ID: 933215833

View in Genome Browser
Species Human (GRCh38)
Location 2:79629098-79629120
Sequence GGCATAGGGGAAGCAATAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 187}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933215833_933215841 -1 Left 933215833 2:79629098-79629120 CCCCTTATTGCTTCCCCTATGCC 0: 1
1: 0
2: 1
3: 10
4: 187
Right 933215841 2:79629120-79629142 CAGCCATATTGGCCCTCGTGTGG 0: 1
1: 0
2: 0
3: 2
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933215833 Original CRISPR GGCATAGGGGAAGCAATAAG GGG (reversed) Intronic
900015029 1:142301-142323 TGCATAGGAGAGGCAATATGTGG + Intergenic
900045295 1:500910-500932 TGCATAGGAGAGGCAATATGTGG + Intergenic
900067492 1:742640-742662 TGCATAGGAGAGGCAATATGTGG + Intergenic
905762638 1:40572885-40572907 AGCATAGAGAAAGAAATAAGGGG - Intergenic
906124545 1:43419672-43419694 GGCATAGGAGAAGGAAGAACAGG - Intronic
907698995 1:56765184-56765206 GCCATATGGGAAGTAATAACAGG - Intronic
908089431 1:60670682-60670704 GGCAAAGGGGGAGGAAAAAGGGG + Intergenic
913239197 1:116814144-116814166 GCAATAGGGGAAGCTATAATGGG - Intergenic
916739759 1:167637801-167637823 GCCATAGTGGAAGGAATGAGCGG - Intronic
918458307 1:184749998-184750020 CATATAGGGGAAGCAATAAATGG - Intronic
918532929 1:185542834-185542856 GGCAGATGAGAAGCAAGAAGAGG - Intergenic
918953861 1:191179503-191179525 AGGATAGGGGAAAGAATAAGAGG - Intergenic
920278997 1:204829191-204829213 AGAATAGGGGAGGCAAGAAGGGG - Intronic
922102094 1:222485414-222485436 TGCATAGGAGAGGCAATATGTGG + Intergenic
924138410 1:240996554-240996576 GGAAAAGTGGAAGCAATAAAGGG - Intronic
924333294 1:242962315-242962337 GGCATAGGGGAAGCATTCTTGGG + Intergenic
924345019 1:243065534-243065556 TGCATAGGAGAGGCAATATGTGG + Intergenic
1062975026 10:1676830-1676852 GTCACAGGGGAAGCATGAAGAGG + Intronic
1064065803 10:12180493-12180515 GGAATAAGGGAAACAAAAAGAGG + Intronic
1065217105 10:23459729-23459751 GGCAGAGAGGAAGCAATAGAGGG - Intergenic
1066731315 10:38439543-38439565 TGCATAGGAGAGGCAATATGTGG - Intergenic
1069241336 10:66143770-66143792 GGCAAAGGGAATGGAATAAGTGG - Intronic
1069407832 10:68121512-68121534 GACATCGGGGAAACAATGAGAGG + Exonic
1069612158 10:69781427-69781449 GGCAGAGGGGAAGCAGCCAGTGG + Intergenic
1071521453 10:86333828-86333850 GGCTGAGGGGGAGGAATAAGAGG + Intronic
1072570633 10:96654808-96654830 GGCATGGGGAAAGCAGAAAGTGG + Intronic
1072914112 10:99526718-99526740 GGGATAGGGGAAGGAATGTGAGG + Intergenic
1074931137 10:118127520-118127542 GGCATAGGGGACAGAAAAAGTGG - Intergenic
1075276568 10:121098742-121098764 GGCATATGGTAAATAATAAGTGG - Intergenic
1076971622 11:137401-137423 TGCATAGGAGAGGCAATATGTGG + Intergenic
1080843299 11:36004551-36004573 TGCATAGTGCAAGCAATCAGTGG + Intronic
1081270720 11:41079054-41079076 GCCAGATGGGAAGCTATAAGAGG - Intronic
1081349920 11:42038620-42038642 GGCAAAGAGGAAGAAAAAAGAGG + Intergenic
1082262386 11:50086722-50086744 TGCATAGGAGAGGCAATATGTGG + Intergenic
1088119939 11:106356623-106356645 AGCCTAGTGGAAGCAAAAAGTGG - Intergenic
1088171075 11:106997593-106997615 GCCATAGGGGAAGCAAGATAGGG + Intronic
1088477955 11:110263420-110263442 CCCATAGGGTAAGCAATAAATGG - Intronic
1090113154 11:123938318-123938340 TTCATAGGGGAAGCAGCAAGAGG - Intergenic
1093247411 12:16756845-16756867 GGCCTAGGGCAAGAAATAAAGGG - Intergenic
1093253985 12:16842803-16842825 GGCATAAATGCAGCAATAAGAGG - Intergenic
1093538698 12:20254299-20254321 GGCATAAGCAAAGCACTAAGGGG - Intergenic
1094409152 12:30150660-30150682 GGCATAGTTGAAGCAATACTTGG + Intergenic
1095220765 12:39611303-39611325 GGCATAGGGGAAACTATGGGGGG + Intronic
1096738629 12:53675917-53675939 GGGATAGCGGAAGCAAGAAAGGG + Intronic
1098168751 12:67724090-67724112 GGAATGGGAGAAGCAATAAGAGG - Intergenic
1100059054 12:90550125-90550147 GTCACAGGGGGAGCAATAATTGG + Intergenic
1100281422 12:93121685-93121707 GGCTTAGGACAAGCAATAAGAGG - Intergenic
1107888962 13:44897330-44897352 GGGAGAAGGGAAGCAATAAAAGG + Intergenic
1107987774 13:45790438-45790460 GCCACAAGGGAAGGAATAAGTGG + Intronic
1110141162 13:72131208-72131230 GACATAAGAGAAGTAATAAGGGG + Intergenic
1110775043 13:79398187-79398209 GGCACAAAGGAAGCAAGAAGAGG + Intronic
1112089951 13:96072594-96072616 GGCATAGGAGAGGGAAGAAGAGG + Intergenic
1113034798 13:106037268-106037290 GGGGTAGGGGAAGCAAGCAGGGG - Intergenic
1114570248 14:23661802-23661824 GGCTTATGGCAAGCAGTAAGAGG - Intergenic
1114612239 14:24050827-24050849 GGAATAGGGGAAGCAAGGAAGGG - Intergenic
1118071608 14:62251884-62251906 GGCATAGTGGAGGGAATAAATGG - Intergenic
1118593391 14:67418408-67418430 GGGATAGGGGAATGAATAATTGG - Intergenic
1120555467 14:85924758-85924780 GTAATAGGGGAAACAATATGAGG - Intergenic
1121223123 14:92301371-92301393 GCAATAAGGGAAGCAACAAGGGG + Intergenic
1121356825 14:93222818-93222840 GGCTAAGGGGAATGAATAAGAGG + Intronic
1122293497 14:100692362-100692384 AGCATAGAGAAAGCAAAAAGTGG + Intergenic
1126460088 15:48905549-48905571 GGCTTAAGGAAAGCAAAAAGGGG + Intronic
1127324906 15:57885523-57885545 GGTTTGGGAGAAGCAATAAGAGG + Intergenic
1128432210 15:67607656-67607678 GGCTTAAGGGAAGGAAGAAGAGG + Intronic
1130747588 15:86672539-86672561 GGCAAAGGGGAGGCGAGAAGGGG - Intronic
1131325553 15:91440127-91440149 GACCTATGGGAAGAAATAAGGGG + Intergenic
1133443488 16:5840236-5840258 GACATAGGGGAAGCAAGATAAGG - Intergenic
1135465166 16:22678682-22678704 GGCAGAGGAGAAGAAATTAGTGG + Intergenic
1135736122 16:24933151-24933173 GGAATAGGGGAAGGAGGAAGAGG - Intronic
1137986441 16:53112357-53112379 GACTTTGGGGAAGAAATAAGTGG + Intronic
1139893212 16:70267812-70267834 GACAAAGGGGAAGCAAGATGAGG + Intronic
1140887593 16:79258629-79258651 GGCTTTGGGGAAGGAACAAGGGG + Intergenic
1141941540 16:87279161-87279183 GCCACAGGGGAAGAAATTAGAGG + Intronic
1141967728 16:87458265-87458287 GGCATGGGGGAAGGAAGAGGAGG + Intronic
1142103972 16:88292148-88292170 GGCAGAGGGGGAGCCAGAAGGGG + Intergenic
1142448626 16:90160121-90160143 TGCATAGGAGAGGCAATATGTGG - Intergenic
1142458859 17:75168-75190 TGCATAGGAGAGGCAATATGTGG + Intergenic
1145784733 17:27586506-27586528 GGCACAGGGGGAGCATGAAGAGG + Intronic
1148282645 17:46361172-46361194 GGCACATGAGTAGCAATAAGAGG - Intronic
1148304863 17:46579097-46579119 GGCACATGAGTAGCAATAAGAGG - Intronic
1150597632 17:66620385-66620407 AGAAAAGGGGAAGCAATAAGTGG + Intronic
1152140336 17:78532745-78532767 GGCAGGGGAGAAGCAAAAAGGGG + Intronic
1160648578 19:207681-207703 TGCATAGGAGAGGCAATATGTGG + Intergenic
1160967306 19:1752404-1752426 GGCAACGGGGAAGCAGGAAGGGG + Exonic
1165850212 19:38845785-38845807 GGCTTGGGGGAGGGAATAAGGGG + Intronic
1168067833 19:53929167-53929189 GGACTTGGGGAAGCAAAAAGGGG + Intronic
925671767 2:6317586-6317608 GGCAAAGGAGAAGCACTAACAGG - Intergenic
926680096 2:15656413-15656435 GGCAGATGGGATGCAGTAAGAGG - Intergenic
927274909 2:21254600-21254622 GGAACTGGGGAAGCAATGAGGGG - Intergenic
927429333 2:23013707-23013729 GGCAGAGGGGAAGTAAGAATAGG - Intergenic
927916433 2:26939477-26939499 GGCATTGGGGAAGAACTGAGTGG + Intronic
929958755 2:46480380-46480402 GGCGTAGGGGAAGCAGGGAGGGG - Intronic
930191207 2:48462279-48462301 AGCATAGGGGATGCAAAAATTGG + Intronic
931183597 2:59928372-59928394 GGCCTAGGGCAAGCATTAAGAGG - Intergenic
933215833 2:79629098-79629120 GGCATAGGGGAAGCAATAAGGGG - Intronic
937794354 2:125999325-125999347 GGCATAGTGGACCCAATTAGGGG + Intergenic
938202559 2:129387282-129387304 GGCATAGGTTATGCAATAAGAGG + Intergenic
941319530 2:164037870-164037892 GCCATAGTGGAAGCAAACAGAGG + Intergenic
942904498 2:181165025-181165047 GGCATAGGGAAAGCAAAAAGAGG + Intergenic
942948615 2:181697354-181697376 GGGATAGGGGAAGAAAAAAGGGG - Intergenic
946120331 2:217506521-217506543 GGGATGAGGGAAGCAATAAGGGG - Intronic
946812519 2:223541019-223541041 GGCAGAGTGGGAGCAAGAAGAGG - Intergenic
947827705 2:233117636-233117658 GGCATAGGGATACCAATAACAGG - Intronic
947944193 2:234085994-234086016 AGCATTGGAGAAGGAATAAGTGG + Intergenic
1169712718 20:8582516-8582538 GGAATAAGGGAAGCAATATAGGG - Intronic
1177421328 21:20861614-20861636 GGCATAGGGGAAGTCTAAAGTGG - Intergenic
1182866084 22:33605969-33605991 GGCAGAGGGGATGCAATCTGAGG + Intronic
1184416912 22:44357545-44357567 GGCACAGAGGCAGCAACAAGTGG - Intergenic
1184996447 22:48210682-48210704 GGAAAAGGGGAAGGGATAAGGGG + Intergenic
951449582 3:22821565-22821587 GGCACAGAGGTAGCAGTAAGTGG - Intergenic
954935025 3:54318602-54318624 GGCATAGGGGAAGTGGGAAGAGG - Intronic
957274829 3:78077372-78077394 GGGACAGGGGAAGCAAAATGGGG + Intergenic
957738642 3:84233900-84233922 GGCAATGGGGAAGCAAAAAGTGG - Intergenic
958506724 3:94988464-94988486 GGCAGAGGGAAAGCAAGAAAGGG - Intergenic
959863951 3:111244765-111244787 GGCATCTGGGAAGGAAGAAGAGG - Intronic
960263689 3:115596362-115596384 GGCAGAGGGAGAGAAATAAGAGG + Intergenic
961583521 3:127902983-127903005 GTCAGACGGGAAGAAATAAGGGG - Intergenic
962649393 3:137473429-137473451 GGCAGAGATGAAGCAATAGGTGG - Intergenic
966582287 3:181581622-181581644 GGGATTGGGGAGACAATAAGTGG + Intergenic
967124657 3:186412990-186413012 GGCACAGGGTAAACAATAAATGG - Intergenic
968369270 3:198212434-198212456 TGCATAGGAGAGGCAATATGTGG - Intergenic
968453978 4:688122-688144 GGCACTGGGGAAGCCATAACTGG - Intronic
971193561 4:24450268-24450290 GGCATGTGGGAAGCAAACAGAGG - Intergenic
975666116 4:76736707-76736729 GGCATATATGAAGGAATAAGTGG - Intronic
979257698 4:118622161-118622183 TGCATAGGAGAGGCAATATGTGG - Intergenic
979330649 4:119418401-119418423 TGCATAGGAGAGGCAATATGTGG + Intergenic
981635986 4:146879778-146879800 GGAATAGGGACAGCAAAAAGTGG + Intronic
982018964 4:151184651-151184673 GGCAGCAGGGAAGCAATCAGTGG - Intronic
982917989 4:161238123-161238145 GACATAAGGGAACCAATAACTGG + Intergenic
984935109 4:184882967-184882989 GTCATAGGGGCACAAATAAGTGG - Intergenic
986605278 5:9516819-9516841 GACACAGGGGAAGCACTGAGAGG + Intronic
987963299 5:24838353-24838375 GGCAGGGGGGAAGCAAAAAGGGG + Intergenic
988816146 5:34837002-34837024 TGCATAGAGGAAGCAGTATGGGG - Intergenic
989813663 5:45709410-45709432 GGGAGATAGGAAGCAATAAGAGG - Intergenic
990970155 5:61496898-61496920 GGCACATGAGAAGCAATAAAAGG - Intronic
994078780 5:95683090-95683112 GGCATAAGGGAAGGAGTGAGGGG + Intronic
994641608 5:102417373-102417395 GACAAATGGGAAGCAAGAAGAGG - Intronic
995659249 5:114462520-114462542 AGCACAGGGGAAGCACTGAGGGG + Intronic
999652471 5:153780994-153781016 GGCAGAAAGGAAGGAATAAGGGG + Intronic
1002728549 5:181318019-181318041 TGCATAGGAGAGGCAATATGTGG - Intergenic
1009938988 6:70267642-70267664 TGCAAAGGGAAAGCAATAAAGGG + Intronic
1010686201 6:78857648-78857670 GGCACAGGGAAAGCAAATAGAGG - Intergenic
1012229713 6:96746592-96746614 GGCAAGCGGGAAGCAATAAGGGG - Intergenic
1013931503 6:115539788-115539810 GGGATAGTGGAAGTAAAAAGTGG + Intergenic
1015235139 6:130962275-130962297 GGCAGAGGGGAAGGAGGAAGTGG + Intronic
1016009118 6:139120267-139120289 GGCAAAGGGAAAGCAATGATGGG - Intergenic
1022779809 7:33568894-33568916 GGCAAAGGGGTAGAAAGAAGGGG + Intronic
1023399682 7:39783420-39783442 TGCATAGGAGAGGCAATACGTGG - Intergenic
1024650720 7:51400958-51400980 TGCATAGGAGAGGCAATACGTGG + Intergenic
1025054841 7:55756544-55756566 TGCATAGGAGAGGCAATACGTGG + Intergenic
1025132916 7:56386769-56386791 TGCATAGGAGAGGCAATACGTGG + Intergenic
1025184551 7:56847189-56847211 TGCATAGGAGAGGCAATACGTGG + Intergenic
1025687378 7:63729779-63729801 TGCATAGGAGAGGCAATATGTGG - Intergenic
1025911081 7:65829302-65829324 TGCATAGGAGAGGCAATACGTGG - Intergenic
1025978628 7:66389548-66389570 TGCATAGGAGAGGCAATACGTGG + Intronic
1026129086 7:67605729-67605751 GGCAGAGGGGCAGAAACAAGAGG + Intergenic
1028405709 7:90471562-90471584 GGCATAGTGCAAAAAATAAGTGG + Intronic
1029199019 7:98826444-98826466 GGCACAGGAGAAGCAGCAAGAGG - Intergenic
1030669522 7:112320046-112320068 GGCATATGGGAAGCTACAAATGG + Intronic
1032050005 7:128642902-128642924 TGCATAGGAGAGGCAATACGTGG - Intergenic
1032346256 7:131119420-131119442 GGCATAGTGCAAGCTATCAGTGG + Intronic
1032457678 7:132086220-132086242 TGCACAGGAGAAGGAATAAGAGG + Intergenic
1035490787 7:159275942-159275964 GGGATAATGGAAGCAACAAGGGG - Intergenic
1036691402 8:10946971-10946993 GACAGAGAGGAAGGAATAAGGGG + Intronic
1037363617 8:18099468-18099490 GGCATAATGGAAGCCATAAAAGG - Intergenic
1038461313 8:27719708-27719730 AGCATAGGGGAATAAATAATAGG - Intergenic
1038929594 8:32178062-32178084 AGCATAGGAGAAGAAATAAAAGG + Intronic
1041030102 8:53728150-53728172 GGAATAATGGAAGCAATTAGAGG - Intronic
1041408902 8:57531986-57532008 TGCATAAGGGAAGAAAAAAGTGG + Intergenic
1042368041 8:67959036-67959058 GGCATAAGGAGAGCAATTAGAGG + Intronic
1045276654 8:100712532-100712554 GGAATAGGAGAAGAAATATGGGG - Intronic
1049971283 9:824320-824342 GGCATATAGAAAGCAATATGTGG + Intergenic
1051141097 9:13979618-13979640 GGCCTAGGGGTAGCAAAAAAGGG + Intergenic
1051565739 9:18495875-18495897 GGCATAGAGTAAGCATAAAGTGG - Intronic
1052772976 9:32706407-32706429 GGCATAGGGCCAGGATTAAGGGG - Intergenic
1056210182 9:84358004-84358026 GTAATAGGGGAATCAATGAGGGG - Intergenic
1059871430 9:118582300-118582322 GGTATAGGGTAGGTAATAAGTGG - Intergenic
1060463833 9:123884648-123884670 GGCACATAGGAAGCAGTAAGTGG - Intronic
1062753611 9:138275118-138275140 TGCATAGGAGAGGCAATATGTGG - Intergenic
1203576124 Un_KI270745v1:9897-9919 TGCATAGGAGAGGCAATATGTGG - Intergenic
1185755605 X:2650813-2650835 GACAGAGGGGAGGCAAGAAGGGG - Intergenic
1185867605 X:3637330-3637352 GTCATCCGGGAAGCAACAAGCGG + Intronic
1187506330 X:19881316-19881338 GGGAAAGGGGAAGGAACAAGAGG + Intronic
1188371797 X:29378830-29378852 GGCATGGTGGAAGTAATCAGAGG - Intronic
1189947438 X:46193644-46193666 GGCATATGTGAAGCAATACAGGG - Intergenic
1190635497 X:52428950-52428972 GGCATATGAAAAGAAATAAGGGG - Intergenic
1191915633 X:66198609-66198631 AGCATAGGATAAGAAATAAGAGG - Intronic
1192185157 X:68941703-68941725 GGCAGAGGCGAAGCAATGGGAGG + Intergenic
1193609176 X:83608043-83608065 GGCATAGGGGAAATAAGAAATGG - Intergenic
1193837768 X:86366794-86366816 GCAAGAGGGGAAGCAAAAAGGGG - Intronic
1193987721 X:88266588-88266610 GGCAGAGGGGAAGGAGAAAGAGG + Intergenic
1194531584 X:95055696-95055718 GGGATGGGGGAGGCTATAAGAGG - Intergenic
1196311945 X:114178664-114178686 GGCAGAGGAGAAGGAAGAAGAGG - Intergenic
1196613204 X:117737231-117737253 GACATAGGAGAACAAATAAGGGG + Intergenic
1198237261 X:134747034-134747056 GGTATAGAGTAGGCAATAAGGGG + Intronic
1198425681 X:136517732-136517754 GGCATACAAGAATCAATAAGGGG + Intergenic
1198527653 X:137518415-137518437 GGAATAAGGGAACTAATAAGAGG + Intergenic
1202391507 Y:24375072-24375094 GGCATAGGGGAAGCATTCTTGGG - Intergenic
1202479278 Y:25295045-25295067 GGCATAGGGGAAGCATTCTTGGG + Intergenic