ID: 933215841

View in Genome Browser
Species Human (GRCh38)
Location 2:79629120-79629142
Sequence CAGCCATATTGGCCCTCGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 49}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933215831_933215841 4 Left 933215831 2:79629093-79629115 CCCTTCCCCTTATTGCTTCCCCT 0: 1
1: 0
2: 9
3: 79
4: 598
Right 933215841 2:79629120-79629142 CAGCCATATTGGCCCTCGTGTGG 0: 1
1: 0
2: 0
3: 2
4: 49
933215832_933215841 3 Left 933215832 2:79629094-79629116 CCTTCCCCTTATTGCTTCCCCTA 0: 1
1: 0
2: 0
3: 34
4: 347
Right 933215841 2:79629120-79629142 CAGCCATATTGGCCCTCGTGTGG 0: 1
1: 0
2: 0
3: 2
4: 49
933215835_933215841 -3 Left 933215835 2:79629100-79629122 CCTTATTGCTTCCCCTATGCCAG 0: 1
1: 0
2: 0
3: 13
4: 170
Right 933215841 2:79629120-79629142 CAGCCATATTGGCCCTCGTGTGG 0: 1
1: 0
2: 0
3: 2
4: 49
933215825_933215841 27 Left 933215825 2:79629070-79629092 CCTTCCCCACTCTCCACTTCCGT 0: 1
1: 0
2: 8
3: 59
4: 685
Right 933215841 2:79629120-79629142 CAGCCATATTGGCCCTCGTGTGG 0: 1
1: 0
2: 0
3: 2
4: 49
933215827_933215841 22 Left 933215827 2:79629075-79629097 CCCACTCTCCACTTCCGTCCCTT 0: 1
1: 0
2: 3
3: 52
4: 539
Right 933215841 2:79629120-79629142 CAGCCATATTGGCCCTCGTGTGG 0: 1
1: 0
2: 0
3: 2
4: 49
933215830_933215841 8 Left 933215830 2:79629089-79629111 CCGTCCCTTCCCCTTATTGCTTC 0: 1
1: 0
2: 6
3: 97
4: 994
Right 933215841 2:79629120-79629142 CAGCCATATTGGCCCTCGTGTGG 0: 1
1: 0
2: 0
3: 2
4: 49
933215833_933215841 -1 Left 933215833 2:79629098-79629120 CCCCTTATTGCTTCCCCTATGCC 0: 1
1: 0
2: 1
3: 10
4: 187
Right 933215841 2:79629120-79629142 CAGCCATATTGGCCCTCGTGTGG 0: 1
1: 0
2: 0
3: 2
4: 49
933215829_933215841 14 Left 933215829 2:79629083-79629105 CCACTTCCGTCCCTTCCCCTTAT 0: 1
1: 0
2: 6
3: 89
4: 1051
Right 933215841 2:79629120-79629142 CAGCCATATTGGCCCTCGTGTGG 0: 1
1: 0
2: 0
3: 2
4: 49
933215826_933215841 23 Left 933215826 2:79629074-79629096 CCCCACTCTCCACTTCCGTCCCT 0: 1
1: 0
2: 4
3: 62
4: 772
Right 933215841 2:79629120-79629142 CAGCCATATTGGCCCTCGTGTGG 0: 1
1: 0
2: 0
3: 2
4: 49
933215828_933215841 21 Left 933215828 2:79629076-79629098 CCACTCTCCACTTCCGTCCCTTC 0: 1
1: 0
2: 12
3: 115
4: 1150
Right 933215841 2:79629120-79629142 CAGCCATATTGGCCCTCGTGTGG 0: 1
1: 0
2: 0
3: 2
4: 49
933215834_933215841 -2 Left 933215834 2:79629099-79629121 CCCTTATTGCTTCCCCTATGCCA 0: 1
1: 0
2: 1
3: 18
4: 207
Right 933215841 2:79629120-79629142 CAGCCATATTGGCCCTCGTGTGG 0: 1
1: 0
2: 0
3: 2
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933215841 Original CRISPR CAGCCATATTGGCCCTCGTG TGG Intronic
901142468 1:7044029-7044051 CAGCCCTAATGGCCCTCTGGAGG - Intronic
904955843 1:34283279-34283301 CAGCCACACTGGCCTTCTTGGGG + Intergenic
908599355 1:65722588-65722610 AAGCCATATGGGGCCTCTTGGGG - Intergenic
913454432 1:119016589-119016611 GAGCCATATAAGCCCTCCTGTGG + Intergenic
915747719 1:158177708-158177730 CAGCGCTATGGGCTCTCGTGCGG - Intergenic
916762167 1:167826890-167826912 CAGCCATATTGGTCCTCTTTTGG - Intronic
921480490 1:215659326-215659348 CAGCCACACTGGCCTTCTTGAGG - Intronic
923306817 1:232696173-232696195 CAGCCAGATTGCCCCAGGTGGGG + Intergenic
1081010650 11:37807315-37807337 CAGACATACTGGCTCTGGTGTGG - Intergenic
1082902521 11:58270738-58270760 CGGCCATATTGGGCCGGGTGCGG - Intergenic
1084043477 11:66555881-66555903 CAGCCACTGTGGCCCTCGTGAGG - Intronic
1084701350 11:70788186-70788208 CATCCACAATGGCCCTGGTGGGG - Intronic
1095319327 12:40806743-40806765 CACACATATTGTCCCTAGTGTGG + Intronic
1096700374 12:53379438-53379460 TCGCCATATTGGCCCTCCTCAGG - Intergenic
1119096681 14:71839369-71839391 CAGCCAGATTTGCCCTTTTGAGG + Intergenic
1132416581 15:101624577-101624599 AAGCCATCCTGGCCCTCATGTGG + Intronic
1134552884 16:15146143-15146165 CTGCCATCCTGGCCCACGTGTGG - Intergenic
1134768195 16:16780931-16780953 CAGGCACACTGGCCCTCCTGAGG - Intergenic
1138448470 16:57079059-57079081 CAGCCATCTGGGCCCAGGTGGGG + Exonic
1147846238 17:43405945-43405967 CTGCCATCTTTGCCCTCATGAGG + Intergenic
1148076816 17:44941888-44941910 CAGCCACACTGGCCCTCAGGAGG - Intronic
1162299829 19:9838263-9838285 CTGCCACATTGGCCCACGTCTGG + Intronic
929572263 2:43030095-43030117 CAGCCACACTGGCCCTCATTGGG + Intergenic
931913969 2:66932908-66932930 CAGCCACAATGGCCCTCCTTTGG - Intergenic
931975301 2:67637634-67637656 CAGCCATATTCACCTCCGTGTGG + Intergenic
933215841 2:79629120-79629142 CAGCCATATTGGCCCTCGTGTGG + Intronic
1174042772 20:47711509-47711531 CAGCCAGATGGCCCGTCGTGGGG - Intronic
1174622469 20:51886387-51886409 CAGGCATTGTGGACCTCGTGAGG + Intergenic
952136503 3:30428480-30428502 CAGTCATATTGGCTCTACTGGGG + Intergenic
957151793 3:76495953-76495975 CAGCCATATTGTACTTCTTGAGG + Intronic
962426097 3:135270654-135270676 CAGCAACATGGGCCCTGGTGTGG - Intergenic
962940278 3:140119074-140119096 CAGGCATTTTGCCCCTCCTGGGG - Intronic
964135510 3:153340833-153340855 CAGCCATAGTGGCACAAGTGTGG - Intergenic
990256517 5:53976209-53976231 CAGCTATTTTGGTACTCGTGTGG - Intronic
1002696809 5:181097784-181097806 CACCCACATTGGCCCTCTTTGGG + Intergenic
1002697813 5:181101589-181101611 CACCCACATTGGCCCTCTTTGGG - Intergenic
1002707787 5:181174361-181174383 CACCCACATTGGCCCTCTTTGGG + Intergenic
1004516715 6:16327398-16327420 CAGCCACTTTGTCCCTCGGGAGG - Exonic
1005438203 6:25837391-25837413 CAGCCATTGTGGCCCTGATGGGG + Intronic
1007194782 6:40051063-40051085 CCCCCATATTGGCCCTTTTGAGG - Intergenic
1019765420 7:2846319-2846341 CAGCCATATTTGGCCTCCTATGG - Intergenic
1021395215 7:20139172-20139194 CAGCCTTAATGGCCCTAATGTGG + Exonic
1021515595 7:21481233-21481255 CAGACATCTTGCCCCTCCTGGGG + Intronic
1037692361 8:21192887-21192909 GAGCCACATTGTCCCTTGTGGGG - Intergenic
1046383004 8:113474737-113474759 CAGCCAGCTTGGCCATCCTGTGG + Intergenic
1057416179 9:94864040-94864062 CATCCAAATTGGCCCATGTGTGG - Intronic
1060510048 9:124225069-124225091 CAGTCACAGTGGCCCTTGTGAGG + Intergenic
1062454940 9:136631639-136631661 CATCCATGGTGGCCCTCCTGGGG - Intergenic
1186111849 X:6266161-6266183 GGGACAAATTGGCCCTCGTGTGG - Intergenic
1189942184 X:46136292-46136314 CAGCCATAGGGGGCCTTGTGTGG - Intergenic
1194033286 X:88841285-88841307 CAGCATTATTGGTCCTGGTGTGG + Intergenic
1199665419 X:150092785-150092807 CAGTCATAATGGCCCTCAAGAGG + Intergenic