ID: 933215835

View in Genome Browser
Species Human (GRCh38)
Location 2:79629100-79629122
Sequence CTGGCATAGGGGAAGCAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 170}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933215835_933215841 -3 Left 933215835 2:79629100-79629122 CCTTATTGCTTCCCCTATGCCAG 0: 1
1: 0
2: 0
3: 13
4: 170
Right 933215841 2:79629120-79629142 CAGCCATATTGGCCCTCGTGTGG 0: 1
1: 0
2: 0
3: 2
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933215835 Original CRISPR CTGGCATAGGGGAAGCAATA AGG (reversed) Intronic
900942501 1:5810001-5810023 CTGACAGATGGGAAGCAATGAGG + Intergenic
901413079 1:9098566-9098588 CTGGCACAGGGTAAGCACTCAGG + Intergenic
903036257 1:20494503-20494525 CTGGCATCTGGAAAACAATAAGG + Intergenic
904578330 1:31521005-31521027 CAGGCAAAGGGGAAGAAAAATGG + Intergenic
906805111 1:48773108-48773130 CTGGCATACAGAAAGCAGTAAGG + Intronic
907256038 1:53179907-53179929 CTGGCAGAGGTGAAGCTCTAAGG + Intergenic
907275376 1:53314020-53314042 CTTGAATAGGGGAAGGAAGAAGG - Intronic
907617961 1:55944077-55944099 CAGGGATAGGGGAACCAACATGG + Intergenic
909936810 1:81560884-81560906 CTGGAATGGAGGAAGCAAAAGGG - Intronic
912240741 1:107905438-107905460 CAGGCACTGGGGAAGCATTATGG - Intronic
913072135 1:115309101-115309123 CTGGGATACCTGAAGCAATAAGG + Intronic
913579250 1:120209775-120209797 CAGGAACAGGGGAAGCAATTAGG - Intergenic
913628922 1:120688613-120688635 CAGGAACAGGGGAAGCAATTAGG + Intergenic
914561181 1:148821207-148821229 CAGGAACAGGGGAAGCAATTAGG - Intronic
914611653 1:149309001-149309023 CAGGAACAGGGGAAGCAATTAGG + Intergenic
915428149 1:155844102-155844124 CAGGAATTGGGGCAGCAATAGGG + Intronic
917129932 1:171730776-171730798 CTAGCATAAGGGAAGGCATAAGG + Intronic
917516086 1:175709811-175709833 CTGGCATATGGGAGGTACTAGGG - Intronic
920082504 1:203385590-203385612 ATGGCACAGGGGCAGCAACAGGG - Intergenic
921151738 1:212408284-212408306 CTGGCACAGGAGAAGCAGTCAGG + Intronic
1064354757 10:14606474-14606496 CTGGCATATGGGAAGTGTTATGG + Intronic
1064605445 10:17034174-17034196 GTGGAAAAGGGGAAGGAATAAGG + Intronic
1065552354 10:26881656-26881678 CTGGAATAGGGTAGGCTATAGGG + Intergenic
1066701164 10:38130080-38130102 CTGGAATAGGGAAATCCATAAGG - Intergenic
1068819517 10:61357666-61357688 CTGGCATTGGAGAGACAATAAGG + Intergenic
1069394727 10:67976485-67976507 GTGGAAGAGGTGAAGCAATAGGG + Intronic
1070484853 10:76920520-76920542 CTGGCACATAAGAAGCAATATGG - Intronic
1070876763 10:79820952-79820974 CTGACATTGTGGAAGCAATTTGG + Intergenic
1073464395 10:103685618-103685640 CTGGCCTAGAGGAAGCACTAAGG - Intronic
1073464721 10:103687781-103687803 CTGGCAGTGGGGAGGGAATAGGG - Intronic
1074016152 10:109536129-109536151 ATGGCATGGGGGTAGCATTAAGG + Intergenic
1075875861 10:125805011-125805033 CTGTGATGTGGGAAGCAATATGG + Intronic
1077578122 11:3399647-3399669 CTGGCCTAGGGGTAGCAGCAGGG - Intergenic
1078521610 11:12068423-12068445 CTGGTAGGGGGGAAACAATAGGG - Intergenic
1079234805 11:18680637-18680659 TTGGGATAGGGAAAGGAATATGG + Intergenic
1084232866 11:67765820-67765842 CTGGCCTAGGGGTAGCATCAGGG - Intergenic
1085316343 11:75547538-75547560 CTGGCTGGGGGGAAGCAATCTGG - Intergenic
1087402535 11:97685220-97685242 CTGGAATAGGTGGAGCAATACGG - Intergenic
1088669847 11:112130354-112130376 CTGGAATAGGGAAAACTATATGG + Intronic
1088947634 11:114530604-114530626 TTGGGACAGAGGAAGCAATATGG - Exonic
1089160273 11:116432035-116432057 CTGGCAGAGGGGAGGCAGCATGG - Intergenic
1092262908 12:6962063-6962085 CTGACATGGGGGAAGGAAGAGGG - Intergenic
1096668973 12:53186718-53186740 CTGGCATAGAGTAAGTGATATGG - Intronic
1101752513 12:107594065-107594087 CTGCCAGAGGGGATGCATTAAGG + Intronic
1102035957 12:109770663-109770685 CTGGAATAGGGGAAGCACTGAGG - Intergenic
1103028050 12:117589986-117590008 ATGTCATCGGGGAAGAAATAAGG + Intronic
1103140099 12:118540911-118540933 CAGGCATCAGGGAAGCAAGAGGG + Intergenic
1103679589 12:122682700-122682722 CTGGCAGAGGTGAAGAAAAATGG - Intergenic
1105210714 13:18255233-18255255 CTGGCACTGGGGAATCAACAGGG + Intergenic
1106115064 13:26810598-26810620 CTAGCTTAGGGGAAGAAATACGG - Intergenic
1106647959 13:31657001-31657023 CTGGCCTAGAGGAAGAAATTGGG - Intergenic
1109362754 13:61317334-61317356 ATGGCAGAGTGGAAGCAATCTGG - Intergenic
1112059097 13:95719193-95719215 CAGGCATATGGGAAGGGATATGG + Intronic
1115418444 14:33164805-33164827 CTGACACAGGAGAAGCAATGGGG - Intronic
1116144009 14:41040221-41040243 CTGCTATATGAGAAGCAATACGG + Intergenic
1117087974 14:52220837-52220859 CTGGAAAAGGGGATGCAAAAAGG + Intergenic
1121291161 14:92776699-92776721 CTGGGGTGGGGGAAGGAATATGG + Intergenic
1121662670 14:95647069-95647091 CTGGCACAGGGGCAGCAACAGGG - Intergenic
1121814082 14:96915726-96915748 AAGGCAAAGGGGAAGCAAAAGGG - Intronic
1125782189 15:42279561-42279583 CAGTCATAGAGGAAGCACTATGG + Intronic
1126994262 15:54421861-54421883 CTGGCATAGAGCAAGCATTCTGG - Intronic
1129910801 15:79224553-79224575 CTGCCAAAGGGGAAGCAGAATGG - Intergenic
1130681769 15:86003105-86003127 ATGGCAGAGGGGAAGCTAGAGGG + Intergenic
1131377554 15:91938016-91938038 CTGGCTCAGAGGAAGCAATCAGG + Intronic
1134790696 16:16986831-16986853 CTGACATAGGGGAAATAATGGGG - Intergenic
1135045980 16:19156233-19156255 CTGGCTTTGGGGAAGCAAGTTGG - Intronic
1140088297 16:71815960-71815982 GTGGCATAGGGGAAATAATCAGG - Intergenic
1141021090 16:80497160-80497182 ATGGCATAGGGGAAGGTATGTGG - Intergenic
1141622196 16:85242271-85242293 CTGGCAGAGGGGAAGCAGGAGGG - Intergenic
1141754138 16:85980110-85980132 GTGGCATTGGGGACGCAATGGGG + Intergenic
1145970613 17:28954340-28954362 CTGGCAAAGAGGAGGAAATAAGG + Intronic
1148519745 17:48261456-48261478 CTGGCATCCTGGAAGCAGTAGGG + Intronic
1148941792 17:51220757-51220779 CTGGCACATGGTAAGCACTAAGG - Intronic
1150229737 17:63543557-63543579 CTGCCTTATGGGAAGCAAGAGGG - Exonic
1150886500 17:69092118-69092140 CTGGCAAATGGGAAGGAATAAGG + Intronic
1152269542 17:79316004-79316026 CTTGCAAAGGGGAACTAATAGGG - Intronic
1156066210 18:33146524-33146546 GTGGCATATGGGAAGCTACATGG + Intronic
1160170773 18:76552093-76552115 CTGGCATAAGGGAAGACACATGG + Intergenic
1163025240 19:14507188-14507210 CTGGCATAGGGGAGGGAGGATGG - Intergenic
1165850210 19:38845783-38845805 CTGGCTTGGGGGAGGGAATAAGG + Intronic
1166325285 19:42046191-42046213 TTGGCATAGTGGAAGGAACAGGG - Intronic
1166505394 19:43368391-43368413 CTGGCTTAGGGGAAGGCAGAAGG - Intergenic
1166947259 19:46404777-46404799 CTGGCGTAGGGGAGGCAGTGGGG + Intergenic
1167043714 19:47038037-47038059 CTGGGATAGGGGAACCCAGAGGG + Intronic
926313449 2:11692174-11692196 CTGGCATATGTAAAGCAAAAAGG + Intronic
927824151 2:26296016-26296038 CTGGAAAGGGGGAAGCAAAAAGG - Intergenic
929958757 2:46480382-46480404 CTGGCGTAGGGGAAGCAGGGAGG - Intronic
931063389 2:58556405-58556427 CTAGCACAGGAGGAGCAATAGGG + Intergenic
933215835 2:79629100-79629122 CTGGCATAGGGGAAGCAATAAGG - Intronic
936457133 2:112683603-112683625 CTGGCATGGGGGAAACAACTTGG + Intergenic
940769478 2:157825096-157825118 CTTGCATAGGGAAAGAAATAAGG - Intronic
940965786 2:159836087-159836109 CTGGCATAGTGGAAAGAATATGG + Intronic
942117591 2:172743362-172743384 CTGGGGCAGGGGAAGCAAGAGGG - Intronic
942948617 2:181697356-181697378 CAGGGATAGGGGAAGAAAAAAGG - Intergenic
944907184 2:204274068-204274090 CAGGGATAAGGGAAGCATTATGG + Intergenic
948901400 2:240958496-240958518 CTGGCACAGGGGCAGCCATGTGG + Intronic
1168985113 20:2041232-2041254 CTAGCTTAGGGGAAGAAATACGG - Intergenic
1169252857 20:4073514-4073536 GTGGCATAGGGGAAGGACTGGGG - Intronic
1172942924 20:38666749-38666771 CTGGCATGGGTGAGGCAAGACGG - Intergenic
1177001866 21:15623119-15623141 CTGGTATAGAGGAAGAAACAAGG - Intergenic
1178421986 21:32450609-32450631 CTGGCCTAGGGGTAGCATCAGGG + Intronic
1180765540 22:18344182-18344204 CTGGCACTGGGGAATCAACAGGG - Intergenic
1180780775 22:18518210-18518232 CTGGCACTGGGGAATCAACAGGG + Intergenic
1180813489 22:18775517-18775539 CTGGCACTGGGGAATCAACAGGG + Intergenic
1181199671 22:21209847-21209869 CTGGCACTGGGGAATCAACAGGG + Intronic
1181649275 22:24249779-24249801 CTGGCACTGGGGAATCAACAGGG + Intergenic
1181702061 22:24627109-24627131 CTGGCACTGGGGAATCAACAGGG - Intronic
1182492584 22:30683250-30683272 CTGGCTTATGGGAAGAAGTATGG - Intergenic
1184462603 22:44647801-44647823 CTGGCACATGTGAAGCAGTATGG + Intergenic
1203227163 22_KI270731v1_random:85072-85094 CTGGCACTGGGGAATCAACAGGG - Intergenic
1203263590 22_KI270734v1_random:1199-1221 CTGGCACTGGGGAATCAACAGGG + Intergenic
949156044 3:828401-828423 CAGGCATAGAGAAAGAAATAAGG + Intergenic
950406628 3:12809058-12809080 CTGCTATAGGGAAAGCAATTCGG + Intronic
950845733 3:16014451-16014473 GTGGCACACAGGAAGCAATATGG + Intergenic
950928309 3:16765121-16765143 CTGGCAGATTGGAAACAATATGG + Intergenic
951072377 3:18346465-18346487 ATGACATTGGGGGAGCAATATGG + Intronic
951475507 3:23101623-23101645 ATGGGGTAGAGGAAGCAATAAGG - Intergenic
952592111 3:34968786-34968808 CTGGCATAGGGCATGTATTATGG - Intergenic
954788762 3:53114997-53115019 CTGGGATAGGTGGAGCAAGAGGG - Intronic
956601421 3:71026755-71026777 CTGGCATCTGGGAATCAAGATGG - Intronic
957274827 3:78077370-78077392 TTGGGACAGGGGAAGCAAAATGG + Intergenic
959386286 3:105712518-105712540 CTGGCATTTGGAGAGCAATAAGG - Intronic
959671314 3:108980558-108980580 CTAGCTTAGGGGAAGAAGTATGG - Intronic
961881618 3:130065428-130065450 CTGGCCTAGGGGTAGCATCAGGG - Intergenic
963216531 3:142754766-142754788 CTGGCATAGTGGCAGGAAAATGG + Intronic
963610871 3:147466260-147466282 CTGGGACAGGCAAAGCAATATGG + Intronic
964566433 3:158059417-158059439 CTGCCATAGGGCAAGCCACAAGG - Intergenic
966136062 3:176699440-176699462 CTGGCATAATAGAAGCACTAGGG - Intergenic
969822295 4:9730054-9730076 CTGGCCTAGGGGTAGCATCAGGG + Intergenic
970683715 4:18540796-18540818 CTGGCATAGGAGAAGAAGCAGGG - Intergenic
970781394 4:19741969-19741991 GTGGCATATGGGAAGCCACAAGG + Intergenic
970960835 4:21869525-21869547 CTGGAATTTGGGAAGAAATAGGG - Intronic
976413322 4:84742524-84742546 CTGGCTTAGAGGAAGCATTCTGG - Intronic
976953883 4:90869372-90869394 TTTGCATATGGGTAGCAATAGGG + Intronic
977199387 4:94098314-94098336 CTCCCATAGGGGTAGGAATAGGG - Intergenic
980875080 4:138653463-138653485 CTGTCATGGGGGAAGAAAAAAGG - Intergenic
982134716 4:152263827-152263849 CTGGCATTGTGGAAGTCATATGG + Intergenic
982528773 4:156511440-156511462 CAACCATAGTGGAAGCAATATGG + Intergenic
983448759 4:167885194-167885216 GTGGCTTAGTTGAAGCAATAGGG + Intergenic
988816148 5:34837004-34837026 ATTGCATAGAGGAAGCAGTATGG - Intergenic
989711514 5:44403092-44403114 CTGGCATAGGGGAAGTCTTCTGG + Intergenic
991124700 5:63056057-63056079 CTGGGATAGGGGAGGAAATGGGG - Intergenic
997731895 5:136187568-136187590 CTGTGATTGGGGAGGCAATATGG + Intronic
1004816621 6:19318207-19318229 CTGGCATATAAGAAGCACTAAGG - Intergenic
1005495830 6:26387161-26387183 CTGACATTGAGGAGGCAATATGG + Intronic
1006704071 6:36002086-36002108 CTTGCATAGGGGAAAAAATGTGG - Intronic
1007205821 6:40149749-40149771 CTGGCAAAAGGGAAGGAATATGG + Intergenic
1007472264 6:42098689-42098711 CTGGCCTAGGGGAAGCCAAGGGG + Intergenic
1007737222 6:43989454-43989476 CTGGCAAAGGGGAAGGATTTGGG + Intergenic
1007836978 6:44681531-44681553 CTGGCAGAGGGGAAAGAAGAGGG + Intergenic
1008319639 6:50093382-50093404 CTGTCATAGTGACAGCAATAAGG + Intergenic
1013825429 6:114205390-114205412 GAGGCATAGGGGAAGATATAGGG + Intronic
1015064474 6:129007117-129007139 AGGGCGTAGGGGAAGCAATCTGG + Intronic
1019472084 7:1226635-1226657 CTGGCCTGGGGGCACCAATAGGG + Intergenic
1019474961 7:1240102-1240124 GTGGCAGAGGGGAATAAATAGGG + Intergenic
1022034110 7:26517751-26517773 CTGGCATTGGGGATCCAATAGGG - Intergenic
1023076770 7:36490993-36491015 TTGGCACAGGGAAAGAAATAAGG - Intergenic
1023076786 7:36491140-36491162 TTGGCACAGGGAAAGAAATAAGG - Intergenic
1030229074 7:107186582-107186604 CTTTCATAAGGGAAGCAATAAGG + Exonic
1032237491 7:130138051-130138073 CTGGCATATAGTAAGCATTATGG + Intergenic
1034841608 7:154402842-154402864 CTGTTATTGGGAAAGCAATAAGG + Intronic
1034993037 7:155560004-155560026 CTGGCACAGGGGAAGCACCCAGG - Intergenic
1035085940 7:156257968-156257990 CTGGAAGAGGAGGAGCAATATGG - Intergenic
1037202100 8:16267924-16267946 CCTGTATAGGGGAAACAATAAGG - Intronic
1037231492 8:16664205-16664227 CTGACATAAAGGAAGAAATACGG + Intergenic
1038525181 8:28267190-28267212 CTGGCATTAAGTAAGCAATAGGG - Intergenic
1039118490 8:34119027-34119049 CTGCCACAGGGGAAACAACAAGG - Intergenic
1040997804 8:53419502-53419524 CTGGCTTAGTGAAAACAATAAGG + Intergenic
1041809104 8:61887534-61887556 CTGGCCTAGGGTCAGCATTAAGG + Intergenic
1042099491 8:65259289-65259311 CTGACATAGAGGCAGCCATATGG + Intergenic
1042749837 8:72146723-72146745 CTGGGAAAGGGGAAGGGATAGGG + Intergenic
1047672272 8:127161175-127161197 CTGGTATTGGAGAGGCAATAGGG + Intergenic
1048148485 8:131868986-131869008 CTGGCATATGGTTATCAATATGG - Intergenic
1050115849 9:2262744-2262766 CTGGCATCGAAGATGCAATATGG - Intergenic
1050209838 9:3240873-3240895 CTGGCATAGAGTAAGCATGACGG - Intronic
1052759587 9:32576753-32576775 CTAGCTTAGGGGAAGAAGTATGG + Intergenic
1053105660 9:35405840-35405862 CTCCCAAAGGGGAAGAAATAAGG + Intergenic
1055002506 9:71468303-71468325 CTGGGAGAGGGGAAGCAGGATGG - Intergenic
1059453140 9:114383343-114383365 CTGGCATAGAGGAAGCGCTTAGG - Intronic
1187727896 X:22222919-22222941 ATGATATAGGGGAAGCAGTATGG - Intronic
1190639475 X:52468933-52468955 TTGGCATAAGGAAAGAAATAAGG - Intergenic
1194847778 X:98832974-98832996 CTGGCTTTGAGGAAGCAAAAAGG + Intergenic
1199244876 X:145591783-145591805 CTGGCCTAGTGAAAGCAAAAGGG + Intergenic
1200167264 X:154045364-154045386 CTGCCACAGGGGAAGCAGCAGGG + Intronic