ID: 933215910

View in Genome Browser
Species Human (GRCh38)
Location 2:79629717-79629739
Sequence GAGGGAGGAAAGGATGCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1046
Summary {0: 1, 1: 2, 2: 4, 3: 108, 4: 931}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933215903_933215910 15 Left 933215903 2:79629679-79629701 CCACAGGCATTATGATCTCAGTG 0: 1
1: 0
2: 1
3: 12
4: 152
Right 933215910 2:79629717-79629739 GAGGGAGGAAAGGATGCTGAAGG 0: 1
1: 2
2: 4
3: 108
4: 931
933215902_933215910 22 Left 933215902 2:79629672-79629694 CCAGGTGCCACAGGCATTATGAT 0: 1
1: 0
2: 2
3: 9
4: 125
Right 933215910 2:79629717-79629739 GAGGGAGGAAAGGATGCTGAAGG 0: 1
1: 2
2: 4
3: 108
4: 931

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933215910 Original CRISPR GAGGGAGGAAAGGATGCTGA AGG Intronic
900124137 1:1062109-1062131 GAGGGAGGGAATGGTGGTGAGGG - Intergenic
900156273 1:1204506-1204528 GAGGGAGGGAGGGAGGCTGGTGG + Intronic
900352318 1:2241072-2241094 GAGGGAGCCCAGGATGCTGTGGG + Intronic
900384015 1:2401217-2401239 GAGGGAGGAAGGGAGGAGGAGGG - Intronic
900391605 1:2436258-2436280 GAAGGAGGAAAGGAGGAGGAGGG - Intronic
900391687 1:2436492-2436514 GAAGGAGGAAAGGAGGAGGAGGG - Intronic
900735683 1:4298111-4298133 GAGGGAGGGAGGGCTCCTGAAGG + Intergenic
900803490 1:4752159-4752181 GAGGGAGGAGAGGAGGAGGAGGG + Intronic
900859046 1:5212149-5212171 GAGGGAGGAAACTATGGGGAGGG + Intergenic
900993259 1:6107461-6107483 GAGGGATGGAGGGATGATGAAGG + Intronic
900993338 1:6107817-6107839 GAGGGATGGAGGGATGATGAAGG + Intronic
901069383 1:6509616-6509638 GAGGGGAGAAAGGATGTTCAGGG - Intronic
901234634 1:7661351-7661373 GAGAGTGGACAGGAGGCTGAGGG - Intronic
901240409 1:7689767-7689789 GAGGGAGGAGAGCATGCAGAAGG - Intronic
901421127 1:9151860-9151882 GAGGAAAGAAAGGATGCAGGAGG + Intergenic
901426372 1:9184141-9184163 GAGGGATAAAAGGAGGCAGATGG + Intergenic
901631399 1:10649876-10649898 GAGGGAGGGAGGGAGGCTCACGG + Intronic
901751370 1:11412176-11412198 GAGGGTGGAAAGGATGGTGGGGG - Intergenic
902275358 1:15335846-15335868 GAGGTAGCTGAGGATGCTGAAGG - Intronic
902481024 1:16711954-16711976 GAGGGAGGGAGGGAGGCAGAGGG - Intergenic
902919925 1:19659601-19659623 GGGGGAGGAAAGGAAGGGGAAGG + Intergenic
902950280 1:19877331-19877353 GTGGGTGCAAAGGATGCGGAAGG - Intergenic
903009825 1:20321736-20321758 GTGGGAGGAATGGATGGAGAGGG + Intronic
903017191 1:20368855-20368877 GAGGGTGGATAGGAGGCTGGAGG + Intergenic
903063603 1:20686171-20686193 GAGGGAGTAAAGGATGGTTCTGG - Intronic
903149676 1:21397966-21397988 GAGGGAGGAAAGGAGGAAGGGGG - Intergenic
903161671 1:21493438-21493460 GAGGGAGGGAAGCATCCTCACGG - Intergenic
903230872 1:21921700-21921722 TAGGGAGGAGCGGATGCTGGGGG - Intronic
903906942 1:26694453-26694475 GAGGAAGAAAAGGCTGCTGCTGG + Intergenic
904439250 1:30519169-30519191 GATGATGGAGAGGATGCTGATGG + Intergenic
904439275 1:30519421-30519443 GATGATGGAAAGGATGATGATGG + Intergenic
904477768 1:30775840-30775862 GAGGGAGGGAGGGAGTCTGAGGG + Intergenic
904539635 1:31224183-31224205 GAGGGAGGGAAGGGGGCTGCTGG - Intronic
905249481 1:36638758-36638780 CCTGGAGGAGAGGATGCTGAAGG - Intergenic
905313578 1:37066883-37066905 AAGGGAGGAAGGGATGAAGATGG - Intergenic
905349895 1:37338166-37338188 GAGAGAGGAAAGGGAGCTCAGGG + Intergenic
905590555 1:39159477-39159499 GAGGGAGGAATGCAGGTTGATGG + Intronic
905885918 1:41491905-41491927 GAGGCAGGAAAGACAGCTGAGGG - Intergenic
905946249 1:41903824-41903846 TAGGGATGCAAAGATGCTGATGG - Intronic
906288088 1:44601440-44601462 GATGGAGGAAAGCATGAGGAAGG + Intronic
906665006 1:47615256-47615278 GAAGGAGGAAAGGTTGTGGAAGG + Intergenic
906685724 1:47761873-47761895 AAGGAAGGGAAGGAAGCTGAAGG - Exonic
907047623 1:51309328-51309350 GCAGGAGGAAAAGATGCTGACGG + Intronic
907445027 1:54501970-54501992 GAGGGACCAAAGGCTGGTGAGGG - Intergenic
907821437 1:57973825-57973847 TAGGGAGGCAAGAATGGTGATGG - Intronic
908403284 1:63790712-63790734 GAGGGAGAAAAAGGTGCTGAGGG - Intronic
908455255 1:64297118-64297140 GTGGTAGGAAGGGATGATGATGG - Intergenic
909265891 1:73558025-73558047 GAGGGAGGTAAGGAACCTGTTGG + Intergenic
909407942 1:75313293-75313315 GAGGGAAGAAACGATGGTTATGG + Intronic
909547126 1:76860378-76860400 GAGGAAGTAAGGGAGGCTGATGG + Intergenic
909849367 1:80441074-80441096 GAGGGAGGTAAAGATGTGGAAGG - Intergenic
910448798 1:87327273-87327295 GATTGAGGAAAGGAACCTGAAGG - Intergenic
910449600 1:87331860-87331882 AAGGGCGGGAAGGAGGCTGAGGG - Intronic
910473316 1:87578628-87578650 GAGGGAGGAAATCATGGAGAAGG + Intergenic
910896409 1:92074546-92074568 GAGGAAGGAGAGGAGGATGAAGG - Exonic
911122420 1:94309663-94309685 GAGGGAGGGATGGATGATGCAGG + Intergenic
911126417 1:94344834-94344856 GAGGGAGGGAAAAATGCTAAAGG + Intergenic
911740592 1:101383094-101383116 GAGGAAGGAAAGGGTGTTCAAGG - Intergenic
912008572 1:104932829-104932851 GAGGGAGGCCAGGGGGCTGAAGG + Intergenic
912576440 1:110675554-110675576 AAGGGAGTAATGGGTGCTGATGG + Intergenic
912834434 1:112983334-112983356 GAGGGAGGAAGGACTGCTGACGG + Intergenic
913131178 1:115839240-115839262 GAGGGAGGAGAGGATGCAGAGGG + Exonic
913250652 1:116909993-116910015 GAGGGAGGGAAGGAGGCGGGAGG + Intergenic
913467741 1:119159532-119159554 GTGGGAGCACAGGGTGCTGAGGG - Intergenic
913614316 1:120541987-120542009 GTGAAAGGAAAGGATGCTGCAGG - Intergenic
914374023 1:147056494-147056516 GCGAAAGGAAAGGATGCTGCAGG - Intergenic
914474205 1:148009902-148009924 GAGGGAGGAAAGAAAGGGGAAGG + Intergenic
914575953 1:148968913-148968935 GCGAAAGGAAAGGATGCTGCAGG + Exonic
914954827 1:152152248-152152270 GAGACAGGAATGGATGCTGAGGG - Intergenic
915130726 1:153693720-153693742 GAGGGAGGAGAGCATGGGGAGGG - Exonic
915292813 1:154897693-154897715 GAGGGAGGAAAGGAGGAGGCTGG - Intergenic
915357354 1:155263277-155263299 GGGCGAAGAAAGGATGCTGAAGG + Exonic
916006947 1:160670949-160670971 GAGGAAGGAGAGGAGGATGAAGG + Intergenic
916481440 1:165218225-165218247 GAGGCAGGAAACACTGCTGATGG + Intronic
917157354 1:172018957-172018979 GAGGGAGGGAAGGAAGGGGAAGG - Intronic
917679759 1:177353839-177353861 GAGGCAGGAAAGGATGATTGAGG - Intergenic
917959656 1:180132198-180132220 GGGGGAAGAAAGCATGCTGGAGG + Intergenic
917977665 1:180250766-180250788 GAGGGTGGAGAGGAAGGTGATGG + Intronic
918241994 1:182628872-182628894 GAGGGAGGCCAGGGTGCTGTTGG - Intergenic
918876729 1:190056118-190056140 TAGGGAGGAAAGGAAGCAGCGGG - Intergenic
919295879 1:195699147-195699169 GAGAGGGGATAGGATGCAGAGGG + Intergenic
919539205 1:198827937-198827959 GAGTGGGGAAATGATACTGAAGG - Intergenic
919724150 1:200871318-200871340 GAAGCAGGAAAGGATCATGAGGG - Intergenic
919803593 1:201367770-201367792 GAGGAAGCAAAGGAGGCTGAAGG - Exonic
920084965 1:203408695-203408717 GAGGGAAGAAGGGATGGGGAGGG + Intergenic
920710270 1:208288141-208288163 GAGGGAGGAGAGGAAGCCAAAGG - Intergenic
920989525 1:210923405-210923427 GAGGGAGGTAAGAAAGATGATGG - Intronic
921222875 1:212985995-212986017 AAGGGAAGAATGGATGTTGAGGG + Intronic
921804805 1:219442150-219442172 GAGGAAGGAAAGATTGCTGAGGG - Intergenic
921822587 1:219634556-219634578 GAAGGGGGAAATGAGGCTGAGGG + Intergenic
922152888 1:223020533-223020555 GAGGGAAAAGAGGATGCTGGTGG - Intergenic
922386123 1:225085222-225085244 GGCAGAGGAAAGAATGCTGAAGG + Intronic
922507222 1:226133553-226133575 GAGGGAGGACAGAGTCCTGAAGG + Intergenic
922621558 1:226992411-226992433 GAGGGAAGAAAGGATCCTGCTGG - Exonic
922747457 1:228052543-228052565 AAGGGAGGAAAGATGGCTGATGG + Intronic
923407942 1:233681177-233681199 GAAGGGGGAAATAATGCTGAGGG + Intergenic
924149911 1:241118890-241118912 AAAGGAGGCAAGGAGGCTGAGGG + Intronic
924260785 1:242228650-242228672 GAGGGAGGGAAGGAGGGAGAGGG + Intronic
924516463 1:244770192-244770214 GAGGAAGGGAGGGATGCAGAGGG + Intergenic
924589135 1:245386649-245386671 TAAGGAGGAAATGATGCTAATGG - Intronic
924596082 1:245445862-245445884 AAGGGAGGGAAGGATGCTAATGG - Intronic
924665139 1:246063611-246063633 GAGGGAGGAAGGGAAGGAGAGGG - Intronic
1063218911 10:3948367-3948389 GAGGGTGGAAGGGAGGCTGAGGG + Intergenic
1063335250 10:5206405-5206427 GAGAAAGGAGAGGAGGCTGAGGG - Intronic
1063764944 10:9128739-9128761 AATGGGGGAAAGGATGTTGATGG - Intergenic
1064004606 10:11690069-11690091 GGGTGAGGAAAGGCTGGTGAAGG - Intergenic
1064048824 10:12042861-12042883 GAGGGAGGAGGGGGAGCTGAGGG - Intronic
1064274967 10:13897448-13897470 GAGGTAGGAAGGGATGGAGAAGG + Intronic
1064349686 10:14565770-14565792 GAGGCTGCAAAGGAGGCTGAAGG + Intronic
1064481716 10:15746682-15746704 GAGGCTGGAAAGGATGTTAAGGG - Intergenic
1064587341 10:16852069-16852091 GAGGGAGGGAAAGATGATGGAGG - Intronic
1064750083 10:18519579-18519601 GAGAGAGCAAAGGATGATTACGG - Intronic
1064834999 10:19516760-19516782 GAGGGAGGAGAAGAAGGTGAAGG - Intronic
1066279275 10:33899248-33899270 GAGGGATGAAAGGTTGGAGATGG - Intergenic
1066290518 10:34010431-34010453 GAGGAAGGAAGGGAGGCAGAGGG + Intergenic
1066542851 10:36467799-36467821 GAGGCAGGAATGGATGTTGATGG + Intergenic
1067153196 10:43753285-43753307 CAGGCAGGAAGAGATGCTGATGG - Intergenic
1067541845 10:47160577-47160599 AGGTGAGGACAGGATGCTGAGGG + Intergenic
1067662859 10:48249563-48249585 GAGGGAGAAGATGACGCTGAAGG + Intronic
1068036396 10:51765208-51765230 GAGGGAAAAAAGAATGCTGAGGG + Intronic
1068062471 10:52086183-52086205 CAGGGTGGAAAGGATGGGGAGGG - Intronic
1068919209 10:62465300-62465322 GAGGGAGGCCAGGGTACTGAGGG + Intronic
1068923633 10:62512180-62512202 CAGGGAGGAAATCATCCTGAGGG - Intronic
1069595010 10:69664826-69664848 GCTGGAGGAAGGGATGCTGATGG - Intergenic
1069657160 10:70098379-70098401 GAGGGAGGGAAGGAGGGGGAGGG + Intronic
1069782799 10:70967461-70967483 GATGGAGATGAGGATGCTGATGG + Intergenic
1069823651 10:71242381-71242403 CAGAGAGGAAAGACTGCTGAGGG + Intronic
1070554439 10:77516942-77516964 GAGGGAGGAAGTGAGGGTGAGGG + Intronic
1071129051 10:82370366-82370388 GAGGGATGTCTGGATGCTGAGGG - Intronic
1071359334 10:84830221-84830243 TAAGGAGGTAAGGATGATGAGGG - Intergenic
1071381585 10:85068591-85068613 GAGGGAGGTGAGGATGCTGCAGG + Intergenic
1071554891 10:86594363-86594385 GAGGGAGGGAAGGAAGGAGAGGG + Intergenic
1071829859 10:89360910-89360932 GAGGCAAGGAAGGATGCTGCGGG - Intronic
1071830101 10:89362988-89363010 GATGAAGGACAGGAAGCTGAAGG + Intronic
1071832330 10:89383998-89384020 GATGAAGGACAGGAAGCTGAAGG + Exonic
1071834162 10:89402960-89402982 GATGAAGGACAGGAAGCTGAAGG + Exonic
1072187898 10:93060088-93060110 GAGGGAGGGAAGGATGTGCAGGG + Intergenic
1072265655 10:93724676-93724698 TAGGGAGCAAAGGAAACTGAAGG - Intergenic
1072754739 10:98011786-98011808 GAGGGAGGAAGGGAGGGAGATGG + Intronic
1073047126 10:100646128-100646150 GAGGGAGGGGAGGAGGCTGGGGG + Intergenic
1073205867 10:101769043-101769065 GAGGGAGGGAGGGCTGCTGTGGG - Intergenic
1073214378 10:101828558-101828580 GAGGGAGGGAGGGATTCTGGAGG - Intronic
1073429964 10:103479472-103479494 TGGTGAGGAAAAGATGCTGATGG + Intergenic
1074290804 10:112136932-112136954 GAGGGAGGAGAGGAAGAGGAAGG - Intergenic
1074385926 10:113016703-113016725 GAGGGAGGAAAGGAACATCATGG + Intronic
1074596854 10:114876035-114876057 GAAGGAAGAAAGGAGCCTGAGGG + Intronic
1074728940 10:116347831-116347853 GAGGGAGGGAAGAATGGTGGAGG - Intronic
1075153186 10:119953539-119953561 GAGGGAGGGAAGGAAGGAGAAGG - Intergenic
1075153206 10:119953602-119953624 GAGGGAGGGAAGGAAGGAGAAGG - Intergenic
1075329163 10:121560275-121560297 GCTGGAGGCAAAGATGCTGAGGG - Intronic
1075908016 10:126099350-126099372 GAGGGAGGGAAGGAGGGAGAAGG - Intronic
1076288166 10:129321831-129321853 CAGGCAGGAGAGGCTGCTGAAGG - Intergenic
1076550046 10:131272548-131272570 TAGGGAGGAAAGAATGGTGGGGG - Intronic
1076567367 10:131407910-131407932 GAGGGAGAAAAGGAGGATGCAGG - Intergenic
1076825101 10:132963264-132963286 GATGGAGGGAGGGATGTTGACGG - Intergenic
1076825126 10:132963384-132963406 GATGGAGGGAGGGATGTTGATGG - Intergenic
1076825134 10:132963414-132963436 GATGGAGGAAGGGATGTTGATGG - Intergenic
1076825147 10:132963470-132963492 GATGGAGGGAGGGATGTTGATGG - Intergenic
1076825155 10:132963500-132963522 GATGGAGGGAGGGATGTTGATGG - Intergenic
1076907371 10:133369776-133369798 GAGGCAGGAAAGGAGGCTGCTGG + Intronic
1077848070 11:6046628-6046650 CCAGGAGGAAAGGAGGCTGAGGG + Intergenic
1078442539 11:11379296-11379318 GAGGGAGGTCAGGAGGCAGAGGG + Intronic
1078901461 11:15646589-15646611 GAGGGAGGGAGGGATGGAGAGGG + Intergenic
1078968335 11:16373893-16373915 GAGGGAGGAAGGGAGGGAGAAGG + Intronic
1079032033 11:16993084-16993106 GAGGGAGGAGAGAGAGCTGAGGG - Intronic
1079351729 11:19697604-19697626 GAGGGAGGCAAGGATGGGGCAGG + Intronic
1079568133 11:21908461-21908483 GAGGGAGGGAAGGAGGGAGAAGG - Intergenic
1080012141 11:27471010-27471032 GAGAGAGGAAGGGATCCTGAGGG - Intronic
1080036827 11:27719708-27719730 GAGGGAGGGATGGAGGCTGGAGG + Intronic
1080268103 11:30422644-30422666 GAGGGGGGAAAGGAGGAGGAGGG + Intronic
1080550674 11:33371622-33371644 GGGGCGGGAAAGGATGCTGTGGG - Intergenic
1080636132 11:34125251-34125273 GGAGGAGGAAAGGCTGCTGTTGG + Intronic
1081448477 11:43151819-43151841 GAGGGAGACAAGGATACTAATGG + Intergenic
1081643555 11:44774622-44774644 GAGGGAAGAAGGGAGGATGAAGG - Intronic
1081713341 11:45232169-45232191 CAGGGGGGAAAGCATGCAGAAGG + Intronic
1081787328 11:45756715-45756737 GTGGGAGGAAAGAGTGGTGAGGG - Intergenic
1083200589 11:61118872-61118894 GAGGGAGGAATGGGTGGTGTGGG - Intronic
1083368983 11:62163499-62163521 GAGGGAAGAAAGGCTGCTATGGG - Intergenic
1083445799 11:62707371-62707393 GAGGGAGGAAAGGAGGAGGGGGG + Exonic
1084042432 11:66550020-66550042 GAGGAAGGAAAGGTGGCTGAGGG + Intronic
1084047621 11:66579110-66579132 GAGGGAGGACTGGATTCTGAGGG + Intergenic
1084155249 11:67309644-67309666 GAAGGAGGGAAGGACACTGAGGG - Intronic
1084529267 11:69717478-69717500 GAGGGAGGAGAGGAGGATGGAGG - Intergenic
1084596272 11:70118787-70118809 GATGGATGAATGGATGCTGAAGG + Intronic
1084803247 11:71560514-71560536 GAGGGAGGAAAGGAGGGAGGGGG - Intronic
1084952859 11:72676318-72676340 GAGGGCAGAAAGGAGGCTGAGGG - Intergenic
1085076832 11:73598593-73598615 GAAGGAGAATAGGAAGCTGAGGG - Intergenic
1085337380 11:75706487-75706509 GAGGGAGGAGAGGAGGCAGCGGG - Intergenic
1085513674 11:77100349-77100371 GAGGGAGGGGAGGAGGCAGAGGG - Intronic
1086282766 11:85210023-85210045 GTGGGCAGAAAGGATGATGAGGG - Intronic
1086375561 11:86196541-86196563 GAGGGAGGAGCTGATGCTAAGGG - Intergenic
1086384737 11:86295546-86295568 GAGGAAGGAGAGGAAGATGAAGG + Intergenic
1086518830 11:87646252-87646274 GAAGGAGGAAGGGAAGCGGAGGG - Intergenic
1086793068 11:91064998-91065020 CAGAGAGGAAAGGATTCTGCTGG - Intergenic
1086872682 11:92057753-92057775 GAGTGAGAAAATGAAGCTGAAGG + Intergenic
1087055886 11:93935958-93935980 GTTGGAGGAAATGATGCTCACGG + Intergenic
1087552702 11:99672269-99672291 TAGGGAAGAAAGGAAGCAGAAGG + Intronic
1087666324 11:101053513-101053535 GAGGGAAGAAAGGAGGGAGAAGG - Intronic
1087666353 11:101053600-101053622 GAGGGAAGAAAGGAGGGAGAAGG - Intronic
1087666361 11:101053624-101053646 GAGGGAAGAAAGGAGGAAGAAGG - Intronic
1087955377 11:104279845-104279867 GAGAGAGGAGAGGATGGGGAAGG - Intergenic
1088394124 11:109348049-109348071 GAGGGAGGGAAGGAAGGAGAGGG - Intergenic
1088787364 11:113194340-113194362 GAAGGGGGAAAGGATGGAGAAGG - Intronic
1089278829 11:117358328-117358350 GAGGGAGACAAGCATGCTGAGGG - Intronic
1089923763 11:122235705-122235727 TAGAGAGGAAAGGTTGCTGGAGG - Intergenic
1090139784 11:124244050-124244072 GAACGAGGAAAGGATGGAGAGGG + Intergenic
1090254739 11:125275525-125275547 GAGGGAGTAAAGGGGGCTGGTGG + Intronic
1090357063 11:126147217-126147239 GAGGGAGGAAAGGAAGGGGAGGG - Intergenic
1090418403 11:126556709-126556731 GAGGTAGGAAAGGTGGCTGGAGG + Intronic
1091118241 11:133035052-133035074 GCGGGAGGAAAGGATGCTCTGGG + Intronic
1091124409 11:133082525-133082547 GGGGGAGGAGAGGATGAGGAGGG - Intronic
1091206984 11:133828504-133828526 GAGGGAGGAGAGGAGGTGGAAGG + Intergenic
1091596535 12:1882538-1882560 GTGGGAGGGAGGGATGATGAGGG + Intronic
1091642604 12:2248856-2248878 GAGGGAGAAACAGAGGCTGAGGG - Intronic
1091796276 12:3299083-3299105 GAGGGAGGAGAGGAAGAAGAAGG - Intergenic
1091859350 12:3765448-3765470 GAGGAAAGCAAGGATGCTGCAGG + Intergenic
1092024099 12:5226386-5226408 GAAGGAGAAAAGGATGAAGATGG - Intergenic
1092124431 12:6065581-6065603 GAGGGAGGAGGGGAGGCTGCAGG - Intronic
1092334285 12:7614978-7615000 GAGGGAGGGAAGGAAGGAGAAGG + Intergenic
1092763294 12:11828997-11829019 GTTGGAGGAAAGAAGGCTGAAGG - Intronic
1092833647 12:12468097-12468119 GCGGTTGGAAAGGATGGTGAGGG - Exonic
1092882725 12:12900524-12900546 GAGGGAGGAAAGGAAGAGGAGGG - Intronic
1092996915 12:13959354-13959376 GAGGGAGGTCAGGCTGCAGAGGG + Intronic
1093683516 12:22030399-22030421 GAGGGATGTCTGGATGCTGAGGG + Intergenic
1095309988 12:40687413-40687435 GAGGGAAAAAAGGAGGGTGAGGG - Intergenic
1095474711 12:42574041-42574063 GAAGGAGAAAAGGGAGCTGAGGG + Intronic
1095812304 12:46383664-46383686 GAGGGAGGAGGGGAAGCAGAGGG + Intergenic
1095882838 12:47156667-47156689 AATGGAGGAAAGGATGCTTAAGG - Intronic
1096372731 12:51082917-51082939 CAGGCAGGAAGGGATGCGGAAGG - Intronic
1096440373 12:51637629-51637651 GAGGGAGGTGAGGAAGCTGCAGG + Intronic
1096751508 12:53761721-53761743 AAAGGAGGGAAGGATGCTGGAGG - Intergenic
1096987222 12:55768093-55768115 GAGGGAGGGAAGGAGGGAGATGG - Intronic
1097395150 12:59064283-59064305 GAAAGAGGACATGATGCTGAAGG + Intergenic
1097913462 12:64995205-64995227 GAGGGAGGAGAGGGAGCTGAAGG + Intergenic
1098139190 12:67434353-67434375 GATGCAGGAAATGAGGCTGAAGG - Intergenic
1098216384 12:68224666-68224688 GAGGGAGGGAAGGAGGGTGGAGG + Intronic
1098236998 12:68426963-68426985 GAGTGGGGAAAGGATGCCCAAGG + Intergenic
1098378565 12:69843943-69843965 GATGGGGGATAGGATGCTTAAGG + Intronic
1099589701 12:84571710-84571732 GAAGATGGAATGGATGCTGAGGG + Intergenic
1099657984 12:85520098-85520120 GAGGGTGGGAAGGATAGTGAGGG + Intergenic
1099851219 12:88099750-88099772 GAGGGAAAACAGGAGGCTGAGGG + Intronic
1099974456 12:89532129-89532151 GGGGGAGGAAAGAATGGGGAGGG + Intergenic
1100106697 12:91183809-91183831 GAGGGAAGGAAGGAGGCTGGAGG - Intergenic
1100286282 12:93169610-93169632 GAGGGAAGAAAGGAAGGGGAGGG + Intergenic
1100408151 12:94288746-94288768 GAGGGAGAAGACGATACTGACGG + Intronic
1100792413 12:98145039-98145061 GAGAAAGGAAAGGAAGATGAGGG + Intergenic
1100793094 12:98152151-98152173 GAGGGAGGGAAGGAGGGGGAAGG + Intergenic
1100865394 12:98852049-98852071 AAGGAGGGAAAGGATGATGATGG + Intronic
1100873420 12:98937407-98937429 GGGGGAGGAAATGAAGCTGGAGG - Intronic
1101010101 12:100440711-100440733 GAGGGAGGAAAGGAGGAAGAAGG - Intergenic
1101318119 12:103648584-103648606 GATGGAGCAAAGGATGCCCAGGG - Intronic
1101434120 12:104650599-104650621 GAGGGAGGAAATGATGGTGGGGG + Intronic
1101584892 12:106077098-106077120 CTGATAGGAAAGGATGCTGATGG + Intronic
1101625284 12:106434778-106434800 GAAGGAGGAAAGGATGCTGGAGG - Intronic
1101638036 12:106562754-106562776 GAGGGAGGAAGGAATGCTAAGGG - Intronic
1102042754 12:109811072-109811094 GAGGGAGGGAAGGGTGTTGTAGG - Intronic
1102064651 12:109963856-109963878 GAGGGAGATAAGGATCCTGCAGG - Intronic
1102099771 12:110269475-110269497 GGGGGAGGACAGGAAGGTGAAGG + Intergenic
1102279486 12:111607697-111607719 GGGGAGGGAAAGGAGGCTGAAGG + Intergenic
1102451489 12:113045040-113045062 GAGGGAGGGAAGGATGGAGGGGG + Intergenic
1102739385 12:115193390-115193412 CAGGCAGGAGAGGATGGTGATGG + Intergenic
1103013397 12:117475363-117475385 GGGGGAGGAAAGGGAGCTGATGG - Intronic
1103393663 12:120591750-120591772 GAGGTAGGAAAGAGTGCTGTAGG + Intergenic
1103719556 12:122966083-122966105 GGGCGCGGAAAGGATGCTGCAGG + Intronic
1103896639 12:124277756-124277778 GAGGAAGGAGAGGAGGATGAGGG - Intronic
1104191652 12:126487337-126487359 GAGGCAGGAAATCAGGCTGAGGG - Intergenic
1104372355 12:128235091-128235113 AAGAGTGGAAAGGCTGCTGATGG + Intergenic
1104463222 12:128971464-128971486 GAGGGAGGGAGGGAGGCAGAGGG - Intronic
1104465387 12:128985682-128985704 GAGGGAGGAGGGGAGGATGAAGG - Intergenic
1104647380 12:130506868-130506890 GAGGGAGGGAAGGATTCTCTAGG - Intronic
1105892439 13:24691129-24691151 GATGAAGAAAAGGATGCCGATGG - Exonic
1106715673 13:32385345-32385367 GATGAAGGACAGGAAGCTGAAGG + Intronic
1106926257 13:34616130-34616152 GGTGGAGGAAAGTAGGCTGAGGG - Intergenic
1107415613 13:40197427-40197449 GAGCAACGAAAGGTTGCTGATGG + Intergenic
1109151799 13:58857108-58857130 GAGGGAGAAAATGATACAGAAGG - Intergenic
1109253858 13:60053229-60053251 GAGGAAGGAAAGGATACTCACGG + Intronic
1109598938 13:64597538-64597560 GACGGAGGAAAGGAAAGTGAAGG - Intergenic
1110034764 13:70669308-70669330 GAGGGAAGAAAGGAGGATGAGGG - Intergenic
1110075711 13:71239614-71239636 GAGAGAGGAAAGGTTGAGGAGGG - Intergenic
1110563892 13:76938498-76938520 AAAGGAAGAATGGATGCTGAGGG + Intergenic
1111347263 13:86974760-86974782 GAGGGAGGCCAGGGGGCTGAAGG + Intergenic
1111785057 13:92776268-92776290 GAGAGAGGAAAGGAGACAGAGGG - Intronic
1112109981 13:96285853-96285875 GAGAGAGGAAGGGAGGCAGAAGG - Intronic
1112466099 13:99646331-99646353 GGGGGAAGAAGGGTTGCTGAAGG + Intronic
1113136842 13:107100094-107100116 GAAGGTGGAAATGATGCTAAAGG + Intergenic
1113167881 13:107463427-107463449 GAGGAAGGAAAGGATGTTGCTGG + Intronic
1113584533 13:111455798-111455820 GAGAGAGGGAAGGATGATGAAGG + Intergenic
1113877689 13:113604839-113604861 CAGGCAGGAATGGAGGCTGAGGG + Intronic
1116229924 14:42203177-42203199 GTGGGAGGAAAGTCTGTTGAGGG - Intergenic
1116409565 14:44605992-44606014 GATGGAGGAAGGGATTCTCAAGG - Intergenic
1116917946 14:50543606-50543628 GATAGAGGAAAGTATGCAGAAGG + Intronic
1117186934 14:53249458-53249480 CAGGGAGGAATGGATGATGCTGG - Intergenic
1117369383 14:55062849-55062871 GAAGGAGGAAAGGGTGCTGGGGG - Exonic
1117497464 14:56319860-56319882 AAGGGAGGAAAGGAGGGAGAGGG - Intergenic
1118110729 14:62715852-62715874 GAGGGAGGAAAGGAGGGATAGGG + Intronic
1118153241 14:63212298-63212320 GAGGGAAGAATGGATTTTGATGG + Intronic
1118451537 14:65907027-65907049 GAAGGAGGAAAGGAGGGTAAGGG + Intergenic
1118686281 14:68294813-68294835 CAGGGAGGAAAGGCTCCTGCAGG - Intronic
1118699544 14:68419813-68419835 GAGGGAGGAAGAGAGGCTGAGGG + Intronic
1118718725 14:68578807-68578829 AAAGGAGGAAAGCATGCTCAAGG + Intronic
1118744398 14:68763311-68763333 GAGGGAGGGAAGGATGGAGGAGG - Intergenic
1118991589 14:70801734-70801756 GAGTGGGGAAAGGATTCTCAGGG + Intronic
1119057583 14:71438837-71438859 GAGGGAGGCAAGTAAGCTGCAGG - Intronic
1119196854 14:72723425-72723447 GAGGGAGGAGAGGAGGCAGAGGG - Intronic
1119401008 14:74362338-74362360 GAGGGAGAAAAGAATGCAGGGGG - Intergenic
1119553175 14:75531797-75531819 GAGGCAGAGAAGGATGCTTACGG + Intronic
1119586584 14:75841357-75841379 AAGGAAGGAAAGAATGCTGTGGG - Intronic
1119769004 14:77208646-77208668 GAGGTGGGAATGGATGCTGAGGG + Intronic
1120532268 14:85646470-85646492 AAGGGAGGAAAGGATGAAGTAGG + Exonic
1120583848 14:86287137-86287159 GAAGGAGGAAGGGAAGGTGAGGG + Intergenic
1120711415 14:87797299-87797321 GTGGGAGGAAAGGAGGATGCTGG + Intergenic
1121232764 14:92369921-92369943 TAAGGAGGAAAAGATACTGATGG + Intronic
1121302830 14:92885572-92885594 GTGGGAGGGAAGGAAGGTGAGGG + Intergenic
1121468204 14:94129393-94129415 GAGGGAGGAAGGGAAGGGGAGGG + Intronic
1121468211 14:94129411-94129433 GAGGGAGGAAGGGAGGGAGAGGG + Intronic
1121510770 14:94511669-94511691 GAAGCAGGAAAGGAGGATGAGGG - Intronic
1121570701 14:94944614-94944636 TATGCAGGAAAGGAGGCTGAAGG - Intergenic
1121584956 14:95056969-95056991 GAGGGAAGGAAGGAAGCTGGAGG - Intergenic
1121624595 14:95374916-95374938 GAGGGAGGAAAGAAGGAAGAGGG - Intergenic
1121624626 14:95375019-95375041 GAGGGAGGAAAGAAGGAAGAGGG - Intergenic
1121624656 14:95375122-95375144 GAGGGAGGAAAGAAGGAAGAGGG - Intergenic
1121624688 14:95375237-95375259 GAGGGAGGAAAGAAGGAAGAGGG - Intergenic
1121624704 14:95375292-95375314 GAGGGAGGAAAGAAGGAAGAGGG - Intergenic
1121794427 14:96723614-96723636 GAGGGATGACAGGAGACTGAGGG + Intergenic
1121800310 14:96769077-96769099 GAGGGAGGAAGGGAGGAGGAAGG - Intergenic
1122096479 14:99376543-99376565 GAGGGAGGGAAGGAAGGGGAGGG + Intergenic
1122392500 14:101399829-101399851 GAGGGAGGGAAGGAAGGGGAAGG + Intergenic
1122475973 14:102009173-102009195 CAGGGAGGGTGGGATGCTGAAGG + Intronic
1122604158 14:102937492-102937514 GAGGGAGGGAGGGATGCAGGCGG - Intronic
1123427883 15:20187671-20187693 GAGTGTTGAAAGGGTGCTGATGG - Intergenic
1124220539 15:27846773-27846795 GGAGGAGGAAAGGATGTTGAAGG + Intronic
1124239038 15:28014896-28014918 CAGGGAGGCCCGGATGCTGATGG + Exonic
1124993584 15:34700353-34700375 GAGGGAGGAATGGATGAAGAGGG - Intergenic
1125561595 15:40638212-40638234 GAGGGAGGAAAGGAAGGGAAGGG + Intronic
1125680426 15:41527089-41527111 AAGGGAGGAAGGGAGGCTGTGGG + Intronic
1126107044 15:45153431-45153453 GAGGCAAGAGAGGACGCTGAGGG - Exonic
1126688055 15:51265474-51265496 GAGGGAGGAAGACAGGCTGAGGG + Intronic
1127698781 15:61476913-61476935 GAGGGAGGAAATGTTGCAGATGG - Intergenic
1128129217 15:65214658-65214680 GAGACAGGAAAGGACTCTGATGG - Intergenic
1128246466 15:66135994-66136016 GAGGGAGGAGAAGATGAGGAGGG - Intronic
1128541375 15:68536852-68536874 GAAGGAGGAAGGGCTGATGAAGG - Intergenic
1128649563 15:69400714-69400736 GAGGAAAGAAAGGATGAAGATGG + Intronic
1128756756 15:70188430-70188452 GAGGGAGCAAAGGTTACTGGAGG + Intergenic
1128955405 15:71937055-71937077 GAGGGAGGAAAAAATGCAGTAGG + Intronic
1129020547 15:72513791-72513813 GAGGGAGGGAAGGAGGGAGAGGG - Intronic
1129069822 15:72941453-72941475 GATGGGGGAGAGGATGCTTACGG - Intergenic
1129140879 15:73596938-73596960 GAAGAGGGAAAGGATGCAGAAGG + Intronic
1129503720 15:76063578-76063600 GGAGGAGGAAAGGATGCTGTGGG - Intronic
1129642245 15:77392897-77392919 GAGGGAGGAGGGGATGGTGTCGG - Intronic
1129659617 15:77545759-77545781 GTGGCAGGAAAGGATGATGGTGG + Intergenic
1129661393 15:77554858-77554880 GAGGGAGGAGGGGCTGCTGCTGG + Intergenic
1130042541 15:80417513-80417535 GAGGGAGGAGAAGAAGCAGAGGG - Intronic
1130102174 15:80902405-80902427 AAGGGAGGAGTGGATGCTGGTGG + Intronic
1130447838 15:84020691-84020713 GAGGTAGGACATGATGATGATGG - Intronic
1130561732 15:84964232-84964254 GAGGGAGGAAGGGAAGGGGAAGG + Intergenic
1130740057 15:86589726-86589748 GAGGGAGGAAAGGAGGAGGAAGG - Intronic
1130812509 15:87394704-87394726 GAGGCAAGAAAGGAAACTGAAGG + Intergenic
1130912094 15:88277741-88277763 AAGGGAGGAATGGAGGCTGCCGG - Intergenic
1132406500 15:101544371-101544393 GTGGGTGGAAAGGAGTCTGAAGG + Intergenic
1132519036 16:379006-379028 CAGGGAGGGAAGGATGCCCAAGG - Intronic
1132912141 16:2319580-2319602 GGAGAAGGAAAGGAGGCTGAAGG - Exonic
1133204491 16:4225085-4225107 CAGGGAGGAATGGATGGTGGAGG + Intronic
1133387415 16:5381096-5381118 TGGAGAGGACAGGATGCTGAAGG + Intergenic
1133392053 16:5418663-5418685 GAGGGAGGAAAGAAGGGGGAAGG - Intergenic
1133567358 16:7008645-7008667 GAGGGAGGAAGGGAGGAGGAAGG - Intronic
1133567369 16:7008672-7008694 GAGGGAGGAAGGGAGGAGGAAGG - Intronic
1133567414 16:7008778-7008800 GAGGGAGGAAGGGAGGAGGAAGG - Intronic
1133717905 16:8466970-8466992 GAGGGAGGGACGGATGCGGGTGG + Intergenic
1133717937 16:8467088-8467110 GAGGGAGGGAGGGATGAGGAAGG + Intergenic
1133840865 16:9408104-9408126 GAGGGAGGAAAGGAGGTGAAAGG - Intergenic
1134060248 16:11195131-11195153 GAGGAAGGAGAGGAGGCAGAAGG - Intergenic
1134108235 16:11499143-11499165 GAGGGGGGAAGGGAGGCAGAGGG + Intronic
1134108257 16:11499188-11499210 GAGGGGGGAAGGGAGGCAGAGGG + Intronic
1134108268 16:11499211-11499233 GAGGGGGGAAGGGAGGCAGAGGG + Intronic
1134108279 16:11499234-11499256 GAGGGGGGAAGGGAGGCAGAGGG + Intronic
1134108290 16:11499257-11499279 GAGGGGGGAAGGGAGGCAGAGGG + Intronic
1134108301 16:11499280-11499302 GAGGGGGGAAGGGAGGCAGAGGG + Intronic
1134233237 16:12445693-12445715 GAGGTTGGAGAGGAAGCTGATGG - Intronic
1134629688 16:15747976-15747998 GGTGGAGGAATGGATGCTGGAGG - Intronic
1135663338 16:24315407-24315429 GAGGGAGGGAGAGATGATGATGG - Intronic
1135975976 16:27109271-27109293 GAGGGAGGAAGGGAGGGGGAGGG + Intergenic
1136282946 16:29224577-29224599 GAGGGAGGACAGGAAGGAGAGGG + Intergenic
1136554139 16:30997784-30997806 CAGGCAGGAAGGGATACTGAGGG + Intronic
1136856412 16:33662090-33662112 GAGTGTTGAAAGGGTGCTGATGG + Intergenic
1137701502 16:50501214-50501236 GAGGAAGGAAAGGATTCTGCAGG + Intergenic
1138021319 16:53484164-53484186 GTTGGAGGAAATGATTCTGACGG + Intronic
1138279484 16:55761922-55761944 GAAGGAAGACAGGATGCAGACGG - Intergenic
1138289041 16:55831755-55831777 GAAGGAAGACAGGATGCAGACGG + Intronic
1138599996 16:58048414-58048436 AAAGGAAAAAAGGATGCTGAGGG - Intergenic
1139405621 16:66715333-66715355 GGGGGAAGAAAGGATGAGGAAGG + Intergenic
1141056721 16:80823256-80823278 GTGGGAGGAAGGGATGGTGTTGG - Intergenic
1141463825 16:84194310-84194332 GAGGAAGGGAAGGGTGGTGAGGG + Intronic
1141602195 16:85133720-85133742 GAGGGAGGAAAGTGTGCAGATGG + Intergenic
1141690556 16:85594093-85594115 GAGGGAGGAAAGGGGCCTGGAGG + Intergenic
1141753518 16:85975681-85975703 GAAGGAGGAAGGGAAGCTCACGG - Intergenic
1142087322 16:88190478-88190500 GAGGGAGGACAGGAAGGAGAGGG + Intergenic
1203117992 16_KI270728v1_random:1510567-1510589 GAGTGTTGAAAGGGTGCTGATGG + Intergenic
1142740594 17:1929806-1929828 GAAGGAGGAAAATATGCAGACGG - Intergenic
1142750702 17:1985782-1985804 TAAGGGGGATAGGATGCTGATGG + Intronic
1142769558 17:2086822-2086844 TAGGGAGAAGAGGATGCTGGAGG - Intronic
1142778130 17:2157907-2157929 GTGGGAGGAGAGCTTGCTGATGG - Intronic
1142850903 17:2704335-2704357 GATGGAGGAACGGGTGCTGGGGG - Intronic
1142958154 17:3535172-3535194 GAGGGAGGAAGGGAGGAGGAAGG - Intronic
1143158206 17:4852414-4852436 GTGGGAGGAGAGGATTGTGAGGG + Intronic
1143247368 17:5498316-5498338 GACGGAGGAAAGGAAGCTGGGGG + Intergenic
1143413380 17:6726457-6726479 GAAGGAGGAAAAGATGCTGATGG + Intergenic
1143476711 17:7207371-7207393 CAGGGAGGAAAGGCTGCAGAGGG + Intronic
1143595641 17:7912066-7912088 GAGGGAGGAAGGGACGAGGAGGG + Exonic
1143709907 17:8727001-8727023 AAGCGAGGAACGGATGCTGGAGG - Intergenic
1143981306 17:10872560-10872582 GTGGGAGGGATGGATGCTAAAGG + Intergenic
1144212276 17:13025686-13025708 GAGGGAGGGAATGAGGTTGAGGG - Intergenic
1144693906 17:17288268-17288290 GAGGGGGAGGAGGATGCTGAAGG + Intergenic
1145124249 17:20287018-20287040 GAGGCAGGGGAGGCTGCTGACGG - Intronic
1145996166 17:29106208-29106230 GAGGCTGGAATGGAGGCTGAGGG + Intronic
1146051222 17:29555072-29555094 CAGGGAGAGAAGGCTGCTGAGGG + Intergenic
1146216962 17:30984773-30984795 GGGAGAGGAAAGGATGTGGAAGG + Intronic
1146626198 17:34437347-34437369 TAGGGAGGGAAGTCTGCTGAAGG + Intergenic
1147193799 17:38751962-38751984 GAGAAAGGGAAGGATCCTGATGG + Intergenic
1147217104 17:38907158-38907180 GGGGAAGGAGAGGAAGCTGAGGG + Intronic
1147599734 17:41738475-41738497 GAGGGAGGACAGGAGGCCAAGGG - Intergenic
1147965138 17:44190652-44190674 GAGGGGGCCAAGGAGGCTGAGGG - Exonic
1148353285 17:46956876-46956898 GTGGCAAGAAAGGATGCTAATGG + Intronic
1148394189 17:47295361-47295383 GAGGGAGGAACGGGTGCTTAAGG - Intronic
1148749281 17:49935391-49935413 CAGGGAGGAAAGGATAGTGGGGG + Intergenic
1150444476 17:65217857-65217879 GTGGAAGGGAAGGAAGCTGAAGG + Intronic
1150448697 17:65247619-65247641 GAAGGAGGAGCGGCTGCTGATGG + Intergenic
1150453536 17:65288947-65288969 GAGGAAGAAAAGGATAGTGAAGG - Intergenic
1150456123 17:65308225-65308247 GAGGGAAGAAAAGATGGTAATGG + Intergenic
1150790151 17:68196574-68196596 GGGGGAGGAAAGGGTGCGGCAGG + Intergenic
1150905555 17:69333024-69333046 GATGGAGGAAGGGATGTGGATGG + Intergenic
1150996755 17:70327187-70327209 GAAGGAGAAAATGATGTTGAGGG + Intergenic
1151050996 17:70978543-70978565 GAGGGAGGAAAAGAAGGGGAGGG + Intergenic
1151051006 17:70978569-70978591 GAGGGAGGAAAAGAAGGGGAGGG + Intergenic
1151138684 17:71971514-71971536 GAGGGAGCAGAGGATGGGGAGGG + Intergenic
1152204716 17:78968360-78968382 GAGGGAGGAAAGGATGATTTGGG - Intergenic
1152342580 17:79733483-79733505 GAGGGAGGAAGAGGTGCAGAGGG - Intronic
1152456923 17:80422010-80422032 GGGGGAGGGAAGGCTGCTGCAGG + Intronic
1152751286 17:82063585-82063607 GATGCAGGAAAGGGTGCAGAGGG - Intronic
1152753745 17:82078318-82078340 GAGGGAAGAAAGGACGGTGGTGG + Exonic
1153057267 18:958499-958521 GAGGGAGGAGAGGTTGGTGTGGG + Intergenic
1153225772 18:2898443-2898465 GAGGAAGGAAGGGGTGCTGGTGG + Intronic
1153463971 18:5368204-5368226 GAGGGAGGAAGGGTCCCTGAGGG - Intergenic
1153498146 18:5721326-5721348 GAGGGAGGAAGGGTTGATTATGG + Intergenic
1153530260 18:6039011-6039033 GAGGGAGGAAGGGAGGTTGGGGG - Intronic
1153666319 18:7370224-7370246 CAGGGAGGAAGGGATGGTGGGGG - Intergenic
1153834154 18:8949337-8949359 GAGGAAGGCAAGGATGTGGAGGG + Intergenic
1155888681 18:31239567-31239589 GAGGGAAAAAAGGATGGTAAAGG - Intergenic
1156504290 18:37579367-37579389 GATGGAGGAAAGGAGGCACATGG - Intergenic
1156539362 18:37894375-37894397 GAGGGAGGAAGAAATGCTGCTGG + Intergenic
1156841376 18:41614009-41614031 GAGGAAGGACAGGAAGTTGATGG + Intergenic
1156890574 18:42185594-42185616 GAGGGAGGAAAGAAAGCATATGG - Intergenic
1157307134 18:46525464-46525486 GGGGGAGGAAAGGCTGTGGAGGG + Intronic
1157382019 18:47227155-47227177 GAGGCAGGAAAGGAGGAAGAAGG - Intronic
1158103772 18:53861352-53861374 GAGGGAGGAAAGGAGGAGGGAGG + Intergenic
1158864076 18:61620305-61620327 GGGCGAGGAGAGGATGCAGAGGG - Intergenic
1158887685 18:61844211-61844233 GAGGGAGGGAAGGAGGGAGACGG + Intronic
1159163179 18:64670588-64670610 GAGGGAAGAATGGATACTGGAGG + Intergenic
1159586084 18:70284788-70284810 GAGGGAGGGAAGGAAGTGGAGGG + Intergenic
1159732847 18:72053315-72053337 GAGGGAGCAAGGGAGGGTGAGGG + Intergenic
1159754225 18:72343695-72343717 GATGGAGGGAAGCAGGCTGAAGG + Intergenic
1160252661 18:77216996-77217018 GAGAGAGGGGAGAATGCTGATGG - Intergenic
1160665307 19:325373-325395 GAGGCAGGACGGGCTGCTGAGGG + Intronic
1160965253 19:1744581-1744603 GGGGGAGGAAAGGAGGGGGAGGG - Intergenic
1161100385 19:2418612-2418634 GAGGGAGGGAAGGAAACGGAGGG - Intronic
1161100465 19:2418826-2418848 GAGGGAGGGAAGGAAACGGAGGG - Intronic
1161154867 19:2727354-2727376 GAGGGAGCACAGGCTGCTGCAGG - Intronic
1161419975 19:4171402-4171424 GATGGAGGGGAGGATGATGAGGG - Exonic
1161914429 19:7218023-7218045 GTGGGAGGATGGGATGGTGACGG + Intronic
1162084777 19:8241957-8241979 AAGGGAGGAAATGAGGCTGAGGG - Intronic
1162126072 19:8500079-8500101 GAGGGGGTCAAGGATGCTGGGGG - Intronic
1162250776 19:9441597-9441619 GAGAGAGGAAAGTATTGTGAGGG - Intergenic
1162475483 19:10896879-10896901 GTGGGTGGCGAGGATGCTGAGGG + Intronic
1162617880 19:11816266-11816288 GAGGTAGGAAGGAATGCTGAAGG + Intronic
1162621851 19:11849702-11849724 GAGGTAGGAAGGAATGCTGAAGG + Intronic
1162626548 19:11889099-11889121 GAGGTAGGAAGGAATGCTGAAGG + Intronic
1162635782 19:11966003-11966025 GAGGTAGGAAGGAATGCTGAAGG + Intronic
1162784067 19:13023314-13023336 GAGGGAGGAAAGGAAGAAGGGGG - Intronic
1162826957 19:13258696-13258718 GAGGGAGGTGAGGATGCTGAGGG + Intronic
1162945177 19:14038930-14038952 GAGGGAGGAAAGAAGGGAGAGGG + Intronic
1163039936 19:14594604-14594626 GAGGGAGGAATGGTTGGTCAGGG - Intronic
1163323467 19:16587977-16587999 GTGGGAGGGAAGGACGCTGTGGG - Intronic
1163468455 19:17483376-17483398 GAGGGAGGCAATGAGGCTGCTGG + Intronic
1163586364 19:18166359-18166381 CAGGGAGGGAAGGAAGCAGAAGG + Intronic
1163848928 19:19652740-19652762 GAGGGAGGGACAGATGGTGAGGG - Intronic
1164750573 19:30651431-30651453 GAGGGAGGAAGGGAAGCTCCAGG + Intronic
1165404661 19:35622327-35622349 GAGGGAGGAAGGCATCCAGAAGG + Intronic
1165436351 19:35797455-35797477 GAAGGAGGAGAGGGCGCTGATGG + Intergenic
1165453341 19:35897618-35897640 GAGTGGGTACAGGATGCTGAAGG - Intronic
1166001225 19:39878575-39878597 GAGGGAGGAAGGGAAGAGGAGGG - Intronic
1166369043 19:42291344-42291366 GAGGGTGAAACGGATGCTGGTGG - Exonic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1167048059 19:47062903-47062925 GAGGAAGGTATGGAGGCTGAGGG - Intergenic
1167087453 19:47320100-47320122 GAGGGAGGGCAGGATGCTGCAGG - Exonic
1167271578 19:48509298-48509320 GAGGGGGGATGGGAGGCTGAGGG + Intronic
1167488897 19:49780603-49780625 GAGGGAGGCAAGAAGGCTGGAGG + Intronic
1167576371 19:50319937-50319959 GAGGGAGGCAGAGATGTTGATGG + Intronic
1167649937 19:50723651-50723673 GAGGGAGGCCCTGATGCTGAAGG + Exonic
1167687918 19:50968179-50968201 AAGGAAGGAGAGGATGCAGAGGG - Intronic
1168212631 19:54901614-54901636 GAGCGAAGAAAGGATGCTAGTGG + Intergenic
1168536729 19:57176997-57177019 GAGTGGGGAAAGAAGGCTGAAGG - Intergenic
1202715061 1_KI270714v1_random:37858-37880 GAGGGAGGGAGGGAGGCAGAGGG - Intergenic
925119827 2:1409644-1409666 GGAAGAGGAAAGGATGCAGATGG - Intronic
925326077 2:3023091-3023113 GAGTGAGGACAGGAAGCTGTTGG + Intergenic
925443334 2:3907123-3907145 AAGGGAGGAATGGAAGCAGAAGG - Intergenic
925585640 2:5461458-5461480 GAGGTGGGAAAAGAGGCTGAAGG + Intergenic
925717377 2:6796825-6796847 GGGGCAGGTGAGGATGCTGAGGG - Intergenic
925910074 2:8568061-8568083 GAGAGGGGAAAGGAGGCTGCTGG + Intergenic
925914982 2:8598305-8598327 GAGGCAGGAGAGGAAGCTGGGGG + Intergenic
926150562 2:10423389-10423411 CAGGGAGGCAAGCATGCTGGTGG + Intronic
926301225 2:11604472-11604494 GAGAGAAGAGAGGATGATGATGG - Intronic
926680646 2:15661526-15661548 GAGGGAGGAAAGGAGCTTCAAGG - Intergenic
926921827 2:17946764-17946786 GAGGGAGGGAAGGAAGGAGAGGG - Intronic
927128938 2:20040366-20040388 GAGGCAGGAAAGTATTTTGATGG - Intronic
927832532 2:26364659-26364681 GATGGAAGAAAGAATGCTGATGG + Intronic
928270057 2:29847869-29847891 GAGGAAGGAGAGGAGGATGAGGG + Intronic
928943831 2:36754200-36754222 GAGGGAAGGAAGGGTGTTGATGG + Intronic
929532998 2:42763971-42763993 GAGGGAGCAGAGGAGGGTGAGGG + Exonic
929575871 2:43051337-43051359 GATGGAGGAAAGGAGGCTATGGG + Intergenic
929918895 2:46158303-46158325 GAGGGAAGAAAGAATGCAAAAGG + Intronic
930131166 2:47852330-47852352 GAGAGAGAAAAGGATGGAGAGGG + Intronic
931660640 2:64559280-64559302 TAGGGAGGGAAGGATGGGGAGGG + Intronic
931848022 2:66224776-66224798 GATGGAGGAGAGGAGGCTCAGGG - Intergenic
932297446 2:70638721-70638743 GAGGGGGGACAGGAAGCAGACGG + Intronic
932417099 2:71580129-71580151 GTGGGAGGATTGGATGCTGCTGG + Intronic
932576196 2:72963648-72963670 CAGGGAGTAAAGGAAGCTGGGGG + Intronic
932733849 2:74240308-74240330 AAGGCAGGAAAGGAGGCTGCTGG - Intronic
932740573 2:74287732-74287754 GATGGAAGAAAGGATGTTGATGG - Intronic
933069276 2:77836830-77836852 GAGGGAGGGAAGGAAGGAGAGGG + Intergenic
933215910 2:79629717-79629739 GAGGGAGGAAAGGATGCTGAAGG + Intronic
933292406 2:80452635-80452657 GGGAGAAGAAAGGATGCTGGTGG + Intronic
934745424 2:96756475-96756497 GAGGGAAGAAGGGAGGCTGAGGG - Intergenic
934971608 2:98768805-98768827 GTGGGAGGGAAGGGTGCAGATGG + Intergenic
935369827 2:102333490-102333512 AAGGGAGGCAAGGAGGCTGGAGG + Intronic
935627113 2:105180524-105180546 CACGGATGAAAGGATCCTGAAGG - Intergenic
935816976 2:106855251-106855273 CAGGGAAGAAAGGGTGCTTAGGG + Intronic
936344674 2:111666265-111666287 GAGGGTGGTGAGGATGCTGCTGG + Intergenic
936643715 2:114345337-114345359 GAGGGAGGAAGGGAGGGAGAGGG + Intergenic
937034526 2:118769808-118769830 GAGGGAGGAAAGGAAGGAGAGGG + Intergenic
937207609 2:120246513-120246535 GAGGAAGGAAAGGATGTTGGTGG - Intronic
937291567 2:120785165-120785187 GAGGGAGGGAGGGTGGCTGAGGG + Intronic
937708915 2:124955533-124955555 AAAGGAGGAAACGATGCTTAAGG + Intergenic
938042784 2:128090165-128090187 GAGGAAGGAGAGGAGGATGAAGG - Intergenic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
938698811 2:133858434-133858456 GAGGGAGGAAGGGAGACAGAGGG + Intergenic
938938925 2:136152199-136152221 GAGGGAGGGAAGGAAGGAGAGGG - Intergenic
939466363 2:142562006-142562028 GAGGGAGGCCAGGAGGCTGAGGG + Intergenic
939563535 2:143759589-143759611 GAGGTAGGAAATGCTGCGGAGGG - Intronic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
941225181 2:162839000-162839022 GAGAGAGAAAAGGAGGCTGGGGG + Intergenic
941591152 2:167422141-167422163 GAGGGAGGAAAGGAAGAGGAAGG + Intergenic
941633291 2:167907995-167908017 AAGAGAGGAAAGGATGGGGAAGG + Intergenic
941834771 2:170004480-170004502 GGGAGAGGGCAGGATGCTGAAGG + Intronic
942481845 2:176396595-176396617 GAGGGAGGAAAGGATCTTAGAGG - Intergenic
942599904 2:177630164-177630186 GAGGGATGAAAGGGGGATGAGGG + Intronic
942607784 2:177710234-177710256 GAAGGAGGGAAGGATGGGGATGG + Intronic
942965846 2:181891886-181891908 GAGGGAGGGAAGGAAGGGGAGGG - Exonic
943046463 2:182867019-182867041 GAGGGAGGAAAAGCTCCTAATGG + Exonic
943144445 2:184024254-184024276 GAGTGAGGAAATGCTGCTGGAGG + Intergenic
943247374 2:185473145-185473167 GAGGGAGGCCAGGGGGCTGAGGG + Intergenic
943371656 2:187023477-187023499 GAGGGGTGAACAGATGCTGATGG - Intergenic
943496594 2:188628748-188628770 GAGGTAGGAAAGGATGGTATTGG - Intergenic
946068070 2:217007169-217007191 GTTGGAGGGAATGATGCTGAAGG + Intergenic
946114665 2:217450878-217450900 TAGGAAGGAAAGGAGGCTGGTGG + Intronic
946180712 2:217947289-217947311 GAGGGAGGGCAGGAGGCTGAAGG + Intronic
946202802 2:218080743-218080765 GAGGGAGGGAAGGATGCTGATGG - Intronic
946366549 2:219252672-219252694 GAGGGAGGAGGGCATCCTGATGG - Intronic
947714133 2:232331355-232331377 GCGGGAGCAGTGGATGCTGATGG + Intronic
947818967 2:233057645-233057667 GAGGTGGGAGATGATGCTGATGG - Intergenic
947824119 2:233092751-233092773 GAGGGATAAAGGGATGCTGTTGG - Intronic
948211932 2:236200601-236200623 GAGGGAGGAAAGGAGAGTGAGGG - Intronic
948458480 2:238118169-238118191 GATGGAGGAATGGATGGTGGAGG + Intronic
948458502 2:238118254-238118276 GATGGAGGAATGGATGGTGGAGG + Intronic
948542468 2:238700412-238700434 GAGGGGGGAAAGCCTGATGAGGG + Intergenic
948703074 2:239772855-239772877 GAGGGAGGAAAGGAGGAGGGAGG - Intronic
948836774 2:240629675-240629697 GGGGCAGGAAAGGAGGCAGAAGG - Intronic
949045908 2:241872568-241872590 GAGGGAGGAGGGGAAGGTGAGGG - Exonic
1168790487 20:572773-572795 GAGGGAGCAGTGGGTGCTGAAGG + Intergenic
1168842243 20:916913-916935 GAGGGAGGGGAGGAGGCAGAGGG + Intergenic
1169046109 20:2535816-2535838 CAGGGAGGAAAAGCTGCTGAGGG + Intergenic
1169132337 20:3172809-3172831 GAGGGAGGAAAGGGATCTGGGGG + Intronic
1169246386 20:4028363-4028385 GAGGGAGGAAGGGAGGAGGAAGG - Intergenic
1169318114 20:4609706-4609728 GAGTGCGGAGAGGTTGCTGAGGG - Intergenic
1169505771 20:6209428-6209450 GAGGGAGGAAAGAAAGAGGAAGG - Intergenic
1169605278 20:7311007-7311029 GAGAAAGGAAAGAATGATGAAGG - Intergenic
1169867164 20:10214515-10214537 GAGGGCAGAAAGGAGTCTGATGG + Intergenic
1169870228 20:10241353-10241375 GAGGGAGGAGGGGATATTGATGG - Intronic
1170549296 20:17462532-17462554 GGGGGAGCTCAGGATGCTGAGGG - Intronic
1170682761 20:18541164-18541186 GAGAGAGGTAAGGAAGCTGCAGG - Intronic
1171178988 20:23077596-23077618 GAGGGAGGAAGGGAGGGAGAGGG - Intergenic
1171485339 20:25481743-25481765 GGAGGAGGAAGGGACGCTGAAGG - Intronic
1172092835 20:32446053-32446075 GAGGGAGGAAAGGCAACAGAGGG + Exonic
1172292156 20:33784186-33784208 GAGGGAGGTGAGGAGGCGGAGGG - Intronic
1172376617 20:34447204-34447226 GCGGGGGGACAGGATGATGAAGG - Intronic
1172484660 20:35291100-35291122 GAAGGAGGAGAGGAGGCTGCTGG - Intronic
1172973002 20:38887109-38887131 GATGGATGAATGGATGCTGGTGG + Intronic
1173009852 20:39172079-39172101 GAGGGAGGATAAGATGCAGCAGG + Intergenic
1173202052 20:40961468-40961490 GAGGGCTGAGAGGCTGCTGAGGG - Intergenic
1173311924 20:41904418-41904440 GAGGGAGGAGGGTATGCTCAGGG + Intergenic
1173662194 20:44742489-44742511 GAAGGAGGAGAGGAGGCAGAGGG + Intergenic
1173737254 20:45370932-45370954 GAGGGAGTAGAGGGAGCTGAGGG + Intronic
1173979611 20:47213159-47213181 TAGGGAGGAGAGGATGGAGAAGG + Intronic
1174199680 20:48798515-48798537 GAGGGAGGGAAGGCTGAGGAGGG - Intronic
1174387986 20:50198194-50198216 GGGGGAGGGAAGGATGGGGAGGG + Intergenic
1175138866 20:56844817-56844839 CAGGGAGGGAAGGAGACTGACGG + Intergenic
1175348115 20:58297603-58297625 GAGGGAGGAGGGGATGTTCAAGG - Intergenic
1175571525 20:60026424-60026446 GAGGGAGAAGAGGAGGCAGAAGG + Intronic
1175644083 20:60656726-60656748 GAGGAAGGTAAGGATGCCGTGGG - Intergenic
1175984112 20:62755589-62755611 GAGGGAGGGAGGGATGATGGAGG - Intronic
1177071144 21:16510092-16510114 GAGGGAGGAGAGAAAGCAGATGG + Intergenic
1177513941 21:22123341-22123363 GAGGGAGGAAATGATACGGGAGG + Intergenic
1177596225 21:23246832-23246854 GAAGAAGGAAAGGATGGGGAAGG + Intergenic
1177761655 21:25408557-25408579 GAGGGTGGAAATGGTGGTGAGGG + Intergenic
1178920774 21:36736737-36736759 GAGGGAGGAAAGGAAAGGGAAGG - Intronic
1179167221 21:38944481-38944503 GAGGGTGGAGAGGGCGCTGATGG - Intergenic
1179271439 21:39854145-39854167 GAGGGAGGAGAGGCTGTGGAAGG - Intergenic
1179366658 21:40765179-40765201 GAAGTAGGAGAGGGTGCTGAGGG + Intronic
1179548054 21:42125344-42125366 GAGGGTGGCCAGGAAGCTGAGGG + Intronic
1179595252 21:42438820-42438842 GTGGAAGGAATGGATGCTCAAGG + Intronic
1179716867 21:43292971-43292993 GAGGGAGGAAAGGAAGGAAATGG - Intergenic
1179716919 21:43293121-43293143 GAGGGAGGAAAGGAAGGAAATGG - Intergenic
1179930766 21:44569493-44569515 AAGGATGGAAAGGATGCAGAGGG + Intronic
1180186902 21:46144658-46144680 GAGGGAGGGAGGGATGGGGAGGG - Intronic
1180799509 22:18625224-18625246 TCTGGAGGAGAGGATGCTGAGGG + Intergenic
1181182684 22:21078741-21078763 AAGGGAGGACAGCAGGCTGAGGG - Intergenic
1181222207 22:21370042-21370064 TCTGGAGGAGAGGATGCTGAGGG - Intergenic
1181637966 22:24183035-24183057 TCTGGAGGAGAGGATGCTGAGGG - Exonic
1181881969 22:25988397-25988419 GATGGAGGATGGGATGCAGAGGG + Intronic
1181883830 22:26003100-26003122 GAAGGAAGAAAGGAAGCTCAGGG + Intronic
1182021537 22:27085783-27085805 GAGGAAGGGGAGGATGCAGAGGG - Intergenic
1182103302 22:27672105-27672127 GAGGGAGGGAAGGAAGGGGAGGG + Intergenic
1182286658 22:29252598-29252620 GGGGAAGGAAAGGATGCAGATGG + Intronic
1182578967 22:31292335-31292357 GAAGGAGGCAAGGATGCTGTTGG - Exonic
1182780070 22:32860572-32860594 TAGGGAAGAGAGGGTGCTGACGG - Exonic
1183162800 22:36126373-36126395 GAGGAAGGAAAGGAGGGAGAGGG - Intergenic
1183306156 22:37084254-37084276 GAGGGAGGAAAGGAAGCCAGAGG + Intronic
1183342761 22:37290914-37290936 CTGGGAGGAAAGCCTGCTGATGG - Intronic
1183374444 22:37454812-37454834 GAGGGAGGAAGGGAGGCTGGGGG - Intergenic
1183489703 22:38109800-38109822 GAGGGAGGAAGAGGTGCTGCTGG - Intronic
1183701342 22:39453000-39453022 TAGGGAAGAAAGCCTGCTGACGG - Intergenic
1183751491 22:39723591-39723613 GAGGGAGGGCAGGAGGCAGAAGG - Intergenic
1183971643 22:41482032-41482054 AAGGGAAGAAAGGATGCTGCTGG - Intronic
1184256169 22:43288371-43288393 GAGGTAGGAAGTGATGCTTAGGG - Intronic
1184293425 22:43509781-43509803 GAGGGAGGGAAGGAGGAGGAAGG - Intergenic
1184369967 22:44076024-44076046 AAAGCAGGAGAGGATGCTGAAGG + Intronic
1184545453 22:45164316-45164338 GCGGGAGGAGAAGAGGCTGAGGG + Intronic
1184655735 22:45941206-45941228 TAGGGAGGAAAGAGTGCAGAAGG + Intronic
1185009325 22:48304541-48304563 GATGGAGGAGAGGAGGCTTAAGG - Intergenic
1185037060 22:48484891-48484913 GAGGGAGGGAAGGAAGGAGAAGG - Intergenic
1185169443 22:49284125-49284147 GAGGGAGGAAGGGATGTTTAGGG + Intergenic
949167897 3:962749-962771 GAGGGAGGGAGGGAGGCAGAGGG + Intergenic
949462982 3:4313884-4313906 GAAAGGGGAAAGGATACTGATGG - Intronic
949796210 3:7854105-7854127 TAGGGAGGAGAAGCTGCTGAAGG + Intergenic
949980588 3:9499859-9499881 GAGGAAGGAGAGGAGGATGAAGG - Exonic
949984241 3:9527019-9527041 GAGGGAGGGAAGGAGACAGAAGG + Intronic
950096763 3:10335175-10335197 AAAGGAGGGCAGGATGCTGAAGG + Intronic
950221041 3:11196293-11196315 GAGGGAGGAAAGGGTGCTCCAGG - Intronic
950301619 3:11884345-11884367 GAGGTAGCAAAGGATGTTCAAGG - Intergenic
950422517 3:12907300-12907322 AGGGGAGGCAAGGCTGCTGACGG + Intronic
950613187 3:14139142-14139164 GGGGCAGGTCAGGATGCTGAGGG - Intronic
950666946 3:14503478-14503500 ATGGGAGGAAGGCATGCTGATGG - Intronic
950720601 3:14879839-14879861 GGAGGGGGAAAGGATGCTGAGGG + Intronic
951169054 3:19517569-19517591 GTGGGAGGAAAATATGCTCATGG + Intronic
951515933 3:23559588-23559610 GAGGGAGGATAAGCTGCTCACGG - Intronic
951871782 3:27369606-27369628 GAGGCAGCAAGTGATGCTGAAGG + Intergenic
952385214 3:32836209-32836231 GAGGGAGGAAATGCGGCTGGTGG - Intronic
952566224 3:34661632-34661654 GAGGAAGGACAGGATGCCAATGG + Intergenic
952690923 3:36204610-36204632 CAGAGAGGACAGGATTCTGATGG + Intergenic
952839338 3:37630938-37630960 GAGGCAGGGCAGGAAGCTGATGG + Intronic
953023295 3:39129701-39129723 GTGGGAGGTGGGGATGCTGAGGG + Intronic
953340819 3:42132812-42132834 GAGGGAGGAAGGGAAGGTCAGGG - Intronic
953360358 3:42290441-42290463 GAGGGAGGAAAGGAGAAAGAGGG - Intergenic
953661583 3:44894859-44894881 GTGTGAGGAGAGGATGCTGAGGG - Intronic
953885433 3:46712249-46712271 GAGGGCAGCAAGGAGGCTGAGGG + Exonic
953937911 3:47062319-47062341 GAACGAGGAAGGGATGCTGTTGG - Exonic
954009469 3:47622678-47622700 TAGGGAGGAAAGGATAGTGAGGG - Intronic
954286329 3:49622048-49622070 GAGGGGGAAATGGATGATGAAGG + Intronic
954287756 3:49630833-49630855 GAGGCAGGAAAGGGAGGTGATGG + Intronic
954310200 3:49760730-49760752 GAGTCAGGAAAGGAAGTTGAGGG - Intronic
954811327 3:53250149-53250171 GAGTGAGGAAATGCTGCTGCTGG + Intronic
954860222 3:53681916-53681938 GAAGGAGCAGAGGATGCTGGAGG + Intronic
954876471 3:53805977-53805999 GAGGGAGGAACGGAGGAGGAGGG - Intronic
954963933 3:54593462-54593484 GAGGGAGGGAAGGAAGGTGAAGG + Intronic
955381519 3:58442225-58442247 AAGCGAGGAAAGTATACTGAGGG + Intergenic
955766839 3:62353764-62353786 GGTGGAGGAAAGGGTCCTGAGGG + Intergenic
955935371 3:64097945-64097967 GAGGGACAGAAGGATTCTGAGGG - Exonic
956039904 3:65134890-65134912 AAGGGAGGAAAGGATAATGGGGG - Intergenic
956193898 3:66633062-66633084 GAAGCAGGAAAGGATGCGAATGG - Intergenic
956673730 3:71715494-71715516 GAGGTGGGAAAGAAAGCTGAGGG + Intronic
956724208 3:72143910-72143932 AAGGGAGGAAAGAATGTGGAAGG - Intergenic
956849320 3:73213816-73213838 AAGGAAGGAAAGGAAGCCGATGG + Intergenic
956946103 3:74225472-74225494 GAAAGAGGAAAAGATGATGAAGG - Intergenic
956961751 3:74411016-74411038 GAGGGAGGAAAGGATAGAGAGGG - Intronic
957311837 3:78530219-78530241 GAGGGAGGCAGGGATGAGGAGGG + Intergenic
957387662 3:79518308-79518330 GAAGGAGGAAAGGAAGGGGAAGG + Intronic
957466683 3:80602516-80602538 GAGGGAGGGAAGGAGGGAGAAGG + Intergenic
957818590 3:85338005-85338027 GATGGAGGCAATGATGCTTAAGG - Intronic
957927146 3:86828794-86828816 AAGGGAGGAAAGAAAGCTGGAGG + Intergenic
958658729 3:97038294-97038316 GGGGGGGGAAAGGATGAAGAGGG - Intronic
959992778 3:112647072-112647094 GAGGGAGTAAATGTTGATGAAGG + Intronic
960094722 3:113678031-113678053 GAGGGAGGAAGGGAGGGAGAAGG - Intronic
960175304 3:114510580-114510602 CAGTGAGGAAAGCATGGTGATGG + Intronic
960639911 3:119814764-119814786 AGGGGAGGAGAGGATGCTGCGGG + Intronic
960844501 3:121993789-121993811 CAGGGAGGACAGCATGCTGCAGG + Exonic
961013386 3:123449778-123449800 GCGGGAGGAGGGGATGCGGAGGG - Intergenic
961203559 3:125063016-125063038 CAGGGAGGAAGGGTTGCTCATGG + Intergenic
961306628 3:125962364-125962386 AAGGGAGGAAAGGATGTTATTGG + Intergenic
961441675 3:126957280-126957302 GAGGGTTAAAAGGATGCTGCTGG + Intronic
961693642 3:128688727-128688749 GAAGGAGGAAGGAATGCTGATGG + Intergenic
961845241 3:129757342-129757364 GAGTGCAGAAAGGTTGCTGAGGG - Intronic
962165219 3:133040535-133040557 AGGGGAGAAAAGAATGCTGAGGG + Intronic
962281064 3:134052260-134052282 GAGGGAGGAGAGGGTGGTGCAGG - Intergenic
963077716 3:141362761-141362783 GGAGGGGAAAAGGATGCTGAGGG + Intronic
963170168 3:142242172-142242194 GTGGTAGGAAAGGAAGCAGAAGG - Intergenic
963350195 3:144142049-144142071 GAGGAAGGAAAGGAGGGAGAGGG - Intergenic
963353784 3:144184899-144184921 TATGCAGGCAAGGATGCTGAAGG - Intergenic
964302264 3:155301761-155301783 GAGGGAGAAAGGGATGTGGATGG - Intergenic
964363137 3:155919451-155919473 GAGAAAGGAAAGGATGGTTAGGG + Intronic
964369813 3:155988141-155988163 GAGGAAGGAGAGGAGGATGAAGG + Intergenic
964531358 3:157671424-157671446 GAGGGAGGAAAGGTGGGTCAGGG - Intronic
964650861 3:159009687-159009709 GTGCGAGGGAAGGAGGCTGATGG - Intronic
965695264 3:171401437-171401459 AAAGGAGGAAAGGGTGATGATGG + Intronic
966062477 3:175775975-175775997 GAGGGAGAAAAGGATACAGACGG - Intronic
966662916 3:182434539-182434561 CAGAGAGGAAGGAATGCTGAAGG + Intergenic
967334771 3:188331579-188331601 AAAGGAGGAAAGGAGGCAGATGG - Intronic
967380634 3:188853601-188853623 GAGGTAGGACAGCATCCTGAAGG + Intronic
968493054 4:900829-900851 GAGGGAGGAAAGGAAGGAGAAGG + Intronic
969119786 4:4899682-4899704 GAGGCATGCAAGGATGCTGCGGG + Intergenic
969207676 4:5659502-5659524 GAGGGAGGATGGGAGGCTGGGGG + Intronic
969242528 4:5909943-5909965 GAGGGGGGAAAAAATGCTGGGGG - Intronic
969457545 4:7308698-7308720 GAGAGAGGACAGGGTGCTGGTGG - Intronic
969510331 4:7614091-7614113 GATGGATGAATGGATGGTGATGG - Intronic
971367860 4:25991975-25991997 GAGGGTGCAAAGCATGTTGAAGG - Intergenic
972865708 4:43229518-43229540 AAGGGATGAAATAATGCTGAAGG + Intergenic
973164772 4:47063585-47063607 GAGTGAGGAGAGCATGATGAAGG + Intronic
973553643 4:52060070-52060092 GAGCCAAGAGAGGATGCTGAGGG - Intronic
973633826 4:52843730-52843752 GAGAGAGGTAAAGAGGCTGAGGG - Intergenic
974183361 4:58412235-58412257 GAGGGAGGAAGGGAGGGGGAAGG - Intergenic
974473880 4:62355142-62355164 GAGGGAGGGAGGGAGGCAGAGGG - Intergenic
974982672 4:68979343-68979365 GAGGGAGAAAAAGAGGCAGAAGG + Intergenic
975054916 4:69918223-69918245 GAGGTAGGAAGGTGTGCTGATGG - Intergenic
975264934 4:72352465-72352487 GAGAGAGGAAAGAAAGGTGAGGG - Intronic
975521438 4:75305844-75305866 GAGAGAAGGAAGGATGCTGCAGG + Intergenic
975604250 4:76137381-76137403 GAGGGAGGAAGGGATGCATGTGG + Intronic
975735131 4:77373336-77373358 GAGGGAGGGAAGGAGGCACATGG - Intronic
976207913 4:82639802-82639824 GAGGAAGGAGAGGAAGCTGCTGG - Intronic
978061410 4:104344783-104344805 GAGGGAGGCTGGGAGGCTGAGGG + Intergenic
978086026 4:104656501-104656523 GATGGAAGAAAAAATGCTGATGG + Intergenic
978437227 4:108698655-108698677 GAGGGTGGAAAGAGGGCTGAGGG - Intergenic
979032410 4:115666271-115666293 GAGGGAGGAAGGGAGGAAGAAGG - Intergenic
979354798 4:119690738-119690760 CAGGGAGCAAAGGATGGGGAAGG + Intergenic
979553808 4:122021753-122021775 GAAGGATGAAAGGAAGGTGAGGG + Intergenic
979666174 4:123313201-123313223 GGGGGCGGAATGGATGCAGAGGG - Intronic
979994324 4:127412167-127412189 GAGGGAGGAAGGGAGGGAGAGGG + Intergenic
980195632 4:129584280-129584302 GAGGGAGGGAAGGAAGCGAAGGG + Intergenic
981037858 4:140190934-140190956 GAGGGGAGAGAGGATGCTGAGGG + Intergenic
982036358 4:151349814-151349836 GAGAGAGGTAAGGAAGCTGCAGG + Intergenic
982350199 4:154407121-154407143 GAGGGAGGACAGGATACACAAGG + Intronic
982488446 4:155998321-155998343 GAGGGTGGAAAGAAGGGTGAAGG - Intergenic
982601486 4:157456377-157456399 AAGGTAAGAAAGGATTCTGAAGG - Intergenic
984456661 4:179977686-179977708 GAGGGAGAAGAGGATGAAGAGGG - Intergenic
984975870 4:185229539-185229561 GAGGGAGTTGAGGAGGCTGAGGG + Intronic
985563129 5:601976-601998 CAGGGAGCAAAGGAGGCGGAGGG - Intergenic
985730159 5:1543217-1543239 GAGGGAGGAATGAATGGTGGGGG + Intergenic
985783194 5:1881445-1881467 GAGGGAGGCCAGGAGCCTGAAGG + Intronic
985969556 5:3364274-3364296 AAGGGAGGGAAGGATGATGCAGG + Intergenic
985994965 5:3592668-3592690 GAGGCAGGAAAAGTGGCTGAGGG + Intergenic
986152661 5:5141146-5141168 GAAGGAGGAAAGGTTGGGGACGG - Intronic
986261108 5:6147174-6147196 AAGGGAAGAATGGATGCTCAAGG + Intergenic
986507158 5:8464122-8464144 GATGTAGAAATGGATGCTGAGGG - Intergenic
987195138 5:15518463-15518485 GAGGTAGGAAAGGCAGCTCATGG + Intronic
988249722 5:28740909-28740931 GAGGCTGGAAAGGATAGTGAGGG - Intergenic
989022488 5:37025504-37025526 GAGGGAGGGAAGGGTTGTGAGGG + Intronic
990113784 5:52363271-52363293 GAGGGAGGATAGTATGCTCCAGG - Intergenic
990253728 5:53943376-53943398 GAAGGTGGAAGGGATACTGAAGG + Intronic
990464707 5:56061076-56061098 GAGGGAGGCAAGTATGCCCAGGG + Intergenic
990751515 5:59021922-59021944 GAGTGAGGAAAGGTGGTTGATGG - Intronic
990835897 5:60019645-60019667 GAGAGAGGTGAGGAAGCTGAAGG - Intronic
991045423 5:62217989-62218011 GAGTGTTGAAAGGGTGCTGATGG - Intergenic
991132354 5:63137174-63137196 GAAGGTGGAAAGGATTATGAAGG + Intergenic
991175673 5:63685155-63685177 GAGGGAGAAAAGGAAGAGGAAGG - Intergenic
991344417 5:65648118-65648140 GAGGGAGGGATGGGTGGTGATGG - Intronic
991668937 5:69027619-69027641 GATGGAGGAAAGGAAGTTGGCGG + Intergenic
991942115 5:71863172-71863194 GAGGGAGGGAAGGAAGAGGAAGG - Intergenic
992483355 5:77172755-77172777 GGGGGAGCACAGGCTGCTGAGGG + Intergenic
992828641 5:80572831-80572853 GAGGGAGAGAAGGAAGCAGAGGG - Intergenic
994254398 5:97576252-97576274 GAGGGAGGAAGGGAGGGAGAGGG - Intergenic
994682169 5:102901852-102901874 GAGGGAGGAAGGGATGAGAAGGG + Intronic
995160616 5:108976270-108976292 GAGGGAGGAAAAGATCCTAAAGG - Intronic
996108638 5:119538249-119538271 AAGGAAGGAAAGGATACAGAAGG - Intronic
996464024 5:123779109-123779131 GAGGGATGTATGGATGCCGAGGG - Intergenic
996614897 5:125429554-125429576 GAGAGAAGAAAGAATGCTGATGG + Intergenic
996672117 5:126130071-126130093 GAGGGAGGAAAAGATAGAGAGGG - Intergenic
997659631 5:135579312-135579334 GACGGTGGAGAGGCTGCTGAAGG + Intergenic
997902242 5:137777774-137777796 GAAGGAGGAAAGGAGGGGGAGGG - Intergenic
997980675 5:138465816-138465838 GAGTGAGGAAAGGATCCGAACGG - Exonic
999084894 5:148879303-148879325 GAGAAAGGAAGGGAGGCTGAAGG - Intergenic
999184767 5:149698852-149698874 GAGGGAGGGAAGGAAGGAGAGGG + Intergenic
999701272 5:154230734-154230756 ACAGGAGGAAAGGATGCTGTGGG - Intronic
999711699 5:154323723-154323745 CGAGGAGGAAGGGATGCTGAGGG - Intronic
1000386023 5:160675478-160675500 GAGGGAGGAGAGGATGCTGAAGG + Intronic
1000997606 5:167974360-167974382 AAGGGAGGAAAGGAGGGAGAAGG + Intronic
1001089402 5:168726378-168726400 GAGGGAGGCAGGGAGGCAGAGGG + Intronic
1001089408 5:168726396-168726418 GAGGGAGGCAGGGAGGCAGAGGG + Intronic
1001131306 5:169065798-169065820 GAGGGAGGAACAGAGGGTGAGGG + Intronic
1001190920 5:169630396-169630418 GAGGCAGGAAATGAAGCTGTCGG + Intergenic
1001201347 5:169720438-169720460 GAGGGAGGAAGGGATGGAAAAGG - Intronic
1001312121 5:170618528-170618550 GAGGGAGGAAAGGAGGGAGGAGG + Intronic
1001432102 5:171670514-171670536 GAGGGAAGAATGAAGGCTGAGGG - Intergenic
1001560472 5:172665735-172665757 GAGGGAGGAGAGGGAGCAGAGGG - Intronic
1001908381 5:175492794-175492816 GAGGGAGGAGAAGATGCTACCGG + Intronic
1001936400 5:175708889-175708911 GAGGGAGGGATGGATCTTGAGGG + Intergenic
1002193592 5:177491026-177491048 GAGGTGGGCAAGGATGCGGAAGG + Exonic
1002203988 5:177550270-177550292 GTAGGAGGAAATGATACTGAGGG - Intronic
1002556925 5:180049228-180049250 GAGTGAGGGAAGGAGGCAGAGGG - Intronic
1003129830 6:3386281-3386303 GAGGCAGAAAAGGCTGCTCAGGG + Intronic
1003427843 6:6009105-6009127 GAGGAAGGCAAGGACGTTGAGGG - Intergenic
1003493253 6:6642034-6642056 GAAGCAGGAAAGCATGCAGAGGG + Intronic
1003812234 6:9796917-9796939 GAGGGAGGGAAGGAGGGGGAAGG + Intronic
1003963234 6:11228640-11228662 CAGCAAGGAAAGGATGCTAAAGG + Intronic
1004913863 6:20313221-20313243 CGGGGAGAAAAGGAAGCTGAGGG - Intergenic
1005555636 6:26979401-26979423 GAGGGAGGGAAGGAGGGAGAGGG + Intergenic
1005860943 6:29899992-29900014 GAGGGAGGAATAGTGGCTGAGGG - Intergenic
1005994398 6:30922603-30922625 GAGAGAGGAAGGCAGGCTGAGGG + Intronic
1006056170 6:31386066-31386088 GAAGGTGGAAAGTATGCTGGAGG - Intergenic
1006197548 6:32255110-32255132 GAGGGAGAGAAGGAAGCTGAGGG + Intergenic
1006431623 6:34000687-34000709 GAGGGAGCACAGGGGGCTGAGGG + Intergenic
1006510928 6:34520711-34520733 GACGGAGGAAGCCATGCTGAGGG + Intronic
1006521357 6:34572982-34573004 GAGGGTTGAAAGGATGCTTTGGG - Intergenic
1007092651 6:39193762-39193784 GAAAGATGAAAGGCTGCTGAGGG + Intronic
1007227946 6:40328026-40328048 GTGGGAGGCAGGGCTGCTGAGGG + Intergenic
1007532007 6:42551488-42551510 GAGGGATGAAAGGAATCTTAAGG + Intergenic
1007656950 6:43456123-43456145 GAGGGAGGGAAGGGTGGTGGGGG - Exonic
1007835625 6:44671658-44671680 GAAGGAGGTGAGGATGCTGAAGG - Intergenic
1008057449 6:46959820-46959842 GAGGGAGGGAGGGAAGATGAGGG + Intergenic
1008057455 6:46959838-46959860 GAGGGAGGGAGGGAAGATGAGGG + Intergenic
1008170621 6:48201405-48201427 GAGGGAGAAATTGAAGCTGAAGG + Intergenic
1008427424 6:51375752-51375774 GTGGGTGGAGATGATGCTGATGG + Intergenic
1009684273 6:66936336-66936358 GAGGGAGGCTGGGAGGCTGAGGG + Intergenic
1011632337 6:89339544-89339566 GAGGGGGGAAGGGATGGGGAGGG + Intronic
1011694510 6:89899949-89899971 GAGGGAGGAAGGGATGAATAGGG - Intergenic
1011726796 6:90218006-90218028 GAGGGAGGAAAATATTGTGAAGG - Intronic
1012239386 6:96854891-96854913 TATGGAGGAAAGGGTTCTGAAGG - Intergenic
1012259739 6:97073829-97073851 GAGGAAGGAAAGGAGTGTGAAGG + Intronic
1012423969 6:99094330-99094352 GGGGGAGAAAAGGATACTGTGGG + Intergenic
1012582830 6:100889852-100889874 GAAGGAGTAAAGGGTGCTGGGGG - Intergenic
1013024043 6:106251653-106251675 GAGGGAGGAAGGGAGGGGGAGGG + Intronic
1013123268 6:107159294-107159316 GAGGGAGGGAGGGAGGCGGAAGG + Intronic
1013630659 6:111983063-111983085 GAGGGAGGGAAGAATGCACAAGG - Intergenic
1013724066 6:113070827-113070849 GAGGTAGGAATTGATGGTGATGG + Intergenic
1013749074 6:113381099-113381121 GAGGGAGGGAAGAATGATGTTGG + Intergenic
1014218590 6:118777374-118777396 GTGGGAGGAAAGGAAACTGTGGG + Intergenic
1014743454 6:125172021-125172043 GAGGGAGGGAAGGAGGCAGTAGG - Intronic
1014874907 6:126645592-126645614 GAGATAGGAAAGAATGATGAGGG - Intergenic
1015181601 6:130366529-130366551 GGGGAAGGAAAGGGTGCTGACGG + Intronic
1015594088 6:134849642-134849664 GAGGGAGGAAAGAAAGAAGAAGG + Intergenic
1015695453 6:135975345-135975367 CAGAGAGGAAAAGCTGCTGAGGG - Intronic
1015980274 6:138831407-138831429 GAGGGAAGAGGGGAAGCTGAAGG - Intronic
1016317756 6:142808705-142808727 GATGGAGGAAAGGATGGGGGAGG + Intronic
1016461279 6:144282642-144282664 GAGGGAGGGAAGGAAGAGGAAGG - Intergenic
1016739397 6:147511278-147511300 GAGGCTGGAAAGGATGTTAAGGG + Intronic
1016881596 6:148917145-148917167 TGGGGAGGAAAGGCTGCTTAGGG + Intronic
1017017437 6:150113206-150113228 GGGGGAAGAAAGGAGGCTGGGGG - Intergenic
1017075768 6:150616408-150616430 GAGGGAGGCAAGGATGCCTTTGG + Intronic
1017382275 6:153844669-153844691 GCTGGAGGAGAGGATGATGAGGG - Intergenic
1017805229 6:157940024-157940046 GCAGGAGGACTGGATGCTGAGGG - Intronic
1017935925 6:159005019-159005041 GAGGGTGGAATGGATGGTGTGGG + Intergenic
1018219608 6:161565171-161565193 GAGGGAGGCTAAGAAGCTGAGGG - Intronic
1018373165 6:163186954-163186976 GGGGCAGGAAAGGGCGCTGATGG - Intronic
1018445591 6:163855311-163855333 GAGGAATGAAAGGATGCTAATGG - Intergenic
1019142879 6:169959446-169959468 GAGGAAGGAGGGGAAGCTGAGGG - Intergenic
1019142896 6:169959492-169959514 GAGGGAGGAGGGGAAGCCGAGGG - Intergenic
1019160977 6:170066665-170066687 GATGGAGGAATGGAGGGTGAAGG - Intergenic
1019226279 6:170512616-170512638 GAGGGAGGAGAGGCGGCTGAGGG + Intergenic
1019419794 7:945716-945738 GAGGGAGGGAAAGAGGCTGGCGG - Intronic
1019443074 7:1057052-1057074 GAGGGAGGGAGGGAGGCTCAGGG + Intronic
1019536880 7:1533872-1533894 GGGGGAGAACAGGATGCTGATGG + Intronic
1019730632 7:2627555-2627577 GAGAGAGGAAAGGAAGGTGGGGG + Intergenic
1019772803 7:2894389-2894411 GACGGAGGAAGGGATGAAGAAGG - Intergenic
1019910920 7:4100212-4100234 GAGGGAGGGACAGATGCGGATGG + Intronic
1020080210 7:5282774-5282796 GAGGGAGGAGAGGAGGGTGAAGG + Intronic
1020752313 7:12157593-12157615 GAGGGAGGAAGGGAAGGGGAGGG + Intergenic
1021021167 7:15600104-15600126 GAGGGCTGAGAGGGTGCTGATGG - Intergenic
1021352291 7:19609944-19609966 GAGGGAGGAAAAGAGGAAGAAGG - Intergenic
1021729781 7:23585121-23585143 GGGAGAAGAAAGGATGCTGAAGG + Intergenic
1021808723 7:24381832-24381854 GTGGTAGGAAAGGAGGCTCATGG - Intergenic
1022056021 7:26735101-26735123 GAGAGAGGGAAGGATGCTGTGGG - Intronic
1022518137 7:30988602-30988624 GAGGGAGGGAGGGATGGTGTGGG - Intronic
1023038124 7:36150666-36150688 GAGGGAGGAATGGATTTTAAAGG - Intergenic
1023126370 7:36958448-36958470 GAGGGAGGGAAGGACTCTGGAGG - Intronic
1023157723 7:37267627-37267649 GTGTGAGGAAAAGATGCTGTGGG - Intronic
1023622702 7:42088986-42089008 GAGGGAGGAGAGGACTCAGATGG - Intronic
1024532499 7:50405516-50405538 GTGGGAGCCTAGGATGCTGAGGG - Intergenic
1024613632 7:51088591-51088613 GAGAGCAGAAAGGATGCTGGAGG - Intronic
1025198707 7:56949423-56949445 GAGGGAGGAGAGGAGGGTGAAGG - Intergenic
1025673241 7:63627508-63627530 GAGGGAGGAGAGGAGGGTAAAGG + Intergenic
1026300177 7:69090836-69090858 GAGGGAGGGAAGGTAGCGGAGGG + Intergenic
1026384038 7:69827874-69827896 GAGGAAGGAAACCATGCTGTGGG - Intronic
1026662821 7:72317169-72317191 GAGGGAGGGAAGGAGGCAGGAGG + Intronic
1026805738 7:73428995-73429017 GAGGCAGGAAAGGAAGGGGAGGG + Intergenic
1027682030 7:81233366-81233388 GAGGGAGGCCAGGGGGCTGAGGG - Intergenic
1028467003 7:91163739-91163761 GAGGGAGGAAAGGAAGTTGTTGG - Intronic
1028871419 7:95774412-95774434 GAGGGAGGAAAGGCTGGGGGTGG - Intronic
1029806726 7:103005328-103005350 GAGGTAAGAAAGAAGGCTGAAGG + Intronic
1030216205 7:107045359-107045381 GAGACAGAAATGGATGCTGAGGG - Intronic
1032487591 7:132299679-132299701 GAAGGTGGAATGGATGCTGGAGG - Intronic
1033150291 7:138908561-138908583 GAGAGAGGAAAGAATGTAGAGGG + Intronic
1033155230 7:138951025-138951047 GAGGGTGCAAAGGATGGGGAGGG - Intronic
1033156766 7:138963449-138963471 GAGGGAGTAGAGGAACCTGAAGG + Intronic
1033411251 7:141119700-141119722 GATGGAGGAAAGGCTGGAGAAGG + Intronic
1033417952 7:141180950-141180972 GATGGATGAATGGATGTTGATGG - Intronic
1033472921 7:141665355-141665377 GAGGGAGGAAGGGCTGTGGAGGG - Intronic
1033608039 7:142941709-142941731 GAGGGAGTACAGGGTGCTTAAGG + Intronic
1033842057 7:145386743-145386765 GAGGGAGGCAGGGTTGCTGTTGG + Intergenic
1034359443 7:150481163-150481185 GAGGAAGGAGAGGAGGCTGGGGG - Intergenic
1034435147 7:151059803-151059825 GAGGGAGGAAGGGAGGGGGAAGG + Intronic
1034607396 7:152329737-152329759 GAGGGAGGGAAGGAAGGAGATGG + Intronic
1035022900 7:155809457-155809479 GGGGGAGGAAGGGATGGGGAAGG - Intronic
1035633467 8:1126467-1126489 GAGGGAGGCAAGGCAGGTGAGGG + Intergenic
1035791458 8:2309311-2309333 AGGGGAGAAAGGGATGCTGATGG + Intergenic
1035801347 8:2412394-2412416 AGGGGAGAAAGGGATGCTGATGG - Intergenic
1035918578 8:3652349-3652371 GATGGTGGTAAGCATGCTGATGG - Intronic
1036144857 8:6245474-6245496 GAAAGAAGAAAGGGTGCTGATGG + Intergenic
1036280239 8:7394051-7394073 GAGGAAGGACAGGGTCCTGAGGG - Intergenic
1038364053 8:26913043-26913065 CATGGAGGAAAGGCTGATGATGG + Intergenic
1038449994 8:27633821-27633843 GAGGGAGGAAAGGAGGGAGAGGG + Intergenic
1038497308 8:28012872-28012894 GAGGGAGGGAGGGATGGAGAAGG + Intergenic
1038521735 8:28238835-28238857 GACGTGGGCAAGGATGCTGAAGG - Intergenic
1038714444 8:29979336-29979358 GAGGAAGGAAAGGGTGAAGAAGG - Intergenic
1038947021 8:32372581-32372603 GAAGAAGGAAGGGATGATGAAGG + Intronic
1039172540 8:34764299-34764321 GAGGGAAGGAAGGATTCTGGAGG + Intergenic
1039584406 8:38694096-38694118 GAAAGAGGAAAGGATGATGGGGG - Intergenic
1039848779 8:41344625-41344647 AAGGCAGGAAAGGAAGCAGATGG - Intergenic
1039964547 8:42274462-42274484 GAGGCAGGAAAGGGTGGTGGGGG - Intronic
1040058689 8:43085555-43085577 GAGGGAGGAGCTGATGCTAAGGG - Exonic
1040278131 8:46024301-46024323 GAGGCCGAAAGGGATGCTGAAGG - Intergenic
1040448684 8:47522444-47522466 GCAGCAGGAAAGGCTGCTGAAGG + Intronic
1040629516 8:49194080-49194102 GAGGGAAGAAAGGAGGCTAGAGG + Intergenic
1041143535 8:54847129-54847151 GAGGGAGGGAAGGAGACAGAGGG + Intergenic
1043172719 8:76985726-76985748 GAGGGAGGCATGGATCCTGCTGG + Intronic
1043602036 8:81952521-81952543 GAGGGAAGAAGGGAGGATGATGG - Intergenic
1043602040 8:81952539-81952561 GAGGGAGGGAGGGAGGGTGAGGG - Intergenic
1043803565 8:84642971-84642993 GAGGGAGCTAAGGATGCTTTTGG + Intronic
1044047041 8:87448968-87448990 CATGGAGCAAAGGGTGCTGAGGG - Intronic
1044468784 8:92540730-92540752 AAGGGAGGAAAGTGTGCTCAAGG - Intergenic
1045217603 8:100163688-100163710 CAGGGAAGAAAGGAAGCTAAAGG - Intronic
1045297254 8:100882793-100882815 GTGGGAGGAACGGATGAAGAGGG + Intergenic
1045553057 8:103189844-103189866 GAGGGAGAAAGACATGCTGAGGG + Intronic
1045650588 8:104338634-104338656 GAGGGAGGGAGGAAAGCTGAGGG - Intronic
1046651100 8:116837418-116837440 GAGGGAGGGGAGTATGCTAATGG + Intronic
1046859100 8:119070477-119070499 GAGGGAGGGAAGGAGGGGGAAGG - Intronic
1046911240 8:119630083-119630105 TAGGGAAGAAATGATGATGAAGG - Intronic
1047229054 8:122980361-122980383 GATGGAGCAAGGGATGATGATGG + Intergenic
1047306795 8:123659154-123659176 GATGGATGAATGGATGATGATGG - Intergenic
1047754587 8:127908773-127908795 GCGGGAGGAAGGGCTGCGGAAGG + Intergenic
1047958996 8:129997137-129997159 GAGGGAGGAAAGGAGGGAGAGGG + Intronic
1048183123 8:132214527-132214549 GAGGGAGGAGAGGATGTCAAGGG - Intronic
1048213855 8:132479164-132479186 GAGGGGGGAGAGGATGGTGGGGG - Intronic
1048616722 8:136082866-136082888 AATGCTGGAAAGGATGCTGAAGG - Intergenic
1048690300 8:136955681-136955703 GAGGGAGGAAGGGAGGAAGAAGG - Intergenic
1048754836 8:137727260-137727282 GAGGGAGGGAAGGAAGGAGAGGG + Intergenic
1049008944 8:139874694-139874716 AAGGGAGGCAAGGATGAAGAAGG + Intronic
1049149429 8:141024904-141024926 GAGGGATGGACTGATGCTGATGG + Intergenic
1049595460 8:143481331-143481353 CGGGGAGGGAAGGATGCTGAGGG - Intronic
1050173292 9:2844357-2844379 GAGGCAGAACAGGCTGCTGAAGG + Intergenic
1050766488 9:9141194-9141216 GAGGGAGGGAAGCAAGCAGATGG - Intronic
1052045062 9:23784333-23784355 GAAGGAAAAAAGGATGCTGTGGG + Intronic
1052437104 9:28443710-28443732 GAGGGAGGCCAGGGAGCTGAGGG + Intronic
1056713281 9:89008854-89008876 TAGGGAGAGAAGGAAGCTGACGG - Intergenic
1057022173 9:91707755-91707777 GAGGGAGGAAAGAATGGGGGTGG + Intronic
1057113951 9:92502400-92502422 GAGGGAGGTGACGATACTGAAGG - Intronic
1057295262 9:93830867-93830889 GAGGGAGGAAAGAACTCAGAAGG - Intergenic
1057518410 9:95740461-95740483 GTGGGAGGCAAGGAGGTTGAAGG + Intergenic
1058630716 9:106983804-106983826 GAGGAAGGAAGGCATGCTAATGG + Intronic
1059305648 9:113351073-113351095 GAGGGAGGAAGTGATGCTAATGG + Intronic
1059310989 9:113389091-113389113 GAGGGAGGTCAGGGTGCTGCAGG + Exonic
1059419770 9:114183571-114183593 TAGGGTGGAAAGGATGGTGGTGG + Intronic
1059502587 9:114767615-114767637 GAGGGAGGAGAGGGGACTGAAGG + Intergenic
1059703789 9:116801149-116801171 GAGGGAGGAAAGGAAGTAGTAGG + Intronic
1060041947 9:120307744-120307766 CAGGGAGGACAGGATGCTTTTGG - Intergenic
1060183915 9:121552380-121552402 GAGGGAGGAAAGTAGGCTGGTGG - Intergenic
1060259128 9:122058296-122058318 GAGGGAGGAAAGCCTGCCCACGG + Intronic
1060371624 9:123078848-123078870 GAAACAGGAAAGGATGATGATGG - Intronic
1060742165 9:126106277-126106299 GGGGGAGAAAAGAAGGCTGAAGG + Intergenic
1060927803 9:127467446-127467468 GAGGGAGGGAAGGGGGCTGCAGG + Intronic
1061049000 9:128183129-128183151 GAGGGAGGGAGGGAGGCTGCAGG - Intronic
1061105826 9:128529672-128529694 GAGAGAGGAAAGGGTAGTGAGGG - Intronic
1061198168 9:129119860-129119882 GAGGGAGGGCAGGAGGCTGTGGG + Intronic
1061284342 9:129613650-129613672 GAGGGAGGAAAAGAGGGTGGGGG - Intronic
1061633886 9:131893156-131893178 GAGGAAGGAAAGGCTCCCGATGG + Intronic
1061871788 9:133524788-133524810 GAGGAAGGCCAGGCTGCTGAGGG + Exonic
1061887875 9:133601889-133601911 CAGGGAGGAAGGGACTCTGAGGG + Intergenic
1061981097 9:134104055-134104077 GATGGATGAATGGATGGTGATGG - Intergenic
1061981189 9:134104449-134104471 GATGGATGAATGGATGATGATGG - Intergenic
1062004773 9:134233653-134233675 GCGAGAGGAAAGGCTCCTGACGG - Intergenic
1062018806 9:134306370-134306392 GATGGTGGTAAGGATGTTGATGG + Intergenic
1062097877 9:134712163-134712185 GAGGGGGGAAAGGAAGAAGATGG - Intronic
1062143726 9:134976708-134976730 GAGGGGGGAAGGGATGGGGAGGG - Intergenic
1062172845 9:135144964-135144986 AAGGGAGGGAAGGCCGCTGAGGG + Intergenic
1062560248 9:137138445-137138467 GAGAGAGGAGCGGAAGCTGAGGG + Intronic
1203549237 Un_KI270743v1:154335-154357 GATGGTGGCAAGGATGCTGCTGG + Intergenic
1185608452 X:1380480-1380502 GAGGGGGGAAAGGAGGGGGAAGG + Intronic
1185627603 X:1493428-1493450 GAGGGAGGGAAGGAGGAGGAAGG + Intronic
1185803283 X:3032575-3032597 GAGGGAGGAAGGGAAGAGGAGGG + Intronic
1185834169 X:3329441-3329463 GAGGGAAGGAAGGAAGATGAAGG + Intronic
1185867564 X:3637114-3637136 GAGGGAGGAAAGGAAAGGGAAGG + Intronic
1186648760 X:11536128-11536150 GAGGGTGGAATAGATGCTGTAGG + Intronic
1187233142 X:17441626-17441648 GAAGGAGGAAAGGAGGGAGATGG - Intronic
1187327870 X:18308341-18308363 GAGGGAGGAAAGGACAGGGAGGG + Intronic
1187522256 X:20024187-20024209 TAGAGAGGAAAGCATGTTGAAGG - Intronic
1187725024 X:22193372-22193394 GAGGGAGGGATGGTTCCTGATGG - Intronic
1187726609 X:22209738-22209760 GAGGGAGGAGAGGGAGCAGAGGG - Intronic
1188309161 X:28596372-28596394 GGGGGAGGAAAGGAAGAAGAAGG - Intronic
1188742603 X:33804611-33804633 GAGGCAGGAAAGGGTACTGGGGG - Intergenic
1188890898 X:35610324-35610346 GAAGGAGGAATGGAGGGTGAAGG - Intergenic
1190702957 X:53001679-53001701 GAGGGAGAAAAAGATGGGGAAGG - Intergenic
1190797661 X:53759797-53759819 GAGGGAGGAGAAGATGGGGAGGG - Intergenic
1190917489 X:54821372-54821394 GAGGGAGGAGAAGATGAAGAGGG + Intergenic
1190931297 X:54951323-54951345 GAGGGAGGAGAGGATGGGGAGGG + Intronic
1191866771 X:65710060-65710082 GAAGGAGGCAAGGATGCAGATGG - Intronic
1192308439 X:69988244-69988266 GAGGCTGGAAAGGATAATGAAGG + Intronic
1195036788 X:100977322-100977344 CAGGGTGGAAAGGATAGTGAGGG - Intronic
1195480442 X:105338730-105338752 GTGGCAGCAAAAGATGCTGAAGG - Intronic
1195599137 X:106726608-106726630 GAGGGAGGAAAGGACACTGCGGG - Intronic
1195617003 X:106920485-106920507 GAGGGAGAAAGGGATCCTGAGGG - Intronic
1195934616 X:110113008-110113030 GAGGAAGGAAAGCAGGGTGAGGG - Intronic
1196232590 X:113240898-113240920 GAGGGTGGAAAGGTTGCTTGGGG + Intergenic
1196462517 X:115945000-115945022 GAGTGGGGAAAGGATGCCCAAGG + Intergenic
1196545901 X:116963644-116963666 GAGGAAGGAGAGGAGGATGAAGG + Intergenic
1196902374 X:120397985-120398007 TAGGGAGGGAAGAGTGCTGAAGG - Intergenic
1196910770 X:120482285-120482307 AAGGGAGGGGAGGATGCAGAAGG - Intergenic
1197776635 X:130122366-130122388 TAGGTGGGAAAGGATGCTTACGG - Intergenic
1197816000 X:130499393-130499415 AAGGGAGGAAAGAAGGCAGAAGG - Intergenic
1198297361 X:135300872-135300894 GAGGGAGGGAAGGATGAGGCAGG + Intronic
1198680985 X:139181948-139181970 GAGGGAGAAGAGGGTGGTGAAGG - Intronic
1198973855 X:142312685-142312707 GAGGTAGAAGAGGAAGCTGAAGG + Intergenic
1199458314 X:148054252-148054274 GAGGGTGCTGAGGATGCTGAGGG + Intergenic
1199665956 X:150096636-150096658 GAGGGAGAACAGGATGGTGAAGG - Intergenic
1200063657 X:153494879-153494901 GAGGGAGGAAAGGAGGGAGGGGG - Intronic
1200081670 X:153579912-153579934 GAGGGAGGAAAGGAAGGGAAAGG - Intronic
1200243309 X:154508819-154508841 GAGAAAAGAAAGGATGCTGAGGG + Intronic
1200656831 Y:5912638-5912660 GAGGGAGGGAAGGAGGGAGAGGG + Intergenic
1201146545 Y:11067906-11067928 GAGGGAGGAAAGGAGGGAGAGGG + Intergenic
1201266291 Y:12210328-12210350 GAGGGAGGAAAAGAAGGAGAGGG + Intergenic