ID: 933222637

View in Genome Browser
Species Human (GRCh38)
Location 2:79708082-79708104
Sequence TGGGCATTACCACAATACTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 85}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933222637_933222641 10 Left 933222637 2:79708082-79708104 CCCAAGTATTGTGGTAATGCCCA 0: 1
1: 0
2: 0
3: 1
4: 85
Right 933222641 2:79708115-79708137 GTTAGATCAAGTGATTGTAGAGG 0: 1
1: 0
2: 0
3: 13
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933222637 Original CRISPR TGGGCATTACCACAATACTT GGG (reversed) Intronic
900813322 1:4824812-4824834 GGGGCCTTACCACAATTCATAGG + Intergenic
900857323 1:5196505-5196527 TGGGCATTTCTACAATGCTAGGG - Intergenic
908655751 1:66386283-66386305 TAGTCAATACCAAAATACTTTGG - Intergenic
908829931 1:68168683-68168705 TGTGCATTCCCACATTACATAGG + Intronic
909190580 1:72543703-72543725 TGTACATTACTACATTACTTTGG - Intergenic
909512282 1:76467729-76467751 TGTGCATTACTAAAATAATTAGG + Intronic
913345334 1:117803711-117803733 AGGGGATGACCACAATATTTTGG + Intergenic
923942110 1:238839760-238839782 TGGGAATTACTAAAATATTTTGG + Intergenic
1063755644 10:9004496-9004518 TGGGCATTTCCACAAAATCTCGG + Intergenic
1066600745 10:37104024-37104046 TGTGCATTTCCCCAATGCTTTGG + Intergenic
1066601455 10:37112210-37112232 TGTGCATTTCCCCAATGCTTTGG - Intergenic
1069981311 10:72254845-72254867 GGGGCATTACCACTGGACTTGGG + Intergenic
1070036979 10:72735532-72735554 TAGACATGAACACAATACTTTGG - Intronic
1070451477 10:76561974-76561996 TGGGCTTAAGCACAATATTTAGG + Intergenic
1080686261 11:34517654-34517676 TGGGCATTACCATAACAAGTAGG + Intergenic
1080831113 11:35894146-35894168 TGTGCTTTACCACAAGCCTTGGG + Intergenic
1088533188 11:110832614-110832636 TGAGCATTTCCAGATTACTTAGG + Intergenic
1088902602 11:114129445-114129467 TGGGCATTTCAACAAGCCTTGGG - Intronic
1090140179 11:124249803-124249825 TGGGCATGACCACACTGATTTGG + Exonic
1093753819 12:22830565-22830587 TGGGCCTTCCCACAACACGTGGG - Intergenic
1095477001 12:42595884-42595906 TATGCAATACCAGAATACTTCGG - Intergenic
1096446625 12:51698828-51698850 TTGGCATTTCCAGAATCCTTGGG + Intronic
1097478333 12:60087484-60087506 TGGGCCTTCCCACAACACCTGGG - Intergenic
1098114376 12:67159447-67159469 TAGTCATTCCCACAATACTGAGG + Intergenic
1099919080 12:88934780-88934802 CAGGCATTATCACAATGCTTAGG - Intergenic
1108555258 13:51584933-51584955 TGCGCATTACAATAAAACTTGGG - Intronic
1115462346 14:33675238-33675260 AGAGCATTACCACTATTCTTAGG + Intronic
1118238425 14:64033142-64033164 TGGGCAATAGCACAACACCTTGG + Intronic
1120782799 14:88501116-88501138 TGTGTTTTACCACAAAACTTTGG + Intronic
1126223635 15:46243986-46244008 TAGGCATTACTACAATATCTTGG - Intergenic
1133862098 16:9605582-9605604 TGGGAATTACCAAAATATTTGGG + Intergenic
1149121329 17:53169712-53169734 TGGGCAATGCCAAAATATTTGGG - Intergenic
1151172955 17:72263470-72263492 GCGGCATTTCCAGAATACTTAGG + Intergenic
1166564221 19:43753984-43754006 TGGGGATTACCCCCAAACTTAGG + Intronic
1167518970 19:49940830-49940852 TGAGCATTATCACACTCCTTTGG - Intronic
928655168 2:33443422-33443444 TGGGTATTACTAGAATTCTTTGG + Intronic
929949358 2:46394509-46394531 TGGGTAATCCCACAATACTATGG + Intergenic
932514491 2:72331244-72331266 TGTGTATTCCCACAACACTTAGG + Intronic
933222637 2:79708082-79708104 TGGGCATTACCACAATACTTGGG - Intronic
936349859 2:111704325-111704347 TGGGCATGTCCACAGTACTGGGG + Intergenic
944735868 2:202564022-202564044 TGGGAATTATCACAAAACATTGG + Exonic
946155791 2:217805974-217805996 TGGGCATTACCCCAGGCCTTTGG - Intronic
947022061 2:225689983-225690005 TGGGCAATACCAAAATAGTAGGG - Intergenic
1171222214 20:23409024-23409046 TGGGCCTTTCCACCATACCTTGG - Intronic
1173108902 20:40166349-40166371 TTGGCATTTCCACAAAATTTGGG + Intergenic
1174741008 20:53014348-53014370 TGGGCTTTAACACAGGACTTTGG + Intronic
1175149698 20:56923819-56923841 TCTGCATTACCAAGATACTTGGG - Intergenic
1181421939 22:22806962-22806984 TGGTCCTTACCAAAATATTTTGG + Intronic
952205043 3:31172834-31172856 TGGGAATTACCAGACAACTTTGG - Intergenic
954676681 3:52319742-52319764 TGTGCATTACCAGTATACTCAGG - Intronic
959327022 3:104950086-104950108 TGGTCCTTCCCACAACACTTGGG + Intergenic
959790078 3:110349042-110349064 AGCGCATTACCCAAATACTTTGG - Intergenic
961879193 3:130048860-130048882 CAGGCATTATCACATTACTTTGG - Intergenic
961996640 3:131252260-131252282 TGGGCATTACCAAAGTGCCTAGG - Intronic
966027115 3:175297609-175297631 TGGGTAATACCACAATAATAAGG - Intronic
984055021 4:174917544-174917566 TGTTCATTACCAATATACTTTGG - Intronic
984539886 4:181024381-181024403 TGAGCACTACCACAGTAGTTTGG + Intergenic
988025345 5:25679577-25679599 TGGGCATTTCCACAACATGTGGG - Intergenic
992312774 5:75519013-75519035 TGGGCAGCACAACAATACCTGGG - Intronic
993485728 5:88481849-88481871 TGGTTATTTACACAATACTTAGG + Intergenic
1007322549 6:41038227-41038249 TGGGTATTACCACATAACTGAGG - Intronic
1009572863 6:65411487-65411509 TTGGCATTAGCATAATATTTGGG + Intronic
1011463843 6:87634576-87634598 CTAGCATTCCCACAATACTTTGG - Intronic
1011651434 6:89509812-89509834 TAGACATCACCACATTACTTGGG - Intronic
1012059279 6:94457284-94457306 TGAGAATTAACAAAATACTTTGG + Intergenic
1012742196 6:103032039-103032061 TGGGAATTGGCACAATACTGAGG + Intergenic
1013899244 6:115133053-115133075 TGGGGACAACCACAGTACTTTGG + Intergenic
1019659440 7:2215805-2215827 TGGGCGTGACCACAATACCGAGG + Intronic
1020914959 7:14181460-14181482 TGAGCATTGCCACAATCCATTGG + Intronic
1021290687 7:18840594-18840616 TAGGCATTACTAAAATATTTTGG + Intronic
1027679017 7:81195731-81195753 TGGAGATTAACACAATTCTTAGG + Intronic
1028939381 7:96503889-96503911 TGGGCAGTACCACAGTATCTGGG - Intronic
1031319449 7:120304819-120304841 TAGGAATCACCAGAATACTTAGG - Intronic
1033777420 7:144628267-144628289 TGGTCCCTCCCACAATACTTGGG - Intronic
1038701175 8:29850505-29850527 TGGTCATTATCACAGTCCTTTGG + Intergenic
1040504812 8:48037680-48037702 TGGGCCTAGCCACAATTCTTTGG + Intronic
1045915823 8:107469408-107469430 AGTGCTTTACCACAATGCTTGGG + Intronic
1047415095 8:124658208-124658230 TGGTCCTTCCCACAATACATGGG - Intronic
1049115649 8:140684784-140684806 TGGGCGGTACGACCATACTTTGG - Intronic
1052811459 9:33064526-33064548 TGGGGAATACCACAAAACCTAGG - Intronic
1058611345 9:106779589-106779611 TGGGCATTTGCAAAATTCTTGGG - Intergenic
1059871477 9:118582961-118582983 TGGCCATTACCACAAATCTCTGG + Intergenic
1186079222 X:5912379-5912401 TGGGTTTTTCCAGAATACTTTGG - Intronic
1186204558 X:7187766-7187788 TGGGCATTACAAAAATCATTTGG + Intergenic
1187889836 X:23923807-23923829 TGGGCGTAACCCCAACACTTTGG + Intronic
1188055922 X:25541289-25541311 AGGACCTTCCCACAATACTTGGG + Intergenic
1201700011 Y:16870420-16870442 TGGGCATAACCTCAGCACTTTGG + Intergenic