGAGGGAAGCTATAAGGGGCTGG - Intronic
1061747310 9:132749912-132749934 TTGGGGAAGAAATAAAAGGATGG - Intronic
1061947171 9:133914798-133914820 GAGGGGAAGGGAGAAGGGGAGGG + Intronic
1062470576 9:136701825-136701847 TGGGATAAGGAATAAGGGGAGGG + Intergenic
1062638430 9:137503661-137503683 AAGGGGAAGGAAGAAGGAGAAGG + Intronic
1188156620 X:26749169-26749191 TAGGAGAAGCAAGTAGGGGTGGG - Intergenic
1189286311 X:39854590-39854612 GAGGGGAAGCTATATGGGGTGGG - Intergenic
1190653384 X:52589800-52589822 TAGGGGAAGGAATGAAGGAAGGG - Intergenic
1190981966 X:55464188-55464210 TAGGGTACGGAAGAAGGGGAAGG - Intergenic
1190986732 X:55508992-55509014 TAGGGTACGGAAGAAGGGGAAGG + Intergenic
1191677247 X:63804309-63804331 GAAGGAAAGCAATAAAGGGAAGG + Intergenic
1192028794 X:67486759-67486781 GAGGGTAAGAAATAAGAGGAGGG + Intergenic
1192036731 X:67571045-67571067 TAAGGAAGGCAGTAAGGGGAGGG + Intronic
1192448960 X:71230903-71230925 AAGGGGAAGGAAGAGGGGGAAGG + Intergenic
1192784171 X:74321530-74321552 TGAGGGAAGCCAGAAGGGGATGG - Intergenic
1192925740 X:75753211-75753233 TAGGGGAAGCTATAATGTGATGG - Intergenic
1194443624 X:93961731-93961753 TTGGGGAAGAAATATGGGGATGG + Intergenic
1194749197 X:97665689-97665711 TAGGGGTAGCAATGAGAGGGAGG + Intergenic
1194933931 X:99924472-99924494 GAGGGTAAGCAATAGGGAGAGGG - Intergenic
1194977793 X:100410808-100410830 TAGTGGAAGGAAGAAAGGGAAGG + Intergenic
1195304314 X:103564308-103564330 TAGTGGAAGGATGAAGGGGAAGG + Intergenic
1195372456 X:104191472-104191494 TAGGAGAACCAAAGAGGGGAAGG - Exonic
1195961031 X:110387051-110387073 CAGGGGAAGCTTTAAGGAGAAGG + Intronic
1196586612 X:117436473-117436495 TAGGAGAAGCAAAGAGTGGAGGG + Intergenic
1196613205 X:117737235-117737257 TAGGAGAACAAATAAGGGGTAGG + Intergenic
1197304227 X:124820877-124820899 AAGGGGAAGCAATACTGGTAAGG - Intronic
1197382710 X:125765371-125765393 AAGTGGAAGAAAAAAGGGGAAGG - Intergenic
1198015939 X:132610970-132610992 CAGGGGAAGAAAGAAGAGGAGGG + Intergenic
1198764868 X:140070247-140070269 CAGGTGAAGCAATAAGAGTATGG + Intergenic
1199696180 X:150344061-150344083 TAGGTGGAAAAATAAGGGGAGGG + Intergenic
1201576046 Y:15462187-15462209 GGGGGGAAACAATAAGGAGAAGG + Intergenic
1201788530 Y:17811057-17811079 TGGAGGAAGAAATAAAGGGAGGG - Intergenic
1201813023 Y:18094931-18094953 TGGAGGAAGAAATAAAGGGAGGG + Intergenic