ID: 933215834

View in Genome Browser
Species Human (GRCh38)
Location 2:79629099-79629121
Sequence TGGCATAGGGGAAGCAATAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 207}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933215834_933215841 -2 Left 933215834 2:79629099-79629121 CCCTTATTGCTTCCCCTATGCCA 0: 1
1: 0
2: 1
3: 18
4: 207
Right 933215841 2:79629120-79629142 CAGCCATATTGGCCCTCGTGTGG 0: 1
1: 0
2: 0
3: 2
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933215834 Original CRISPR TGGCATAGGGGAAGCAATAA GGG (reversed) Intronic
900950837 1:5857498-5857520 GGTCATCAGGGAAGCAATAATGG + Intergenic
901033128 1:6320004-6320026 GGGCATGGGGGAAGCAAGAGAGG + Intronic
901266290 1:7913364-7913386 TAGCTTAGGGGAAGAAATACAGG - Intergenic
901860996 1:12074227-12074249 TGGCACTAGGGAAGCATTAAAGG - Intronic
901954361 1:12773202-12773224 TGGCAGAGGGGAACCACTGAGGG - Intergenic
903925449 1:26827719-26827741 TGGCTGAGGGGAAGCAAAAGCGG - Intronic
904400103 1:30250595-30250617 TGGCATATGGGATGCACTTAGGG + Intergenic
904888171 1:33757544-33757566 TGGCATAAAGGAAGCAAGAGTGG - Intronic
905080730 1:35317929-35317951 TGTCATAGTGGAAGTAATACTGG + Intronic
905650600 1:39654050-39654072 TGGCATAGCGACAGCAATGATGG + Intergenic
907914645 1:58857685-58857707 AGGCATAGAGAAAGCAATGAAGG + Intergenic
910013536 1:82494565-82494587 TGGCTTAGAAGAAGCAATCAGGG - Intergenic
910469365 1:87535040-87535062 TGGCTAAGGGGCAGCCATAAGGG - Intergenic
910595990 1:88981453-88981475 TGGAAAAGGGGAAGTAATTAAGG - Exonic
911116422 1:94250407-94250429 TGGGAGAGGGGAAGAAGTAATGG + Intronic
911803278 1:102172934-102172956 TGGCATAGATGGAGGAATAAAGG + Intergenic
913239198 1:116814145-116814167 TGCAATAGGGGAAGCTATAATGG - Intergenic
915942999 1:160130621-160130643 TGGCATGGGGGAGGCTAGAATGG - Intronic
916983393 1:170164547-170164569 TGGCATAGTGTAAGTAAAAATGG + Intronic
917055665 1:170978575-170978597 TGGGCTAGGGGAAGGAACAAAGG - Intronic
917129933 1:171730777-171730799 TAGCATAAGGGAAGGCATAAGGG + Intronic
919796669 1:201325215-201325237 TGGAGTAGGGGAAGCACCAAGGG + Intronic
919843300 1:201624785-201624807 TAGCATAGGGGAAAAAATATAGG - Intronic
923992410 1:239453885-239453907 AGGGAGAGGGGAAGCAATGAAGG + Intronic
924138411 1:240996555-240996577 AGGAAAAGTGGAAGCAATAAAGG - Intronic
924333293 1:242962314-242962336 CGGCATAGGGGAAGCATTCTTGG + Intergenic
924685312 1:246283346-246283368 TAGCAAAGGGGATGTAATAATGG - Intronic
924941359 1:248814266-248814288 TGGAATATGGGAAGCAATGGAGG + Intronic
1064947274 10:20805009-20805031 TGACATAAGGGTAGCAACAATGG + Intronic
1065217106 10:23459730-23459752 TGGCAGAGAGGAAGCAATAGAGG - Intergenic
1066070459 10:31803816-31803838 TGGGAGAAGGGAAGCAATGAAGG + Intergenic
1068866206 10:61897743-61897765 TGGCTGAGGGGGAGCAAGAAAGG + Intergenic
1070488148 10:76950806-76950828 TTGCAGAGGGAAACCAATAATGG - Intronic
1071003161 10:80854109-80854131 TGTCAAAAGGGAAGAAATAAAGG + Intergenic
1073464394 10:103685617-103685639 TGGCCTAGAGGAAGCACTAAGGG - Intronic
1074339935 10:112618600-112618622 TGGCCTAGGGGAAGGAGGAAGGG + Intronic
1075749685 10:124755603-124755625 TGGGGTAGGGGAAGGAAGAATGG - Intronic
1076292490 10:129357837-129357859 TGCCATAGGGAAAGAAAGAACGG + Intergenic
1078144066 11:8711153-8711175 TGGCATCAGGGAAGCAAAACTGG + Exonic
1079570830 11:21941867-21941889 TGGCATATGGGAAGCTAGAATGG + Intergenic
1079886010 11:25989834-25989856 TGGCATAGGTAAACAAATAAAGG + Intergenic
1087074632 11:94117995-94118017 TGGCAAAGGAGAAGTAACAAAGG - Intergenic
1087194411 11:95291098-95291120 TGGGATAGGGGTAGTCATAAAGG + Intergenic
1087435207 11:98107871-98107893 TGACATACAGGAAGAAATAAAGG - Intergenic
1087678883 11:101195483-101195505 AGGCAATGAGGAAGCAATAAAGG + Intergenic
1088171074 11:106997592-106997614 AGCCATAGGGGAAGCAAGATAGG + Intronic
1088259297 11:107928927-107928949 GGGCAAAGGGGAAGCGAGAATGG - Intronic
1091143643 11:133258404-133258426 GGGCATAGGTGAAGGAAGAAGGG + Intronic
1093213466 12:16334925-16334947 TGTCAAAGGAGAAGCAATATAGG + Intergenic
1093247412 12:16756846-16756868 TGGCCTAGGGCAAGAAATAAAGG - Intergenic
1094260960 12:28499082-28499104 TAGCATAGGGGAAGCTTTTATGG + Intronic
1095217858 12:39570550-39570572 TTGCATATGGTGAGCAATAAGGG - Intronic
1096738628 12:53675916-53675938 AGGGATAGCGGAAGCAAGAAAGG + Intronic
1098217684 12:68237292-68237314 TTGCAAAGGGGAAGAAAAAAGGG + Intergenic
1099674340 12:85738750-85738772 TTGCATAGGGGTAGAAATCAAGG - Intergenic
1100013088 12:89977033-89977055 TGGCATTTAGGAAGCAATACAGG + Intergenic
1101752514 12:107594066-107594088 TGCCAGAGGGGATGCATTAAGGG + Intronic
1102035956 12:109770662-109770684 TGGAATAGGGGAAGCACTGAGGG - Intergenic
1103970713 12:124669420-124669442 AGGCAAAGGGGAAGCATGAAAGG + Intergenic
1106115063 13:26810597-26810619 TAGCTTAGGGGAAGAAATACGGG - Intergenic
1106218565 13:27725098-27725120 GAGCACTGGGGAAGCAATAAGGG - Intergenic
1108722282 13:53144706-53144728 TGGCATAGGAAAAAAAATAAAGG - Intergenic
1108839360 13:54593277-54593299 TGGCATAGGGGATGCAGTGGTGG - Intergenic
1109425358 13:62160018-62160040 TTACATAGGTGTAGCAATAATGG - Intergenic
1110060649 13:71034104-71034126 TGGTACAGGGGAAGGAACAAAGG + Intergenic
1110141161 13:72131207-72131229 TGACATAAGAGAAGTAATAAGGG + Intergenic
1112206329 13:97327001-97327023 TGAAAGTGGGGAAGCAATAAAGG - Intronic
1112482088 13:99785512-99785534 TGGAAAGGGGGAAACAATAATGG - Intronic
1112910450 13:104476471-104476493 TGGCAATGGGGAAGGCATAATGG + Intergenic
1113034799 13:106037269-106037291 TGGGGTAGGGGAAGCAAGCAGGG - Intergenic
1114612240 14:24050828-24050850 GGGAATAGGGGAAGCAAGGAAGG - Intergenic
1115951105 14:38722416-38722438 TGTCATATGTAAAGCAATAAAGG - Intergenic
1117088878 14:52229389-52229411 TGGTATGTGGGAAGCAATATAGG + Intergenic
1118592397 14:67411431-67411453 TGGCACTGGGGAGGCAGTAAAGG + Intronic
1119252335 14:73167618-73167640 TGGAATAGGGTAAGGGATAAAGG - Intronic
1121032700 14:90672780-90672802 AGGCACAGGGGAAGCAACAAAGG - Intronic
1121223122 14:92301370-92301392 TGCAATAAGGGAAGCAACAAGGG + Intergenic
1121694499 14:95901685-95901707 TGGCACAGGGGCTGCAATGAAGG + Intergenic
1121787556 14:96673829-96673851 TGGCATTGGAGATGCTATAATGG - Intergenic
1121814081 14:96915725-96915747 AGGCAAAGGGGAAGCAAAAGGGG - Intronic
1121951844 14:98177684-98177706 TGTCAGAGGGGATGCAAGAAAGG + Intergenic
1125347850 15:38737147-38737169 TGTCATAGAAGAAGCCATAATGG + Intergenic
1127832594 15:62763891-62763913 TGGCTTGGGGGAAGGAATACAGG + Intronic
1127835638 15:62788903-62788925 TGTCACAGGGGAAGGAACAAAGG + Intronic
1130747589 15:86672540-86672562 TGGCAAAGGGGAGGCGAGAAGGG - Intronic
1131377555 15:91938017-91938039 TGGCTCAGAGGAAGCAATCAGGG + Intronic
1133682335 16:8131499-8131521 AGGCAAAGGGGAAGCAAGCATGG - Intergenic
1137965838 16:52932494-52932516 TGGCATAGGAAAAGAAAAAAAGG - Intergenic
1144585536 17:16485402-16485424 TGGCATGGTGGAAGGAATGAAGG - Intronic
1146536342 17:33656012-33656034 TGGCATAGTGGAAGTAGAAAGGG + Intronic
1146588255 17:34101890-34101912 TGGCATAGGTAAATCAAGAATGG - Intronic
1147931298 17:43983329-43983351 TGAGATAAGGGAAGCAGTAAAGG + Intronic
1149618971 17:58027441-58027463 TTGAATAGGTGAAGCAATCAGGG + Intergenic
1150827369 17:68488774-68488796 TGGCAGAGGGAAAGGAATGATGG - Intergenic
1203162915 17_GL000205v2_random:68249-68271 TGGCCAAGGGGAAGAACTAAGGG - Intergenic
1153671710 18:7418392-7418414 CTGCATAGGGGAAGGAATTAGGG - Intergenic
1156066211 18:33146525-33146547 TGGCATATGGGAAGCTACATGGG + Intronic
1160503524 18:79414355-79414377 TGGCATAGGGACAGGATTAATGG - Intronic
1165575198 19:36809457-36809479 TAACATAGAGGAAGGAATAAAGG + Intergenic
1165850211 19:38845784-38845806 TGGCTTGGGGGAGGGAATAAGGG + Intronic
1166635076 19:44444083-44444105 TGGCACACGGGAAGCACTTAAGG + Intronic
1166813186 19:45526393-45526415 TGGCAGAGGGGAAGGACCAAAGG - Exonic
1168162065 19:54517413-54517435 GGGCAGAGAGGAAGCAAAAAGGG - Intergenic
925752966 2:7106205-7106227 TGACATAGGGCAAGCAGCAATGG + Intergenic
926911778 2:17858237-17858259 TGGCTTAGGATAAGCAAGAACGG - Intergenic
927274910 2:21254601-21254623 TGGAACTGGGGAAGCAATGAGGG - Intergenic
927824150 2:26296015-26296037 TGGAAAGGGGGAAGCAAAAAGGG - Intergenic
928359785 2:30653807-30653829 TTGTATAAGGGCAGCAATAAGGG + Intergenic
928360157 2:30656086-30656108 GGCCATAGGGTAAGAAATAAAGG + Intergenic
929714201 2:44293871-44293893 TGGTAAAGGGGGAACAATAATGG + Intronic
929958756 2:46480381-46480403 TGGCGTAGGGGAAGCAGGGAGGG - Intronic
931984735 2:67730624-67730646 AGGTAAAGGGAAAGCAATAAGGG + Intergenic
933215834 2:79629099-79629121 TGGCATAGGGGAAGCAATAAGGG - Intronic
934095486 2:88598698-88598720 AGGCATAGAGGATGCTATAAAGG + Intronic
934616694 2:95775683-95775705 TGGTATAGAGCAAGCAAGAAAGG - Intergenic
934644196 2:96048877-96048899 TGGTATAGAGCAAGCAAGAAAGG + Intergenic
935222913 2:101029996-101030018 TGGCATGGGGGAAATAAAAAAGG + Intronic
939429278 2:142082224-142082246 TGGCATATGGGAAGTAATTCAGG - Intronic
939571053 2:143840187-143840209 TGTGCTATGGGAAGCAATAATGG + Intergenic
940965787 2:159836088-159836110 TGGCATAGTGGAAAGAATATGGG + Intronic
941263052 2:163321124-163321146 TAGCAGAGGGAAACCAATAATGG - Intergenic
942133699 2:172905092-172905114 GGGGATAGGGGAAGCGAGAAAGG - Intronic
942948616 2:181697355-181697377 AGGGATAGGGGAAGAAAAAAGGG - Intergenic
944095097 2:195957162-195957184 TGGCTTATTGGAAACAATAATGG + Intronic
944672651 2:202007964-202007986 TGGCTCAGGGGGAGAAATAAAGG + Intergenic
946120332 2:217506522-217506544 GGGGATGAGGGAAGCAATAAGGG - Intronic
1168985112 20:2041231-2041253 TAGCTTAGGGGAAGAAATACGGG - Intergenic
1169687887 20:8296705-8296727 TGGGACAGGGGGATCAATAAAGG - Intronic
1169712719 20:8582517-8582539 GGGAATAAGGGAAGCAATATAGG - Intronic
1170496017 20:16926126-16926148 TTGCATAGAGGAAGGATTAATGG - Intergenic
1175078167 20:56393240-56393262 TGGTGTAGGGGAACCAAAAATGG + Intronic
1178773484 21:35527434-35527456 TGGAACAGGGGAAACAATAATGG + Intronic
1180081233 21:45488744-45488766 GGGCATAGGGGAAGAACTCAGGG + Intronic
1182397766 22:30048667-30048689 TGGGACAGAGGAAGAAATAATGG + Intergenic
1184132032 22:42522514-42522536 TGGCATATGGGCTGCACTAAAGG + Intergenic
949156045 3:828402-828424 AGGCATAGAGAAAGAAATAAGGG + Intergenic
951022520 3:17796655-17796677 TGGCCTAGGGCAAGCAGTGAAGG - Intronic
951475506 3:23101622-23101644 TGGGGTAGAGGAAGCAATAAGGG - Intergenic
956331501 3:68115348-68115370 TATCATCTGGGAAGCAATAATGG - Intronic
956762872 3:72459243-72459265 TGGCAGAGGAGAAGCAAAAAAGG + Intergenic
957274828 3:78077371-78077393 TGGGACAGGGGAAGCAAAATGGG + Intergenic
958457322 3:94348027-94348049 TAGCTTAGGGGAAGCAGTACAGG - Intergenic
958506725 3:94988465-94988487 GGGCAGAGGGAAAGCAAGAAAGG - Intergenic
959284924 3:104396801-104396823 TAGCATAGGAAAACCAATAAGGG - Intergenic
959386285 3:105712517-105712539 TGGCATTTGGAGAGCAATAAGGG - Intronic
962433938 3:135347303-135347325 TGGCAGAGGGGAAGCTGGAAAGG - Intergenic
962923195 3:139969419-139969441 TGGCACAGGGGAGGCACTCAAGG - Intronic
965661083 3:171042530-171042552 GGGCAGGGGGGAAGAAATAAAGG - Intergenic
965699550 3:171445831-171445853 TGGCATAGTGCAAGGAAGAATGG - Intronic
972687683 4:41366968-41366990 AGGCAAAGGGGAAGCAAGACAGG + Intronic
972782948 4:42301692-42301714 TGGAATCTGGGAAGAAATAAGGG - Intergenic
974259650 4:59509334-59509356 AGGCAAAGGGGAAGCAAGACAGG - Intergenic
975769362 4:77704780-77704802 TGGCAAATGGGAAGCTTTAATGG + Intergenic
976953884 4:90869373-90869395 TTGCATATGGGTAGCAATAGGGG + Intronic
977830209 4:101581850-101581872 TGGCATATGGGACACCATAAAGG - Intronic
979661900 4:123265569-123265591 TGGCATAGAGTTAGCAATACAGG - Intronic
980875079 4:138653462-138653484 TGTCATGGGGGAAGAAAAAAGGG - Intergenic
983476414 4:168217564-168217586 TGGCAAAGGGGAATGAATTATGG + Intronic
983664059 4:170163035-170163057 TGGCATATAGTAAGCACTAAGGG - Intergenic
983695049 4:170518000-170518022 TAGCTTAGGGGAAGAAATATAGG + Intergenic
985022004 4:185701724-185701746 TGGGAGAGGGCAAACAATAATGG + Intronic
986357623 5:6944079-6944101 TGGCAGAGGAAAAGGAATAAAGG - Intergenic
987963298 5:24838352-24838374 GGGCAGGGGGGAAGCAAAAAGGG + Intergenic
988407603 5:30843736-30843758 TGGCAGAGGGAAAGGCATAAGGG - Intergenic
988586897 5:32514912-32514934 TCCCATAGGGGACACAATAATGG + Intergenic
988816147 5:34837003-34837025 TTGCATAGAGGAAGCAGTATGGG - Intergenic
991484259 5:67118177-67118199 TGTCAGAGAGGAAGTAATAATGG - Intronic
992361221 5:76040579-76040601 TGTCACAGAGGAAGCAAAAATGG + Intergenic
996981939 5:129507737-129507759 AGACATAGGGAAAGCAATAGAGG + Intronic
999386279 5:151156537-151156559 GGGCAAGGGGGAAGGAATAATGG + Intronic
999849744 5:155525134-155525156 TGGCTGAGGGGAAGAAATGAAGG + Intergenic
1004816620 6:19318206-19318228 TGGCATATAAGAAGCACTAAGGG - Intergenic
1007926482 6:45653550-45653572 TGGAGTAGGGTGAGCAATAAAGG + Intronic
1009938987 6:70267641-70267663 GTGCAAAGGGAAAGCAATAAAGG + Intronic
1011678145 6:89756574-89756596 TTGCATAGAAGAAGCAATAATGG - Intronic
1012229714 6:96746593-96746615 AGGCAAGCGGGAAGCAATAAGGG - Intergenic
1012526958 6:100189517-100189539 TGGCAGAAGGCAAGCAAAAAAGG + Intergenic
1014297958 6:119643549-119643571 TGTCATAGGGGAAGGAACATAGG + Intergenic
1014457788 6:121656574-121656596 AGGCATATGGGAACCATTAAAGG - Intergenic
1016009119 6:139120268-139120290 AGGCAAAGGGAAAGCAATGATGG - Intergenic
1019474962 7:1240103-1240125 TGGCAGAGGGGAATAAATAGGGG + Intergenic
1020842544 7:13237738-13237760 TGGAATATGGTAAGCAAAAAAGG - Intergenic
1021482037 7:21128791-21128813 TGCCATTGGGGCAGCAAAAATGG + Intergenic
1022779808 7:33568893-33568915 TGGCAAAGGGGTAGAAAGAAGGG + Intronic
1023076769 7:36490992-36491014 TGGCACAGGGAAAGAAATAAGGG - Intergenic
1023076785 7:36491139-36491161 TGGCACAGGGAAAGAAATAAGGG - Intergenic
1024489551 7:49963550-49963572 TGGCATAAGGGAACCATTTAGGG + Intronic
1024854428 7:53761396-53761418 TGGCCTTGGAGAAGCAATGAAGG + Intergenic
1027167269 7:75843890-75843912 TGGCATAAGGGCAGGATTAATGG + Intronic
1029506871 7:100968140-100968162 AGGCAGAGGGGAGGCAAGAAGGG - Exonic
1031023149 7:116650176-116650198 TGGCAAAGGAGTTGCAATAATGG - Intergenic
1032460779 7:132108733-132108755 TGGATTAAGGGAACCAATAAAGG - Intergenic
1032698669 7:134359650-134359672 TGGCACAGGGGAGACAGTAAAGG - Intergenic
1032946133 7:136855064-136855086 TGGCATAATGGTAGGAATAAAGG - Intergenic
1033873851 7:145790361-145790383 GGGCATAAGAGAAGGAATAAAGG - Intergenic
1036089813 8:5653318-5653340 TGGCATAGAGGAAGTAATTAAGG + Intergenic
1036530006 8:9576395-9576417 AGGCAAAGGGGAAGCAATCATGG + Intronic
1037295133 8:17391497-17391519 TGGCATAGAGAAAGCACTCAAGG + Intronic
1038915892 8:32022375-32022397 TGGCATAGAGGAAGAAATAAAGG - Intronic
1039118489 8:34119026-34119048 TGCCACAGGGGAAACAACAAGGG - Intergenic
1042077621 8:65013759-65013781 TGGCTTTTGGGAAGCAATCAGGG - Intergenic
1042889146 8:73587797-73587819 TGGCAAAGGGGAAGCAGAAATGG + Intronic
1043087941 8:75859636-75859658 TGGCATTGGGGAAGAAACATTGG + Intergenic
1046738152 8:117799675-117799697 TGGGGGAGGGGAAGCAAGAAGGG - Exonic
1047663635 8:127065855-127065877 TGCCCCAGGGGAGGCAATAAAGG - Intergenic
1047876792 8:129147583-129147605 AGGCAAAGGGGAAGCAGAAATGG + Intergenic
1048552542 8:135447252-135447274 GGGCATTGGAGAAGGAATAAAGG - Intergenic
1051141096 9:13979617-13979639 AGGCCTAGGGGTAGCAAAAAAGG + Intergenic
1052772977 9:32706408-32706430 TGGCATAGGGCCAGGATTAAGGG - Intergenic
1058415236 9:104780666-104780688 TGGTATAGGGGAAGCTACAAAGG - Intergenic
1058972999 9:110100382-110100404 TCACATAGGGGAAGCAACAGAGG + Intronic
1059453139 9:114383342-114383364 TGGCATAGAGGAAGCGCTTAGGG - Intronic
1059713716 9:116893799-116893821 TGGGATAGAGAAAGCAATTATGG - Intronic
1185860469 X:3574032-3574054 TGGCAGAGGGGAAGTCATCAGGG + Intergenic
1186761657 X:12729621-12729643 TGGCAAAGGTGAAGCAATTTTGG - Intergenic
1186978856 X:14937704-14937726 TGGCATAGGGGGAATAATACTGG + Intergenic
1187817656 X:23250191-23250213 TGGTATAGTGGAAAAAATAATGG + Intergenic
1189947439 X:46193645-46193667 AGGCATATGTGAAGCAATACAGG - Intergenic
1190540614 X:51474182-51474204 TAGCTTAGGGGAAGAAATACAGG + Intergenic
1190631416 X:52390630-52390652 TGGCATAAGAAAAGAAATAAGGG + Intergenic
1190639474 X:52468932-52468954 TGGCATAAGGAAAGAAATAAGGG - Intergenic
1194537373 X:95120913-95120935 TGGCATAGGGGAGACATTGAAGG + Intergenic
1194847779 X:98832975-98832997 TGGCTTTGAGGAAGCAAAAAGGG + Intergenic
1198237260 X:134747033-134747055 TGGTATAGAGTAGGCAATAAGGG + Intronic
1198461770 X:136870200-136870222 TGGAAAAGGGGAAGTAATTAAGG - Intronic
1202391508 Y:24375073-24375095 CGGCATAGGGGAAGCATTCTTGG - Intergenic
1202479277 Y:25295044-25295066 CGGCATAGGGGAAGCATTCTTGG + Intergenic