ID: 933215841

View in Genome Browser
Species Human (GRCh38)
Location 2:79629120-79629142
Sequence CAGCCATATTGGCCCTCGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 49}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933215833_933215841 -1 Left 933215833 2:79629098-79629120 CCCCTTATTGCTTCCCCTATGCC 0: 1
1: 0
2: 1
3: 10
4: 187
Right 933215841 2:79629120-79629142 CAGCCATATTGGCCCTCGTGTGG 0: 1
1: 0
2: 0
3: 2
4: 49
933215825_933215841 27 Left 933215825 2:79629070-79629092 CCTTCCCCACTCTCCACTTCCGT 0: 1
1: 0
2: 8
3: 59
4: 685
Right 933215841 2:79629120-79629142 CAGCCATATTGGCCCTCGTGTGG 0: 1
1: 0
2: 0
3: 2
4: 49
933215827_933215841 22 Left 933215827 2:79629075-79629097 CCCACTCTCCACTTCCGTCCCTT 0: 1
1: 0
2: 3
3: 52
4: 539
Right 933215841 2:79629120-79629142 CAGCCATATTGGCCCTCGTGTGG 0: 1
1: 0
2: 0
3: 2
4: 49
933215829_933215841 14 Left 933215829 2:79629083-79629105 CCACTTCCGTCCCTTCCCCTTAT 0: 1
1: 0
2: 6
3: 89
4: 1051
Right 933215841 2:79629120-79629142 CAGCCATATTGGCCCTCGTGTGG 0: 1
1: 0
2: 0
3: 2
4: 49
933215828_933215841 21 Left 933215828 2:79629076-79629098 CCACTCTCCACTTCCGTCCCTTC 0: 1
1: 0
2: 12
3: 115
4: 1150
Right 933215841 2:79629120-79629142 CAGCCATATTGGCCCTCGTGTGG 0: 1
1: 0
2: 0
3: 2
4: 49
933215830_933215841 8 Left 933215830 2:79629089-79629111 CCGTCCCTTCCCCTTATTGCTTC 0: 1
1: 0
2: 6
3: 97
4: 994
Right 933215841 2:79629120-79629142 CAGCCATATTGGCCCTCGTGTGG 0: 1
1: 0
2: 0
3: 2
4: 49
933215826_933215841 23 Left 933215826 2:79629074-79629096 CCCCACTCTCCACTTCCGTCCCT 0: 1
1: 0
2: 4
3: 62
4: 772
Right 933215841 2:79629120-79629142 CAGCCATATTGGCCCTCGTGTGG 0: 1
1: 0
2: 0
3: 2
4: 49
933215834_933215841 -2 Left 933215834 2:79629099-79629121 CCCTTATTGCTTCCCCTATGCCA 0: 1
1: 0
2: 1
3: 18
4: 207
Right 933215841 2:79629120-79629142 CAGCCATATTGGCCCTCGTGTGG 0: 1
1: 0
2: 0
3: 2
4: 49
933215835_933215841 -3 Left 933215835 2:79629100-79629122 CCTTATTGCTTCCCCTATGCCAG 0: 1
1: 0
2: 0
3: 13
4: 170
Right 933215841 2:79629120-79629142 CAGCCATATTGGCCCTCGTGTGG 0: 1
1: 0
2: 0
3: 2
4: 49
933215832_933215841 3 Left 933215832 2:79629094-79629116 CCTTCCCCTTATTGCTTCCCCTA 0: 1
1: 0
2: 0
3: 34
4: 347
Right 933215841 2:79629120-79629142 CAGCCATATTGGCCCTCGTGTGG 0: 1
1: 0
2: 0
3: 2
4: 49
933215831_933215841 4 Left 933215831 2:79629093-79629115 CCCTTCCCCTTATTGCTTCCCCT 0: 1
1: 0
2: 9
3: 79
4: 598
Right 933215841 2:79629120-79629142 CAGCCATATTGGCCCTCGTGTGG 0: 1
1: 0
2: 0
3: 2
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933215841 Original CRISPR CAGCCATATTGGCCCTCGTG TGG Intronic