ID: 933227851

View in Genome Browser
Species Human (GRCh38)
Location 2:79771719-79771741
Sequence AAATAAATACAGATGAAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 819
Summary {0: 1, 1: 0, 2: 2, 3: 83, 4: 733}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933227850_933227851 -2 Left 933227850 2:79771698-79771720 CCAGTGATGAGGAGTGGCTGTAA 0: 3
1: 7
2: 14
3: 49
4: 210
Right 933227851 2:79771719-79771741 AAATAAATACAGATGAAGCTTGG 0: 1
1: 0
2: 2
3: 83
4: 733

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933227851 Original CRISPR AAATAAATACAGATGAAGCT TGG Intronic
900248614 1:1653316-1653338 AAAAAAATAAAAATAAAGCTGGG - Intronic
901293236 1:8140811-8140833 AAATAAATAAATAAAAAGCTGGG + Intergenic
901473213 1:9472012-9472034 AAATAAATACGCAAGAGGCTTGG + Intergenic
901523137 1:9800949-9800971 AAATAAATAAATAAGAGGCTGGG + Intronic
901552404 1:10005356-10005378 AAATAAAAACAGCTGAGGCTGGG - Intronic
902385825 1:16075170-16075192 AAATAAATAAATAAAAAGCTAGG + Intergenic
902438585 1:16414362-16414384 AAATAAATACAGTTTAGGCTGGG - Intronic
902830510 1:19009411-19009433 ACATCGCTACAGATGAAGCTGGG + Intergenic
902890284 1:19438368-19438390 AAGGAAATACAGAGGAAGCTGGG + Intronic
904510788 1:31005488-31005510 AAAAAAATAAAGCTGATGCTGGG - Intronic
904979576 1:34486123-34486145 AATTAAATTCAGCTGAAGCCAGG - Intergenic
905160217 1:36026401-36026423 ATTTAAAAACAGATGAGGCTGGG - Intronic
905192672 1:36247859-36247881 AAAAAAAAAAAGATGAAGATGGG - Intronic
906007432 1:42488105-42488127 AAATATATACAAAAGTAGCTAGG - Intronic
906010597 1:42520947-42520969 AAATACTTAAAGATGAGGCTGGG - Intronic
907395754 1:54188887-54188909 TAATAAATGCATATGAGGCTGGG + Intronic
907460621 1:54603358-54603380 AAATAAATAAAAATGAAGCCAGG + Intronic
909771426 1:79427076-79427098 AAATAAACACAGAAGAGACTAGG + Intergenic
909991241 1:82225038-82225060 AAATATATACACATGAGACTGGG - Intergenic
910519497 1:88103202-88103224 AAACAAATACAGTTGGAGCATGG - Intergenic
910857572 1:91710943-91710965 AGATTAACACACATGAAGCTGGG + Intronic
910991574 1:93061899-93061921 AAAAAAAAATAGAAGAAGCTGGG - Intergenic
910999855 1:93151786-93151808 AACTAAATAGAGATGAAGGAAGG + Exonic
911125079 1:94333859-94333881 AAAAAAAGTCAGATGCAGCTGGG + Intergenic
911848691 1:102786557-102786579 AGATAAATAAAGAAGAAGCTGGG - Intergenic
912119505 1:106453104-106453126 AAACAAATTCTAATGAAGCTAGG - Intergenic
912221894 1:107687766-107687788 AAAAAAATACAGAAGATGATGGG - Intronic
912249365 1:107994945-107994967 AAATAAATACATGTGAAATTTGG - Intergenic
914681381 1:149940822-149940844 AAATTAATATAGATTCAGCTTGG - Exonic
914688166 1:150001004-150001026 AAATAAATAAAGATGTGGCGGGG + Intronic
915044313 1:152999348-152999370 AAATAAACAGGGGTGAAGCTAGG + Intergenic
915387866 1:155512745-155512767 AAAAAAACACATATCAAGCTGGG + Intronic
915939224 1:160108148-160108170 AAAAAAATACCGATGCGGCTGGG + Intergenic
916081786 1:161237984-161238006 AATAAAATACAGATAATGCTGGG - Intronic
916238813 1:162618020-162618042 AAAGAAAAACAGCTGAAACTAGG - Intergenic
916249913 1:162727558-162727580 AAATAAATACAGAGAAGCCTGGG + Intronic
916250095 1:162729705-162729727 AAATAAATACAGAAAAGCCTGGG - Intronic
916407162 1:164508906-164508928 TCTTAAATTCAGATGAAGCTGGG - Intergenic
916714466 1:167438009-167438031 AAATAAAGACAGAGGAAGGAAGG + Intronic
916842370 1:168613626-168613648 TAATAAAAACAGATGCAGATTGG - Intergenic
916874804 1:168958018-168958040 CAGTAAATACAAATGAAGCTTGG + Intergenic
917245807 1:172999046-172999068 AAATAAATTCAGCTGAGCCTTGG + Intergenic
917714206 1:177717599-177717621 AAAAAAATAGAGATGGAGGTGGG + Intergenic
917735714 1:177918155-177918177 AAATAAAAAAAGAAAAAGCTAGG - Intergenic
918624733 1:186644448-186644470 AAAAAAATAAAAATGTAGCTAGG + Intergenic
918974058 1:191457812-191457834 AAAAAATTTCAGATGAAGTTTGG + Intergenic
919664541 1:200279408-200279430 AAGTAAATAAAGATGAAATTTGG + Intergenic
920510402 1:206547315-206547337 CTGTAAATACAGATGAAGCGTGG - Intronic
920612821 1:207458268-207458290 AAAAAAAAAAAAATGAAGCTTGG - Intronic
921030428 1:211331204-211331226 AATTGAATACAGATGGACCTGGG - Intronic
923604550 1:235431659-235431681 AAATAAATAAAAATGAAAGTGGG - Intronic
923604594 1:235431970-235431992 AAATAAATAAAAATGAAAGTGGG - Intronic
923682595 1:236130259-236130281 AAAAAAATGCAGAGGAACCTCGG + Intergenic
923781461 1:237028851-237028873 AAATAAATAAAGTTGAATGTGGG + Intergenic
923872127 1:238006821-238006843 AAATATAAACAGAGAAAGCTTGG - Intergenic
924166699 1:241291118-241291140 AAATAAACACAGACAAAGCCAGG + Intronic
924189484 1:241535239-241535261 AAAAAAAAACAGAAGAAGATGGG - Intronic
924228303 1:241941522-241941544 AAAAAAACACAGATGTGGCTGGG - Intergenic
924231190 1:241963270-241963292 AAAGAAATACATTTGAGGCTGGG - Intergenic
1063163520 10:3438673-3438695 AAATCAATCCAGATTAATCTAGG + Intergenic
1063756003 10:9009215-9009237 AAATCTATCCGGATGAAGCTTGG + Intergenic
1063762212 10:9092808-9092830 AAATGATTACAGATGAATTTAGG - Intergenic
1063830011 10:9941950-9941972 AAATAAATAGAAATGACACTGGG - Intergenic
1063856298 10:10257998-10258020 AAATCCATACATATAAAGCTAGG - Intergenic
1064420067 10:15183189-15183211 AAATAAATCCAGATTATCCTGGG + Intergenic
1064653550 10:17534337-17534359 AAAAATATACAGATGAGGCTGGG + Intergenic
1064720119 10:18220555-18220577 AAATAAACACAGATAAGGCTGGG - Intronic
1065018314 10:21481699-21481721 AAATAAATAAAGATTGAGGTTGG + Intergenic
1065682696 10:28253199-28253221 AAAGAAATGCAGATGAGGCCGGG - Intronic
1065754485 10:28918763-28918785 TAAGAAGGACAGATGAAGCTGGG - Intergenic
1065880285 10:30031735-30031757 AAAAAAATACAGATGGGGCTGGG - Intronic
1066384872 10:34933554-34933576 AAAAAAAAAAAGAAGAAGCTGGG + Intergenic
1066717463 10:38301626-38301648 AAATAAATAAAGAATTAGCTGGG + Intergenic
1067124037 10:43500168-43500190 AAAAATATAAAGATGAAGCCAGG - Intergenic
1068582339 10:58755989-58756011 AAATAAATCCAGAGGAAAATGGG - Intronic
1068982968 10:63080950-63080972 AAATAAACACAGAAGAACTTAGG + Intergenic
1069481106 10:68783161-68783183 AAATAAATAAATATTTAGCTGGG - Intronic
1069565755 10:69462294-69462316 AAAATATTACAGATAAAGCTAGG - Intronic
1069680262 10:70279441-70279463 AAATAAATAAAGATTGAGTTTGG - Intronic
1070900603 10:80025528-80025550 AAATAAATAAAGATGCAGGCTGG + Intergenic
1071345306 10:84686428-84686450 AAAAAAAAAAAGAAGAAGCTGGG + Intergenic
1071680602 10:87701847-87701869 AAATAAGTACAAATCAACCTGGG + Intronic
1071767407 10:88683396-88683418 ATAAAAATACAGATGAGGCCAGG + Intergenic
1071843367 10:89496149-89496171 AAATAAATTCAGAGGAAACATGG + Intronic
1072074136 10:91951441-91951463 AAATTATTACAGAAGAAACTTGG + Exonic
1072712679 10:97727418-97727440 AAATAAATAAAAATAAAACTGGG - Intergenic
1072780550 10:98248399-98248421 AAATAACAACAGATGAAGAAAGG + Exonic
1073563022 10:104512938-104512960 ATATTAATTCAGAGGAAGCTGGG - Intergenic
1073672283 10:105605737-105605759 ATAAAAATAGAGCTGAAGCTAGG - Intergenic
1073844856 10:107543821-107543843 AAATTAATAAATATGAATCTTGG + Intergenic
1074530908 10:114298080-114298102 AAAAAAATACAGTTCAAGCTGGG + Intronic
1074627631 10:115210325-115210347 AAACAAATACAAATAAAACTGGG - Intronic
1074852683 10:117451343-117451365 AAATAAATAAATATAAAGCCTGG - Intergenic
1075373486 10:121957932-121957954 AAAAAAATAAAGTTGAAGCCAGG + Intronic
1076925931 10:133487016-133487038 AAATAATAACAGATGAAGCAAGG - Intergenic
1079947459 11:26761965-26761987 AACTAACTCCAAATGAAGCTAGG + Intergenic
1080079910 11:28204624-28204646 AATTGAATAGAGATGAATCTGGG - Intronic
1080096264 11:28411286-28411308 AAATAAATACAAATAAAAGTTGG + Intergenic
1080785554 11:35472055-35472077 AAGTAAACACTGATGAAACTCGG - Intronic
1080875811 11:36273469-36273491 AAATAAATAAAAAGGAAGCAAGG - Intergenic
1081036067 11:38148295-38148317 AATTAAATACCAATGAGGCTGGG - Intergenic
1081108518 11:39102323-39102345 CAATAAAAACAGATGGACCTAGG - Intergenic
1081706708 11:45186429-45186451 AAATTAATGCAGCTGAAGCCCGG + Intronic
1082083596 11:48031151-48031173 AAATAACAAAAGATGAGGCTAGG - Intronic
1082087825 11:48064586-48064608 AAATAAATACATTTGCAGCTCGG - Intronic
1083465906 11:62845930-62845952 AATTAAATAAAAATGAGGCTGGG - Intergenic
1083577128 11:63800320-63800342 AAATAAAAAGAAATGAAGCCAGG + Intergenic
1084108869 11:66999968-66999990 AAATAATAATAGAGGAAGCTGGG + Intergenic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1084522005 11:69669041-69669063 AAAAAAATTGACATGAAGCTTGG + Intronic
1084851541 11:71945287-71945309 AAATAAATAAAAGTGAATCTTGG - Intronic
1084906997 11:72356121-72356143 AAAAAAATACAAATTTAGCTGGG + Intronic
1084976568 11:72803030-72803052 AAATAAATAAATAAAAAGCTTGG + Intergenic
1085134785 11:74076628-74076650 AAGTGATTAGAGATGAAGCTAGG - Intronic
1085410874 11:76289642-76289664 AAATAAATAAATAAAAAGCTGGG + Intergenic
1085677744 11:78540627-78540649 GAATACATAAAGATGAAGCATGG + Intronic
1085991564 11:81852978-81853000 AAGAAAATGCACATGAAGCTGGG + Intergenic
1086083024 11:82924838-82924860 AAAAAAAAACAAATGAAACTTGG + Intronic
1086523447 11:87697760-87697782 AAATAGAGAGAGAGGAAGCTGGG - Intergenic
1086543106 11:87936330-87936352 AAATAAATAAAAATAAAGCTTGG - Intergenic
1086543339 11:87939110-87939132 AAAGAAATACATTTTAAGCTAGG - Intergenic
1086650091 11:89278027-89278049 AAATAGCTCCAGATGAGGCTAGG - Intronic
1086902082 11:92379251-92379273 AAATAAATATATAAGAATCTAGG - Intronic
1087257120 11:95968440-95968462 AAAGAAATAAAGTAGAAGCTTGG - Intergenic
1088030529 11:105243138-105243160 ATATAAATATAGATCAAACTTGG + Intergenic
1089074145 11:115724278-115724300 AAAGAAATACAAATTAAGTTTGG - Intergenic
1089084608 11:115806396-115806418 AAATAAATAAAGATGAAGGCGGG + Intergenic
1089677383 11:120098917-120098939 AAATGCACACAGATGCAGCTGGG - Intergenic
1090956909 11:131521353-131521375 AAATAAATGCAGAAGAAGCAAGG + Intronic
1091007226 11:131964461-131964483 AAATAAATTCAAATAATGCTGGG - Intronic
1091182095 11:133614579-133614601 TAATAAATAAAAATGGAGCTGGG + Intergenic
1091556300 12:1576125-1576147 AAATTACTGCAGATGAAGCAGGG + Intronic
1092659766 12:10725172-10725194 AAATAATTACAGATGCACCCTGG + Intergenic
1093093753 12:14949602-14949624 AATTAAATAGAGATAAAGATTGG + Intronic
1093241556 12:16682957-16682979 AGATAAACACAGATGCAGGTAGG - Intergenic
1093472478 12:19517635-19517657 AAATAAATACAGTTGTCTCTCGG - Intronic
1093717218 12:22397111-22397133 AAATAAAAACAGATCAAGTTAGG + Intronic
1094047840 12:26186871-26186893 AAACAATTACAGCTGAAGCAAGG - Intronic
1094188609 12:27672736-27672758 AAATGAAAACTGATGAAGCAAGG - Intronic
1094213179 12:27913996-27914018 AAAAAAATAGAGATGAATTTAGG + Intergenic
1094304470 12:29002051-29002073 AAAGAAACACAGATGGAACTAGG + Intergenic
1094426262 12:30320328-30320350 AGATAAACACAGATGAAAATAGG + Intergenic
1094565797 12:31597566-31597588 AAATAAATAAAGAATTAGCTGGG - Intergenic
1095198233 12:39349427-39349449 AAATAGATAAACATGAAGCATGG + Intronic
1095343474 12:41120401-41120423 ACAAAAATGCAAATGAAGCTGGG + Intergenic
1095359947 12:41325360-41325382 AAATGCATACAAATGAATCTTGG - Intronic
1095427659 12:42094360-42094382 AAAAAAAAAAAGATGAGGCTGGG + Intronic
1095811751 12:46379270-46379292 AGTTAAATACATAAGAAGCTGGG - Intergenic
1095820428 12:46472534-46472556 AAAAAAATACATTTGAAGTTTGG + Intergenic
1095979254 12:47961789-47961811 AAATTATTAAAGATGATGCTAGG - Intergenic
1096293860 12:50366715-50366737 AAAAAAATACACAAGAGGCTGGG + Intronic
1096392068 12:51237486-51237508 AAATAAATAAAAATAAGGCTCGG + Intergenic
1097027182 12:56065701-56065723 AAAGAAATAAAAATGAAGCCTGG + Intergenic
1097422639 12:59399279-59399301 AGAAAAATACAGATGAACATAGG - Intergenic
1097438587 12:59581386-59581408 ATATGAATTCAGATCAAGCTAGG - Intergenic
1097453142 12:59760906-59760928 AAATAAAAAGACATGAAGCAAGG + Intronic
1098002014 12:65954907-65954929 AAATAAATAGAAATGAGGCTGGG + Intronic
1098874520 12:75853282-75853304 AAATAAATGCAAATGAAGTAGGG - Intergenic
1099081649 12:78190931-78190953 AAATAATTACAGGTAAAACTAGG - Intronic
1099213603 12:79825181-79825203 AAATAAATTCAGATGGAATTAGG + Intronic
1099307651 12:80977981-80978003 AAATGAATACAGATTAATATGGG - Intronic
1099922618 12:88978113-88978135 AAAAAAATCCAAATGAAGTTGGG + Intergenic
1099982543 12:89623343-89623365 AAAAAAAAAAAGATGTAGCTTGG - Intronic
1100436536 12:94576448-94576470 AAATTCATAAAAATGAAGCTGGG + Intronic
1100443761 12:94642017-94642039 AAATAAATTCAGAAGAAGAATGG + Intronic
1100588733 12:96004316-96004338 AAATATACAAAGATAAAGCTAGG - Intronic
1101018845 12:100531158-100531180 AAAAAAGTTCAGATGAGGCTGGG + Intronic
1101262258 12:103045218-103045240 AAATAAATACAGCTGAAGAACGG - Intergenic
1101406448 12:104433234-104433256 AAAGAAAGACAGATGGACCTGGG + Intergenic
1102187888 12:110964048-110964070 AAAGTAGTACAGATGAAACTTGG - Intergenic
1103240088 12:119405874-119405896 TAAAAAATATAGATGAGGCTGGG + Intronic
1103259275 12:119572631-119572653 AAAGAAAAACAGAGGAGGCTGGG + Intergenic
1103430572 12:120881746-120881768 CGCTAAATATAGATGAAGCTCGG + Intronic
1103788961 12:123455577-123455599 AAAAAAATACACAAGAAGCCTGG - Intergenic
1104431017 12:128716256-128716278 AAAAAAATTCAGATTAAGTTAGG + Intergenic
1105449495 13:20486215-20486237 AAAGAAATAAAGATGAAGGCTGG - Intronic
1106504460 13:30359115-30359137 AAATAAATAAAAAGGAAGCTAGG - Intergenic
1106909577 13:34449150-34449172 GAATAAAGACAGAGGAAACTAGG + Intergenic
1107871213 13:44748453-44748475 AAAAAAATACAAATGAACTTGGG - Intergenic
1108107476 13:47027271-47027293 GAATTAAAACAGATGAAGTTGGG + Intergenic
1108227939 13:48308356-48308378 AAATAAATAAAAATAAGGCTGGG + Intronic
1108878483 13:55078186-55078208 AAATTAATAAGGATGAAGCATGG - Intergenic
1108969354 13:56352866-56352888 AAATGAATACAGATTAAATTAGG - Intergenic
1109080253 13:57890552-57890574 AAAAAAAGAAAGATGGAGCTGGG - Intergenic
1110204313 13:72894824-72894846 AAGTAAATACAGATGATCCAGGG + Intronic
1110415877 13:75251717-75251739 AAATAAAAACAGAATTAGCTGGG - Intergenic
1110536067 13:76652208-76652230 AAATAAATACAAAATTAGCTGGG - Intergenic
1110976463 13:81842015-81842037 AAGTAAATATAGCTGTAGCTGGG + Intergenic
1111119643 13:83830255-83830277 AAAGAAATACAGATCAAGATTGG + Intergenic
1111308186 13:86444639-86444661 AAATAAAAGCAGATGAAGTTTGG + Intergenic
1111622506 13:90742661-90742683 AAATAAATACCCATGAAGTCTGG + Intergenic
1112697595 13:101968376-101968398 AAAAAAATACAGCTTAGGCTGGG + Intronic
1113594878 13:111524060-111524082 AAGTAGCCACAGATGAAGCTAGG - Intergenic
1113774126 13:112933048-112933070 AAATAAATAAACATGAAGGAAGG + Intronic
1114152833 14:20064143-20064165 AAAAAAAAAAAGGTGAAGCTGGG - Intergenic
1114410376 14:22495100-22495122 TAATAAAGACTGAAGAAGCTTGG - Intergenic
1115904266 14:38189537-38189559 AAATAAATACCCTTGAAGATTGG - Intergenic
1115991671 14:39156431-39156453 AAATAAAATCTAATGAAGCTGGG + Intronic
1116847115 14:49875178-49875200 AAAGAAATACAGGTCCAGCTGGG + Intergenic
1117099178 14:52328381-52328403 AAATATAGACAGATGAATTTTGG - Exonic
1117630951 14:57690884-57690906 CTCTAAATACAGATGAAGCTTGG + Intronic
1117957324 14:61132741-61132763 ACATAAATCCAGGTGAGGCTAGG - Intergenic
1118243038 14:64080244-64080266 AAATGAATACAGTTGTAGTTAGG + Intronic
1118358705 14:65037718-65037740 AAATAAATAAATAAGAGGCTGGG - Intronic
1118754642 14:68831284-68831306 AAAGAAATACAAATCAAGCCTGG - Intergenic
1119575379 14:75716347-75716369 AAATAAACAAACATGAGGCTAGG - Intronic
1120037343 14:79712880-79712902 AAATAAATAGAGCTGAAACTAGG - Intronic
1120105721 14:80491905-80491927 ATATGAACACAGAGGAAGCTGGG - Intronic
1120352356 14:83379059-83379081 AAATATATACAGAGGAAGGTTGG - Intergenic
1120452756 14:84690730-84690752 AAATGAATACAAGTAAAGCTGGG - Intergenic
1120517365 14:85486882-85486904 AAATAAAGACAGATAACTCTAGG - Intergenic
1120988126 14:90351902-90351924 AAATACAAACATATGGAGCTGGG + Intergenic
1120989873 14:90365863-90365885 AAATAAATAAATCTGAAACTGGG - Intergenic
1121068996 14:90999235-90999257 AAACAAACAGACATGAAGCTAGG + Intronic
1121090623 14:91179454-91179476 AAATATATATAGATGAGGCTGGG + Intronic
1121913660 14:97816328-97816350 GAATACATACTGATGAAGTTGGG - Intergenic
1122310011 14:100788535-100788557 AAATAAATACATAAGAAGGTTGG - Intergenic
1123752926 15:23372662-23372684 AAATAAATAAAAAAGTAGCTGGG + Intergenic
1124060840 15:26292471-26292493 AAATAAATCCTTATGAAGATGGG + Intergenic
1124142814 15:27092334-27092356 AAATAAATGCAAATGAGGCAGGG + Intronic
1124963604 15:34416818-34416840 AAATAAATAAAAAAGAAGTTTGG + Intronic
1124980223 15:34563044-34563066 AAATAAATAAAAAAGAAGTTTGG + Intronic
1126080554 15:44957051-44957073 TAATAAATATTGATGAGGCTGGG + Intronic
1126488855 15:49213957-49213979 AAATAAAAAAAGATTTAGCTGGG + Intronic
1126584830 15:50274093-50274115 AATTAAAAACTGAGGAAGCTAGG + Intergenic
1126607378 15:50492152-50492174 AAAAAAATACAGTTCCAGCTGGG - Intronic
1126700358 15:51361208-51361230 AAATAAGTGCAGAAGAAGTTAGG - Intronic
1127063550 15:55213562-55213584 CTGTAAATACAGATGAAACTTGG - Intronic
1127429719 15:58891953-58891975 AACTAAATACACAGGAAGCTAGG + Intronic
1127598592 15:60512266-60512288 AAATAAATAAAAATAAAGATGGG - Intronic
1128106139 15:65046307-65046329 AAATAAATACAAAATTAGCTGGG + Intronic
1128332935 15:66767948-66767970 AAAAAAAAAAAGATGCAGCTTGG - Intronic
1128865123 15:71109078-71109100 AAATAAAGAAAGATGAACTTAGG + Intronic
1128987797 15:72233869-72233891 AAACAAAAAAAGATCAAGCTTGG + Intergenic
1130058841 15:80555014-80555036 AAATAATTACAAATGGATCTGGG + Intronic
1131085052 15:89568895-89568917 AAAAAATTAAAAATGAAGCTGGG - Intergenic
1131170928 15:90177557-90177579 AAATAAATACTGATGTTGGTTGG + Intronic
1131286153 15:91059975-91059997 AAATAAATAGAAAATAAGCTTGG - Intergenic
1131905675 15:97139437-97139459 AAATAAATAAATATGAAACCTGG - Intergenic
1131906670 15:97150170-97150192 ACTGAAATACAGATGAACCTTGG + Intergenic
1131920585 15:97323739-97323761 AAATAAATACATTTGTGGCTAGG - Intergenic
1132029325 15:98427527-98427549 AAAAAACTACAGATGAAAATGGG + Intergenic
1132583612 16:696212-696234 AAATAAATACAAATGCAGTGTGG - Intronic
1133214236 16:4281651-4281673 CTGTAGATACAGATGAAGCTTGG + Intergenic
1133247676 16:4460023-4460045 AAAGAAATACAAAAGAAACTAGG - Intergenic
1133802898 16:9098398-9098420 AAGTAAATACATAAGTAGCTAGG + Intronic
1134259010 16:12635640-12635662 AAAAAAATACACATCCAGCTGGG + Intergenic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1135039877 16:19110096-19110118 AAATAAAGACAGAGGTAGCTGGG + Intergenic
1135534467 16:23282468-23282490 AAATAAGTACAGATAAAGAAAGG + Intronic
1135685127 16:24492781-24492803 AAATAAATAAATATGAGGCCAGG - Intergenic
1136532049 16:30876292-30876314 AAATAACCACGGATGAATCTGGG + Intronic
1136870370 16:33802162-33802184 AAATACACACACATGAACCTTGG + Intergenic
1137032647 16:35538318-35538340 AAAGAAAAACAGATGAGGCTGGG + Intergenic
1137406332 16:48192449-48192471 AAAAAAATAAAAATGAAGCTGGG + Intronic
1137922578 16:52505486-52505508 GAATAATTACAGATGATGCTAGG + Intronic
1138225199 16:55288762-55288784 AAATAAAAACATATGCAGGTCGG + Intergenic
1139417712 16:66827979-66828001 AAACAAAAACAAATGAAGCCAGG - Intronic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1141748911 16:85945374-85945396 AAATAAAGAAAAATAAAGCTGGG - Intergenic
1142400677 16:89856762-89856784 AAATAAAAAATGATGAGGCTGGG + Intronic
1203101802 16_KI270728v1_random:1313888-1313910 AAATACACACACATGAACCTTGG - Intergenic
1142540630 17:656033-656055 AAACGAATGCAGATGAAGCAGGG + Intronic
1142820796 17:2465565-2465587 AAAAAAAGACAGATCAGGCTGGG + Intronic
1143332315 17:6146839-6146861 AAAGAAATGCAAATCAAGCTTGG + Intergenic
1143546827 17:7601928-7601950 AAAAAAAAAGAAATGAAGCTAGG + Intronic
1144692286 17:17275640-17275662 AAATAAATAAAAATAAAGCCAGG + Intronic
1144692337 17:17275955-17275977 AAATAAATAAAAATAAAGCCAGG + Intronic
1144842395 17:18195573-18195595 AAATAAATGCTGGTGAAGCCAGG - Intronic
1144925166 17:18800656-18800678 AGATAAATACAGATACATCTGGG - Intronic
1145876435 17:28321720-28321742 AAAAAAATAAAGCTGACGCTGGG - Intronic
1146227204 17:31077508-31077530 TAAAAAATACAGAAGTAGCTGGG + Intergenic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1146774861 17:35604792-35604814 AAAATATTATAGATGAAGCTGGG + Intronic
1146817077 17:35951014-35951036 ACATATATAAAGATGAAGATAGG + Intergenic
1147371517 17:39996125-39996147 AAAAAAAAAAAGAAGAAGCTGGG + Intronic
1148061129 17:44837195-44837217 AAAAAAAAAAAGATGTAGCTGGG + Intergenic
1149694074 17:58602650-58602672 AAAAGAAATCAGATGAAGCTGGG + Intronic
1149773587 17:59340402-59340424 AAATAAATAAAGTTCCAGCTGGG - Intronic
1150121653 17:62608465-62608487 CCCTGAATACAGATGAAGCTGGG - Intronic
1150195452 17:63293624-63293646 AAATATAAACAGCTGCAGCTAGG - Intronic
1150342480 17:64379726-64379748 AAAAAAATATGGATGAAGCTAGG + Intronic
1150372390 17:64651276-64651298 AAAAATATACACATAAAGCTGGG + Intronic
1150438575 17:65173215-65173237 AAAGAAATAGAGATGAGGCCAGG - Intronic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1150677002 17:67252878-67252900 AAATTAAAACATTTGAAGCTGGG + Intergenic
1150677481 17:67257167-67257189 AAATAAATAAATATTCAGCTGGG + Intergenic
1151038182 17:70825584-70825606 AGATAAATTCAGATTCAGCTAGG - Intergenic
1155355215 18:24945292-24945314 AAATAAAAGCAGTTGGAGCTTGG - Intergenic
1155360630 18:24996949-24996971 AAATGAATACAGGAAAAGCTAGG - Intergenic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1155445693 18:25910976-25910998 CCATAAATACAGATCAAGGTGGG + Intergenic
1155588120 18:27391789-27391811 AAATTATGACAGATGAGGCTGGG + Intergenic
1155592485 18:27443633-27443655 AAATAATTACTGATGCAGCCAGG + Intergenic
1155816882 18:30323362-30323384 AAGTAGCTACAGATGCAGCTAGG - Intergenic
1155889567 18:31249747-31249769 AAAAGAATTCAGATGATGCTGGG + Intergenic
1156648533 18:39197154-39197176 CTATAAGCACAGATGAAGCTTGG + Intergenic
1156815289 18:41303208-41303230 AAATAATTACAGTGGAATCTTGG - Intergenic
1157225694 18:45861878-45861900 AATTAATTACTGATGTAGCTGGG + Intronic
1157963640 18:52183906-52183928 AAATAAATACAAAATTAGCTGGG - Intergenic
1158370404 18:56795727-56795749 AAACAAATACAAATAAAGCTAGG - Intronic
1158918101 18:62157162-62157184 AAGTAAATACACATGGAGCTGGG - Exonic
1159012790 18:63074098-63074120 AAATAAATACAACTAAATCTCGG + Intergenic
1159034702 18:63265423-63265445 AAAGAAATAGAGATGAAACCAGG + Intronic
1159062091 18:63526274-63526296 AAATAAATAAAAAGGAAGCTAGG - Intergenic
1159478140 18:68951172-68951194 AAATAAACACAGATGATGTTAGG + Intronic
1159872011 18:73768926-73768948 TAATAAATACAAATGCAGCATGG - Intergenic
1160221313 18:76979962-76979984 AAAAAAAAACAAAGGAAGCTTGG + Intronic
1161604539 19:5207378-5207400 AAAAAAATAGAAATGAGGCTGGG - Intronic
1161742197 19:6028709-6028731 AAAAAAAAAAAGATGAAACTTGG + Intronic
1161951039 19:7468254-7468276 AAAAAAAAAAAAATGAAGCTGGG + Intronic
1162081962 19:8223456-8223478 AAAAAAATACAAAAGTAGCTGGG + Intronic
1162213912 19:9116317-9116339 AAAAAAAAAAAGATGAGGCTGGG - Intergenic
1162238855 19:9331378-9331400 AAATAATTCCAAAGGAAGCTAGG - Intronic
1162239022 19:9333405-9333427 AAATAATTCCAAAGGAAGCTAGG + Intronic
1162663136 19:12186262-12186284 AAATAAATCAATTTGAAGCTTGG - Intronic
1162702524 19:12528199-12528221 GAATAAATAAATCTGAAGCTGGG + Intronic
1162750167 19:12824656-12824678 AAATAAATAAATAAAAAGCTGGG + Intronic
1163011544 19:14429654-14429676 AAATAAATAAATATCAGGCTGGG + Intergenic
1163229038 19:15987428-15987450 AAATAAAAACTGTTCAAGCTGGG + Intergenic
1163229261 19:15989048-15989070 ATAGAAATAGAGATGCAGCTGGG - Intergenic
1163578835 19:18126059-18126081 AAAAAAAAAAAGATGTAGCTGGG + Intronic
1164501958 19:28827686-28827708 GAATAAATATAGGTGAAGGTGGG - Intergenic
1164979377 19:32602239-32602261 AAATAATTACAAATGGAGCTTGG + Intronic
1165353311 19:35288982-35289004 AATAAAATGCAGATGAGGCTGGG + Intergenic
1166395694 19:42438956-42438978 AAATAAATAAGGAAGAGGCTAGG + Intronic
1167010127 19:46801728-46801750 AAAAAAAAAAAGAAGAAGCTGGG - Intergenic
1167025771 19:46916714-46916736 AAAAAAAAATAGATGAATCTGGG - Intergenic
1167039890 19:47017648-47017670 AAATAAATACAGGCCAGGCTGGG + Intergenic
1167061188 19:47147746-47147768 AAAAAAATACAGTTGAGGCTGGG - Intronic
1167162121 19:47774909-47774931 AAAAAAATAGAGATGGAGCCAGG - Intergenic
1167524535 19:49975418-49975440 AAATAAATAAAAGTCAAGCTGGG + Intergenic
1167646247 19:50706751-50706773 AAATAAATAAAAATAAAGCAAGG - Intronic
1167809843 19:51819769-51819791 AAAGAAATAGGGTTGAAGCTTGG + Intronic
1168298952 19:55392526-55392548 AAAAAAAAAAAGATGAGGCTGGG - Intronic
1168375520 19:55875874-55875896 AAAAAAATACAGAATTAGCTGGG + Intronic
925495330 2:4441980-4442002 AGATAAAGACAGATAAAGCTGGG - Intergenic
925663518 2:6227624-6227646 TAATAAAGATAGATGAAGTTTGG - Intergenic
925758516 2:7159396-7159418 ATATACATACAGATGAAACATGG - Intergenic
925844426 2:8022755-8022777 ACAATCATACAGATGAAGCTCGG - Intergenic
926065319 2:9834674-9834696 AAAGAAATACAAATTTAGCTGGG + Intergenic
926345688 2:11942992-11943014 AAATAAAAAAATAAGAAGCTTGG + Intergenic
926468517 2:13222515-13222537 AAGTAAATACATAGGAAGTTTGG - Intergenic
926882595 2:17563567-17563589 AAAAAAATACAGTTTTAGCTGGG + Intronic
927123841 2:19995098-19995120 AAATAAATAAAAATAAAACTAGG + Intronic
927159852 2:20246735-20246757 AAATAAATACTCATGAATCCAGG - Intergenic
927643854 2:24862579-24862601 AAACAAATAAAAATCAAGCTCGG + Intronic
927753679 2:25691849-25691871 AAAAAAATACAAAAGTAGCTGGG - Intergenic
927909228 2:26884867-26884889 ACACAAGTACAGATCAAGCTTGG - Intronic
928239636 2:29575348-29575370 GAATAAAAACAGATGAAACCTGG - Intronic
928441644 2:31297057-31297079 AAATAAATAAATATGAACCGAGG - Intergenic
928662832 2:33520854-33520876 AAATAAAAAAAACTGAAGCTTGG - Intronic
928813319 2:35255706-35255728 AAATAAAAACAGTAGAAACTGGG + Intergenic
929185029 2:39085034-39085056 AAATAAATACAAATAAAAATAGG - Intronic
929206806 2:39305311-39305333 AAATATATACTGATGATGTTGGG + Intronic
929250912 2:39754034-39754056 AAATACATAAAAGTGAAGCTGGG + Intronic
929354942 2:41011006-41011028 AAATAAAAAAATATGAGGCTCGG - Intergenic
929378512 2:41320669-41320691 AATTAAACATAGCTGAAGCTTGG + Intergenic
929639711 2:43565439-43565461 AAAAAAAAAAAGATGAATCTAGG + Intronic
929641744 2:43587373-43587395 AAATAAATAAAGATGAGGTCAGG - Intronic
929676337 2:43935097-43935119 AAATAATAAAAGATGAAGCAGGG - Intronic
930094886 2:47559383-47559405 AAATAAAAACTGAGCAAGCTGGG - Intronic
931316782 2:61140491-61140513 AAAGAAACAGAGATGTAGCTGGG + Intergenic
931571879 2:63677816-63677838 AAACAAATCCAGATGAAACTTGG + Intronic
932787482 2:74619959-74619981 AAATAAATAAGGATGTATCTGGG - Intronic
933227851 2:79771719-79771741 AAATAAATACAGATGAAGCTTGG + Intronic
933293667 2:80465693-80465715 AAAGAAATAAAGAAGAAGTTAGG - Intronic
933478468 2:82822353-82822375 AAATAATGACAGATGAAGTAGGG + Intergenic
933710633 2:85323251-85323273 AAAAAAATACACATGTGGCTGGG - Intronic
933846471 2:86331081-86331103 AAATAAATGGAGATGAGACTTGG - Intronic
934018551 2:87918075-87918097 AAATAAATGCAAATGAAGTGTGG - Intergenic
934944731 2:98531528-98531550 AAATAAAAACAAATGTACCTAGG + Intronic
935164935 2:100562338-100562360 AAATAAATAAAAATGATGCAGGG - Intergenic
935353265 2:102174119-102174141 CAATAATTAAAGAGGAAGCTGGG - Intronic
935878722 2:107539557-107539579 AAAAAAAAAGAGGTGAAGCTAGG + Intergenic
936822566 2:116541264-116541286 AAAAAACTACACATGAATCTGGG - Intergenic
936854991 2:116946936-116946958 AAAGAAATACAGATAAAGCAAGG - Intergenic
937991750 2:127666357-127666379 CAAGAAAAACAGATGAATCTTGG + Intronic
938042482 2:128087108-128087130 AAATAATTAGAGAATAAGCTAGG + Intergenic
938785083 2:134620708-134620730 AATTCAATACAGAGGAAGCTTGG + Intronic
939223177 2:139329725-139329747 AGATAAATAAAGATGAACCATGG - Intergenic
939306319 2:140416092-140416114 TTGTGAATACAGATGAAGCTTGG - Intronic
939778220 2:146412335-146412357 GAATGAATACAGGTGAAACTGGG + Intergenic
939831944 2:147082706-147082728 AAAGAAATACAGCAGAAACTTGG + Intergenic
940263459 2:151810465-151810487 AAGGAATTACAGATGAAGTTGGG - Intronic
940467204 2:154046162-154046184 AAATAAAAAAAGAAGAAGATGGG + Intronic
940595979 2:155793694-155793716 TATTAAATACAGGTTAAGCTTGG - Intergenic
940723839 2:157312096-157312118 AAAAAAATCCACATGAATCTAGG - Exonic
940978155 2:159970118-159970140 AATTAAATGCAAATGAATCTAGG + Intronic
941025920 2:160456053-160456075 AAAGAAATACAGATCAAACAGGG + Intronic
941051195 2:160735942-160735964 AAATAACTAAAGAGTAAGCTAGG - Intergenic
941145353 2:161837127-161837149 AAATAAATAGAGAAAGAGCTTGG + Intronic
941248961 2:163137691-163137713 AAATGAATAAAGAAGAAGATAGG - Intergenic
941520809 2:166539831-166539853 AATTAACTTCAGATGAAGTTTGG + Intergenic
941717729 2:168781260-168781282 AAACAAATACACATAAAGCAAGG - Intergenic
941754209 2:169167355-169167377 AAATGAGTAGTGATGAAGCTGGG + Intronic
942129004 2:172859163-172859185 ACAAAAATAGAGATGAAACTTGG + Intronic
942153235 2:173099636-173099658 AAATAATTACAGCTGAAGAATGG - Intronic
942382768 2:175409338-175409360 AAATAAATACTGAAGTAGTTAGG - Intergenic
943471375 2:188298263-188298285 AAATAAATACAGAGAAAGTTTGG + Intronic
943584842 2:189726000-189726022 AAATAAATAGAGAATAAGGTAGG + Intronic
943684442 2:190803027-190803049 AAATAAATACAGATACAACATGG - Intergenic
944615928 2:201460129-201460151 AAATAAAGACAGCTGAAGATAGG - Intronic
944823892 2:203460819-203460841 AAATATATAAAGATGAGGCCAGG + Intronic
945991144 2:216396318-216396340 AAAAAAATAAAGATGTAGCTGGG + Intergenic
946033634 2:216724652-216724674 GAATAAATAAAGATGGGGCTGGG - Intergenic
946841855 2:223827541-223827563 AAATAAAAAAAAATGTAGCTGGG - Intronic
947764135 2:232625025-232625047 AAATAAATAAAAATCTAGCTTGG - Intronic
947956651 2:234197786-234197808 AAAGAAATACAATGGAAGCTCGG + Intergenic
948032426 2:234829856-234829878 ACAAAATTACAGAAGAAGCTTGG - Intergenic
948327158 2:237133798-237133820 AAAAAAAAAAAGAGGAAGCTAGG - Intergenic
948337407 2:237221346-237221368 ATATAAGTACAGGTGAAGATAGG - Intergenic
1168743098 20:211693-211715 AAAGAAATAAAGCTGAGGCTAGG + Intergenic
1169370242 20:5023341-5023363 AAATAAATAAAGATAAAGCCTGG - Intergenic
1169457930 20:5768673-5768695 AAATATAGATAGATAAAGCTAGG - Intronic
1169495348 20:6109738-6109760 AAAAAAATACAAATTTAGCTGGG + Intronic
1170032084 20:11954598-11954620 AAACCAAGACAGATGAAGCTAGG + Intergenic
1170326977 20:15167311-15167333 TCACAAATACAGATAAAGCTAGG - Intronic
1172065040 20:32213475-32213497 AAAAATATAAAGATGAGGCTGGG + Intronic
1172088537 20:32409266-32409288 AAATAAAAATAGCTGAGGCTGGG - Intronic
1172257000 20:33527837-33527859 AAATATATACAAATCAGGCTGGG - Intronic
1172616284 20:36287386-36287408 AAATGAATACAGGTAAAACTGGG - Intergenic
1172721516 20:37002323-37002345 AAAAAAAAACAGATAAGGCTAGG - Intronic
1172965742 20:38833400-38833422 AAATAAGTACATGTGAAACTAGG + Intronic
1172998167 20:39086083-39086105 AAATAAATAAAGATGAAAAAGGG - Intergenic
1173126403 20:40340018-40340040 AAATAATGACAGATGAACTTTGG - Intergenic
1173319676 20:41976124-41976146 AAAAAAAAACAGATGATGTTAGG - Intergenic
1173447339 20:43130961-43130983 ATCTAAATACAAATGAAGCCAGG + Intronic
1173846530 20:46192096-46192118 AAATAAAAACAGAGGGTGCTGGG - Intronic
1174300027 20:49575019-49575041 AAAGAAAGAGAGATGAAGCAAGG + Intergenic
1174537694 20:51265251-51265273 AACTAAGTACAGAAGAAGCCAGG + Intergenic
1174669076 20:52289079-52289101 AAATACACAGAGATGTAGCTTGG - Intergenic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1174849872 20:53983359-53983381 AAATGAATACAAATGAAGTAAGG - Intronic
1174929448 20:54796715-54796737 AAATAAATTTAAATGAGGCTGGG + Intergenic
1175112077 20:56655489-56655511 AAAAAGATACATATGTAGCTGGG + Intergenic
1175462040 20:59159143-59159165 AAATAAATACAGATGACTTGTGG + Intergenic
1175796027 20:61771326-61771348 AAAAAAATGCAGTTGAGGCTGGG + Intronic
1176066084 20:63196548-63196570 AAATAAATGCAGATCCATCTGGG + Exonic
1176202341 20:63867247-63867269 AAAAAAAGACAAATGAGGCTGGG - Intronic
1176701160 21:10052163-10052185 AAAGAAATACAGAGCAATCTAGG - Intergenic
1176977272 21:15335947-15335969 AAAGAAATACAAATGAAGTTAGG + Intergenic
1176989702 21:15480531-15480553 AAATTAATACAAAAGTAGCTGGG - Intergenic
1177188274 21:17821418-17821440 AAATAAAGAGAGAGCAAGCTTGG - Intergenic
1177447151 21:21212561-21212583 AAATGAATACAGGTAAACCTGGG + Intronic
1177507130 21:22033761-22033783 ATATAATAACAGATGAAACTTGG - Intergenic
1177707854 21:24732386-24732408 AAATAAATACAGTTGCAGAAAGG - Intergenic
1177852316 21:26363334-26363356 AAGTAAATACAGATGAAAACAGG + Intergenic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1178702150 21:34842771-34842793 AAAAACATACAGATGCAGCTGGG + Intronic
1178738032 21:35170521-35170543 AAACAAATACAACTCAAGCTTGG + Intronic
1178862674 21:36302351-36302373 CAATATGTACATATGAAGCTAGG + Intergenic
1178986405 21:37307423-37307445 TAAAAAAGACAGAGGAAGCTAGG + Intergenic
1180242836 21:46523219-46523241 AAATAAATAAATAAGAAGCTAGG - Intronic
1180681425 22:17629509-17629531 AAATAAAAACAAATGAGCCTGGG - Intronic
1180781006 22:18519559-18519581 AAATAAAAACATAAAAAGCTGGG - Intergenic
1180823898 22:18850223-18850245 AAAGAAAAACATATGATGCTGGG + Intronic
1181828550 22:25539853-25539875 AAATAAATACAGAATAAAATAGG - Intergenic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
1182363682 22:29763626-29763648 AAATAAATAAAAATTAGGCTGGG + Intronic
1183932414 22:41243304-41243326 AAATTAAAATAGATGAAGCCGGG - Intergenic
1184530875 22:45054865-45054887 AAAAAAAAACAGAGGAAGCCGGG + Intergenic
1203216586 22_KI270731v1_random:9262-9284 AAAGAAAAACATATGATGCTGGG - Intergenic
949240109 3:1860948-1860970 ATATAATCACAGATGAACCTCGG - Intergenic
949393032 3:3584024-3584046 AAATAATTACAGGTGATGCATGG + Intergenic
950645671 3:14375160-14375182 GAATAAAAACAGACAAAGCTGGG + Intergenic
951891589 3:27572752-27572774 AAATAGATACAGCTGGATCTAGG - Intergenic
952124596 3:30285764-30285786 AAGTAAATAAATATGAAACTAGG - Intergenic
952941607 3:38449414-38449436 AAATAAATAAAAATAAGGCTGGG - Intergenic
953316784 3:41935385-41935407 AAAAAAATACAAATTTAGCTGGG - Intronic
954032333 3:47828474-47828496 AAAAAAAAAAAGATGAGGCTGGG + Intronic
954977354 3:54709000-54709022 AAAAAAAAAAAGATGAAGATGGG - Intronic
955263249 3:57416076-57416098 AAATAAAAATAGATCAAGCATGG - Intronic
955301109 3:57780438-57780460 AAATTAATAGTGTTGAAGCTGGG - Intronic
955621386 3:60868082-60868104 AAATAAAAACATAAGAAGGTTGG + Intronic
956038351 3:65119869-65119891 AAATAAAAACAGATTGAGTTGGG + Intergenic
956197743 3:66670099-66670121 AAAGAGAGACAGAAGAAGCTGGG - Intergenic
956291714 3:67667583-67667605 AAAAAAAAAAAGATGAAGATGGG + Intergenic
956613495 3:71147772-71147794 AAATAAATGCCGATAAGGCTAGG - Intronic
956800692 3:72755354-72755376 AATAAAATAGAAATGAAGCTTGG - Intronic
957213179 3:77287485-77287507 AAATAAATTCAGAAGTATCTGGG - Intronic
957383554 3:79466889-79466911 GAATATATCCAGAGGAAGCTTGG + Intronic
957416250 3:79909297-79909319 AAAAAGACACAGATGTAGCTAGG + Intergenic
957444190 3:80293537-80293559 AAAAACTTACAGATGATGCTTGG + Intergenic
957540822 3:81566754-81566776 AAATGAATACAGGTGAAGGTTGG - Intronic
957656095 3:83077801-83077823 AAATAAAAACACATTAAGCAAGG + Intergenic
958265067 3:91428862-91428884 AAATAAAAATAAATGAAACTTGG + Intergenic
958569350 3:95860175-95860197 AAAAAAATACATATGAGGCTGGG - Intergenic
959563812 3:107814148-107814170 AATGCAGTACAGATGAAGCTGGG + Intergenic
960296252 3:115948256-115948278 AAATAAATAGAGAAGAAGGGAGG - Intronic
960831534 3:121854509-121854531 TAAAAAAGACAGATGAAGATAGG - Intronic
962036510 3:131657517-131657539 AAAAAAATACAGATAATTCTAGG - Intronic
962333243 3:134499809-134499831 AAAAAAAAAAAGATGAAGATGGG - Intronic
963217260 3:142762329-142762351 AAAAAAATACAGAAGAGGCCAGG - Intronic
963470240 3:145731408-145731430 AAATAAATACAAATAAAACTTGG + Intergenic
963560785 3:146862413-146862435 AAATAAATAAATATTAAGCTTGG - Intergenic
963573763 3:147032760-147032782 ATATAAATGGAGATGAATCTTGG - Intergenic
963838834 3:150083965-150083987 AAATATATACATATGTCGCTTGG + Intergenic
963848496 3:150183502-150183524 AAATGGATCCAGATGGAGCTTGG + Intergenic
964221413 3:154350743-154350765 AAATAAATACAGTTGATCTTTGG + Intronic
964320395 3:155490237-155490259 AAATAAAAAGACATGAGGCTTGG + Intronic
964575697 3:158165183-158165205 AGATAATTAGAAATGAAGCTTGG + Intronic
965695217 3:171401116-171401138 AAACAAAAAAAGAAGAAGCTGGG + Intronic
965766641 3:172137354-172137376 AAATTAATACAGAAGAATATGGG + Intronic
966181411 3:177192100-177192122 AAAAAAAAAGAGTTGAAGCTGGG + Intronic
966549914 3:181193543-181193565 ATAAAAATACAGTTGAAGCTTGG + Intergenic
967890581 3:194361610-194361632 AAATAAATAGGGCTGAACCTGGG + Intronic
968072373 3:195793339-195793361 AAAAAAATACAGAAATAGCTGGG + Intronic
968279886 3:197468439-197468461 AAGAAAATAAAGATGCAGCTGGG + Intergenic
969097686 4:4746223-4746245 AATTAAATACAGATGAAAGGAGG + Intergenic
969335657 4:6508282-6508304 CAATAGAAACAGCTGAAGCTGGG + Intronic
969428956 4:7142010-7142032 AAATAAATAAATAAAAAGCTGGG - Intergenic
969443005 4:7228299-7228321 AAATAAATACAGACGCATCCTGG + Intronic
970180928 4:13392470-13392492 AGGTAAATACAGAAGAAACTTGG + Intronic
970599988 4:17634192-17634214 AAATAAATGCATTTGAGGCTAGG - Intronic
970718969 4:18962860-18962882 AAATAAATACAAATAAATTTAGG - Intergenic
970811350 4:20098224-20098246 AGAAAAATATAGATAAAGCTAGG - Intergenic
971228103 4:24773842-24773864 TAAAAAATACAGATACAGCTGGG + Intergenic
971471274 4:27029309-27029331 AAAGAAATACAAAAGAAGCCGGG - Intergenic
971837391 4:31786161-31786183 CTGTAAATACAGATAAAGCTTGG - Intergenic
972098858 4:35385973-35385995 AAATAAATGCTGATTAAACTGGG - Intergenic
972172581 4:36364747-36364769 AAATAAATTCAGATGAACATAGG + Intergenic
972248207 4:37268888-37268910 AAATAATTTCAGATGCCGCTGGG - Intronic
972467814 4:39374144-39374166 AAATAAACACAGATTAAAGTAGG - Intergenic
972504037 4:39704527-39704549 AAATAAAAAGGGAAGAAGCTAGG - Intronic
972601282 4:40575258-40575280 AAAGAAATACCAAGGAAGCTGGG + Intronic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
974422800 4:61699445-61699467 AAATAAAATAAGATGAAGTTAGG + Intronic
974671840 4:65041139-65041161 AATTACTTACTGATGAAGCTAGG - Intergenic
975089783 4:70388406-70388428 AAATAAAAATAGCTGAGGCTGGG - Intronic
975111723 4:70635742-70635764 AACTAAATACAATTGAAACTTGG - Intronic
975160964 4:71122916-71122938 AAATAAATCCAGAGGAATCAGGG + Intergenic
975437838 4:74374547-74374569 ATATAAATAAAAATGAAGCAAGG + Intronic
975438912 4:74387253-74387275 TAATAAATACAGTTGTACCTTGG - Exonic
975761664 4:77626038-77626060 AAATAAAATCAAAAGAAGCTTGG - Intergenic
975930528 4:79516856-79516878 AGATAAATATAGATGTAGATGGG - Intergenic
976086519 4:81412336-81412358 AAATCAAACCAGATAAAGCTTGG - Intergenic
976230678 4:82839579-82839601 AAATAATTATAAATGAGGCTGGG - Intronic
976283552 4:83348577-83348599 AAAAAAATTATGATGAAGCTTGG + Intergenic
976308332 4:83583685-83583707 AAAAAAAAAAAAATGAAGCTGGG + Intronic
976398845 4:84585201-84585223 AAATAAATAAATATGCAGCGAGG - Intronic
976553457 4:86423240-86423262 AAAAAAATTCAGGTGAAACTAGG + Intronic
976569066 4:86587854-86587876 AAAAAATTATGGATGAAGCTGGG + Intronic
977693636 4:99944870-99944892 AAAAAAATACTGATTAGGCTGGG - Intronic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
978263737 4:106795838-106795860 ACATGAATACTGATAAAGCTTGG + Intergenic
978345719 4:107766568-107766590 AAATCAGTAAAGAAGAAGCTAGG + Intergenic
978358650 4:107904941-107904963 AAAAAATTACAGAAGAAGATGGG + Intronic
978533854 4:109740385-109740407 AAAGAAATAAAGAGGAAGCAGGG + Intergenic
978648633 4:110972838-110972860 AAAGAAAGACAGATGAGGCAGGG - Intergenic
979083950 4:116381479-116381501 AAATAAATTCAAATGACTCTTGG - Intergenic
979651182 4:123133528-123133550 AAATATATATAAATAAAGCTAGG - Intronic
979893173 4:126126136-126126158 AAACACTTAGAGATGAAGCTGGG + Intergenic
980011869 4:127604929-127604951 AAAGAAATAAAGAAGGAGCTAGG + Intergenic
980373310 4:131908491-131908513 AAAGAAATACAGAGCAATCTAGG - Intergenic
980842031 4:138275334-138275356 ATTGATATACAGATGAAGCTTGG - Intergenic
980895877 4:138859721-138859743 AAATTAACACAAATGGAGCTGGG - Intergenic
981182651 4:141763963-141763985 CTGTAAATACACATGAAGCTGGG + Intergenic
981478955 4:145216454-145216476 AAATAAATACAATTAAAACTAGG - Intergenic
981520584 4:145657833-145657855 ATATAAATGCTGATGAAGTTTGG + Exonic
981612594 4:146611106-146611128 AAATACATACAGAAGAAAGTGGG - Intergenic
981706236 4:147662205-147662227 AACTAAACACAAAAGAAGCTAGG + Intronic
981761057 4:148195412-148195434 GAATAAATACTAATAAAGCTAGG - Intronic
981931194 4:150190963-150190985 AAATAAATTAAGATTTAGCTAGG + Intronic
981980094 4:150781474-150781496 CTATAAATACAGATGAAGCTTGG + Intronic
982465358 4:155723613-155723635 AAATAAATGCAGAAGAAGAAGGG - Intronic
982940160 4:161540490-161540512 AAATAAATCAAGGTGAAACTAGG - Intronic
983153417 4:164313949-164313971 AAAGAGATGCAGCTGAAGCTGGG - Intronic
983183371 4:164674703-164674725 CAATAAATAGAGATGAATCCTGG - Intergenic
983196120 4:164808331-164808353 AAATATATAGAGATAGAGCTGGG + Intergenic
984544391 4:181083263-181083285 ATATAAATATAGATGTAGGTAGG + Intergenic
984587956 4:181584404-181584426 TAAGGAATACAGAAGAAGCTTGG - Intergenic
986185240 5:5429603-5429625 AAATAAATACAGATGATAATGGG - Intronic
986504677 5:8436924-8436946 AAATAAAGACAAATGGAGATTGG - Intergenic
986828845 5:11552061-11552083 AAATAAAGACAGAGGCAGCAGGG - Intronic
986971233 5:13339434-13339456 AAAAAAAAACAGATAAGGCTGGG - Intergenic
987306070 5:16639066-16639088 AGATAAATAAAGATGAAAATTGG - Intergenic
987998000 5:25310660-25310682 AGTTATATACAGATAAAGCTAGG - Intergenic
989153354 5:38321345-38321367 CTGTAAATACAGACGAAGCTTGG + Intronic
989745394 5:44822843-44822865 AAATAGATGCACAGGAAGCTGGG + Intergenic
990247019 5:53873313-53873335 AAATAAAAACAGATGAGGCTGGG - Intergenic
991273648 5:64816997-64817019 AAATAGATTCAGATGCAGATAGG - Intronic
992023915 5:72652328-72652350 AAACAAATACAGATAATCCTAGG - Intergenic
992909784 5:81384743-81384765 AAACATTTACAGATGATGCTTGG + Intronic
992919804 5:81503157-81503179 AAAAAACAACAGATGCAGCTGGG + Intronic
994342621 5:98649414-98649436 AGATAATTCCAGATGAAGGTAGG + Intergenic
994359424 5:98833107-98833129 AAATAAATACAAATTAATATTGG + Intergenic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
994862092 5:105209834-105209856 AAAAAAACACAGCTGAAGCATGG - Intergenic
995539932 5:113175566-113175588 AGATAAATAGATATGATGCTAGG + Intronic
995941794 5:117594714-117594736 AAATAAAAATAGATTAAGCCAGG + Intergenic
996227005 5:121011847-121011869 TAATAAATACAAATTAAGCGGGG - Intergenic
996664443 5:126042501-126042523 AAATAAAAACAAATGCTGCTTGG + Intergenic
997007421 5:129834495-129834517 AGAAAAATACAAATTAAGCTTGG - Intergenic
997832888 5:137166646-137166668 AAATAAAAACAAAAAAAGCTGGG + Intronic
998073872 5:139220298-139220320 AAATAAATAAATAAAAAGCTGGG - Intronic
999162082 5:149509834-149509856 AAAAAAATATAAATGAAGCCAGG - Intronic
999545004 5:152618182-152618204 AAACATATACAGATGGAGGTGGG - Intergenic
999857562 5:155611529-155611551 AAATAAATGCACATTTAGCTGGG + Intergenic
1000172844 5:158720415-158720437 GAATAAACACAAAGGAAGCTGGG - Intronic
1000531537 5:162427937-162427959 AAATAAATACATATATAGATGGG - Intergenic
1001368932 5:171176294-171176316 AAAGAAAGACAAATGGAGCTGGG - Intronic
1001446630 5:171790311-171790333 AACCAAATCCACATGAAGCTTGG + Intronic
1001635878 5:173210048-173210070 AAATAAATAGAGTTGGGGCTGGG + Intergenic
1002117643 5:176976323-176976345 AAATAAATAAAAATAAAACTGGG + Intronic
1002291975 5:178206168-178206190 ATGAAAATACAGATTAAGCTGGG + Intronic
1002630811 5:180575740-180575762 AAATGAATGCAGAGGGAGCTTGG + Exonic
1002646043 5:180655521-180655543 TAAGAAATACAGACGAGGCTGGG - Intergenic
1002916485 6:1532274-1532296 AAATAAATACAGTTCATCCTCGG - Intergenic
1002951549 6:1817692-1817714 CAATAGCTCCAGATGAAGCTGGG + Intronic
1004303210 6:14476931-14476953 AAGAAAATACAGCTGGAGCTGGG + Intergenic
1004353868 6:14914870-14914892 AAATAAATATTGGTGAAGATGGG + Intergenic
1004728517 6:18334506-18334528 AAATAAATAAATAAAAAGCTGGG + Intergenic
1004765269 6:18719816-18719838 AAATCAATAAAGAGGAAGATTGG - Intergenic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1005260074 6:24049698-24049720 AAAGTTATACAGATGAAGGTGGG + Intergenic
1005390747 6:25330698-25330720 AAAAAAAGACAGATGAGGATGGG + Intronic
1005582559 6:27248526-27248548 AAATAAATGCAGATGGATTTAGG - Intronic
1005702732 6:28418825-28418847 AAAAAAAAAAAGATGCAGCTAGG + Intergenic
1005797634 6:29383633-29383655 AAATGAATACAAATAAAACTGGG + Intronic
1005977970 6:30814780-30814802 AAATAAACACCTATGAAGTTAGG + Intergenic
1006873555 6:37275765-37275787 AAATAAATACATATAAATATTGG - Intronic
1007202331 6:40120492-40120514 CAATAAATACAGAAGCAGCATGG + Intergenic
1007714324 6:43845751-43845773 AAATAAAAACAGATGAAAGCTGG + Intergenic
1008148238 6:47918368-47918390 AAAAAAATCCAGATCAACCTGGG + Intronic
1008313984 6:50016137-50016159 AAATAAATACTGATATAGGTTGG + Intronic
1008342215 6:50381088-50381110 AAATAAATACAGTTTATGTTGGG - Intergenic
1008499419 6:52165837-52165859 AAATCAATCTAAATGAAGCTGGG - Intergenic
1008501697 6:52189897-52189919 AAATTAATACATATGAAAGTAGG - Exonic
1008512619 6:52291048-52291070 AAATAAAAGGAAATGAAGCTGGG + Intergenic
1008607002 6:53150283-53150305 AAAAAAAAAAAGATGAAGCAGGG - Intergenic
1008657035 6:53626037-53626059 TAAAAAATATAGATAAAGCTGGG + Intergenic
1008990317 6:57593790-57593812 AAATAAAAATAAATGAAACTTGG - Intronic
1009178891 6:60492337-60492359 AAATAAAAATAAATGAAACTTGG - Intergenic
1009640571 6:66330625-66330647 CAAAAAATTCAGTTGAAGCTGGG - Intergenic
1009694140 6:67076052-67076074 GAATAAATAGAAATTAAGCTAGG + Intergenic
1009797616 6:68492060-68492082 AAATACATACAGATATAGCCGGG - Intergenic
1010656810 6:78521142-78521164 AAATATATATATATGTAGCTTGG - Intergenic
1011616448 6:89202131-89202153 AAATAAATACAAATGACCCCAGG - Intronic
1011798866 6:90987731-90987753 AAATGAATACAAATGAAATTAGG + Intergenic
1012068437 6:94579265-94579287 AAATAAACAAACATGAGGCTGGG - Intergenic
1012199053 6:96382721-96382743 AAATAACTAGATATGAGGCTTGG + Intergenic
1012343731 6:98160068-98160090 AAAAAAATACACATAAAGTTTGG + Intergenic
1013074592 6:106759940-106759962 AAATAAGTACAGAGAAAACTGGG + Intergenic
1013140216 6:107326471-107326493 AAATAAATACAGAAAATGTTCGG + Intronic
1013348806 6:109287885-109287907 AAAGAAATTCAGCTCAAGCTGGG + Intergenic
1013638807 6:112053677-112053699 GAAAAAATACAGATGGAGCAGGG - Intergenic
1014041765 6:116835418-116835440 AAATACATACAGTTGACCCTTGG - Intergenic
1014960687 6:127680347-127680369 AAAAAAATACAGAACAACCTAGG - Intergenic
1015067171 6:129044437-129044459 AAATAAAAACAGTGGAAGTTAGG + Intronic
1015140983 6:129931410-129931432 AAATTAATACAGATAAAATTTGG + Intergenic
1015458143 6:133453368-133453390 TAATAATTATAGATAAAGCTTGG - Intronic
1015486972 6:133783008-133783030 AAATAACTACAAATGAAACGTGG - Intergenic
1016541052 6:145165064-145165086 AAATAAATACACATGTAATTTGG + Intergenic
1016943933 6:149510441-149510463 AAATAAATAAAAATGAAACAGGG + Intronic
1017593642 6:156005204-156005226 AAATAAATCCATATGATGATGGG + Intergenic
1018112913 6:160553492-160553514 AAATAAAAACAGATCAACCTAGG - Intronic
1018863615 6:167731148-167731170 AGATAAATGCAGCTGAAGCTAGG + Intergenic
1019489414 7:1304819-1304841 AAATAAATTCAGACCAGGCTCGG - Intergenic
1019518041 7:1448193-1448215 AAATCAGGACAGATGAAGGTAGG + Intronic
1019696446 7:2448903-2448925 AAATAAATAGAAATGAGCCTAGG - Intergenic
1020049169 7:5070661-5070683 AAATAAATAGAGATGGGGCCTGG - Intronic
1020117813 7:5486091-5486113 AAATAAATAAAAATTTAGCTGGG + Intronic
1020263434 7:6544653-6544675 AAATAAATAAATAACAAGCTGGG + Intronic
1020567859 7:9820623-9820645 AAATCAATCCTGATGGAGCTGGG + Intergenic
1020586165 7:10071093-10071115 AAATAAACACTTAGGAAGCTAGG + Intergenic
1021333885 7:19374646-19374668 AAGTAAATGCAGATGATGTTTGG - Intergenic
1022049900 7:26656336-26656358 AGAAAAATACAAATAAAGCTTGG - Intergenic
1022344830 7:29504357-29504379 AAATTAATAAAGATGATGCTAGG + Intronic
1022475798 7:30708727-30708749 AAAAAAAAAAAGAAGAAGCTGGG - Intronic
1023210727 7:37801937-37801959 AAATCAACACAGTTGAAGATAGG - Intronic
1023597202 7:41843541-41843563 AAATAGAAACAAAGGAAGCTGGG - Intergenic
1024023084 7:45388452-45388474 AAGTAAATACAGACCAGGCTGGG - Intergenic
1024424545 7:49210872-49210894 AAATAAAGACAAAAGCAGCTGGG + Intergenic
1025794158 7:64722512-64722534 AAAAAAAAAAAGAAGAAGCTAGG - Intergenic
1026265189 7:68790293-68790315 ATATGAATACAGCTGAACCTGGG - Intergenic
1026316025 7:69228396-69228418 CTGCAAATACAGATGAAGCTTGG + Intergenic
1026718430 7:72810010-72810032 AAAAAAACACAGAAGAGGCTGGG + Intronic
1026974039 7:74485624-74485646 AAAAAAAAATAGATGCAGCTGGG + Intronic
1027353447 7:77334596-77334618 AAAAAAAAAAAGATGAACCTGGG + Intronic
1027446655 7:78281243-78281265 AAATACATACTGATGTGGCTTGG + Intronic
1027508513 7:79049560-79049582 AAATAGATACAGATGTATGTTGG - Intronic
1027616143 7:80426984-80427006 AAATAAATCAAGATCAATCTAGG + Intronic
1027999277 7:85470430-85470452 ATAGAAACACTGATGAAGCTAGG + Intergenic
1028058910 7:86284704-86284726 AAATAAATAGGGATGACACTTGG + Intergenic
1028976046 7:96915417-96915439 AAGTAAATAAAAATAAAGCTCGG + Intergenic
1029624692 7:101713324-101713346 AAATATATATATATGAGGCTGGG - Intergenic
1029787551 7:102807761-102807783 AAAAAAATACAGAGTAGGCTGGG + Intronic
1029976665 7:104841354-104841376 AAATAAATCGAGGTGAAGATGGG - Intronic
1030010683 7:105163648-105163670 AAATAAATACAAAATTAGCTGGG + Intronic
1030019834 7:105262497-105262519 AAATATATAAAGAAGATGCTTGG - Intronic
1030061704 7:105627220-105627242 AAATAAATACAGAAAAAGAAAGG - Intronic
1030129414 7:106185198-106185220 AAAAAAATACAAAAAAAGCTGGG - Intergenic
1031180795 7:118412503-118412525 AAATAAATAAAGATGTAGACGGG - Intergenic
1031189386 7:118527931-118527953 AAATAAATTCAAATGACTCTTGG + Intergenic
1031240579 7:119233300-119233322 AAATTAATACATATGAAGAAAGG + Intergenic
1031854284 7:126903382-126903404 AAATGAATATATATGATGCTGGG - Intronic
1032559413 7:132873101-132873123 AAATAAATAAAAATGAAGAGGGG + Intronic
1033087691 7:138357447-138357469 AAATCAAGACAAATGAAGGTGGG + Intergenic
1033785096 7:144720579-144720601 AAATCAAAACAGAGGAAGCCTGG + Intronic
1034211814 7:149370338-149370360 AAAAAAATACAGATGAGGCCAGG - Intergenic
1034926746 7:155128932-155128954 AATAAAATAAACATGAAGCTGGG + Intergenic
1035274094 7:157737097-157737119 AAATAAATACAGCTGCAACCAGG - Intronic
1036820940 8:11938911-11938933 AAGGAAATATAGAAGAAGCTAGG + Intergenic
1037269353 8:17109142-17109164 AAATAAAAACAGATTAAGGTAGG - Intronic
1038126381 8:24677881-24677903 CAATAAATAGAGAAGAGGCTGGG + Intergenic
1038529652 8:28307955-28307977 AAATAAATACAGACGTGGATTGG - Intergenic
1038657330 8:29465761-29465783 CTGTAAATATAGATGAAGCTTGG - Intergenic
1038719523 8:30021459-30021481 AAAGAAACACAGAGGAGGCTGGG + Intergenic
1038792749 8:30683119-30683141 AAAAAAATAAAGATTCAGCTGGG - Intronic
1038863630 8:31414846-31414868 CTGTAAATACAGATGATGCTTGG + Intergenic
1038963134 8:32544464-32544486 AAATAAATAAATAATAAGCTAGG - Intronic
1039155402 8:34550373-34550395 AACTTAATACAGATGAATCATGG - Intergenic
1039858117 8:41433958-41433980 AAATAAATAGAGATATAGTTAGG - Intergenic
1041236673 8:55809804-55809826 AAAGAAATACAGATGAAAATAGG + Intronic
1041326999 8:56678479-56678501 ACAGAAATACAGAAGAAGCAGGG - Intergenic
1041352709 8:56964855-56964877 AAACAAATGCAGAAGAAACTGGG + Intronic
1041735331 8:61105123-61105145 AAATTAAAACAGATGTGGCTGGG - Intronic
1043187954 8:77178922-77178944 AAATAAATACACATGAATGATGG - Intergenic
1043648153 8:82549106-82549128 AAATAATTCCAGGTGAGGCTGGG - Intergenic
1043888092 8:85625523-85625545 AAATAAATACATAAAAGGCTTGG + Intergenic
1044131965 8:88534514-88534536 AAATAAATCAAGATGAAATTAGG - Intergenic
1044682675 8:94798357-94798379 AAATAAATACAAACGGAGCGAGG + Intergenic
1045590846 8:103594966-103594988 AAAAAAATGCAGATGAACATTGG - Intronic
1045695264 8:104802211-104802233 AAAATAAGACAGAGGAAGCTTGG + Intronic
1045864057 8:106844765-106844787 AAAAAAATACAAAATAAGCTGGG + Intergenic
1045953390 8:107877948-107877970 AAAAAAATATAGTTGATGCTGGG + Intergenic
1047066086 8:121284641-121284663 AAATAAATAAAGAAGAAGAAAGG + Intergenic
1047158045 8:122343935-122343957 AAATAGAGAGAGATGAAGATGGG + Intergenic
1047520929 8:125594840-125594862 AAATAAATAAAAATAAAGCCAGG - Intergenic
1047554166 8:125910832-125910854 AAAAAAATGTATATGAAGCTGGG + Intergenic
1047904964 8:129463104-129463126 AAAGACATACAGATGAAGAAAGG + Intergenic
1048171086 8:132107103-132107125 AAATAGATACAGAAGAAGAAGGG - Intronic
1049379210 8:142303614-142303636 AAATACAGACAGATGAACCCCGG + Intronic
1050118254 9:2282491-2282513 ACATAAAGACAGAAGAATCTGGG - Intergenic
1050245749 9:3688361-3688383 AAATAAATAAAAATAAAGATGGG - Intergenic
1050398721 9:5228567-5228589 AAATAAATACGGAGTAAGTTAGG + Intergenic
1050536906 9:6638508-6638530 AAAGAAGCAAAGATGAAGCTGGG - Intronic
1050609404 9:7336066-7336088 AAAGATATCCAGATGAGGCTTGG + Intergenic
1050713242 9:8489914-8489936 AAATAAAGACGGATGCAGCAGGG + Intronic
1050842065 9:10162755-10162777 ATATAAATATATATGGAGCTGGG + Intronic
1051423635 9:16913466-16913488 AAATAAATAAAGACTAAGCCAGG - Intergenic
1052276805 9:26685905-26685927 AAATAAGGACAGATCAAGCTGGG + Intergenic
1053310144 9:37012952-37012974 AAAAATATATAGATTAAGCTAGG + Intronic
1053638303 9:40038662-40038684 AAAGAAATACAGAGAAATCTAGG - Intergenic
1054319096 9:63635261-63635283 AAAGAAATACAGAGCAATCTAGG - Intergenic
1054546447 9:66338062-66338084 AAAGAAATACAGAGAAATCTAGG + Intergenic
1054959615 9:70953415-70953437 AAATAAATACAGTTAAAGTAAGG + Intronic
1054999021 9:71427340-71427362 AAATAAATACAGCTGAAGTGTGG - Intronic
1055044069 9:71907257-71907279 AAATAAACATAGATAAATCTTGG + Intronic
1055548375 9:77406710-77406732 AAAAAAAAAAAGATGAGGCTGGG - Intronic
1056175160 9:84027530-84027552 AAATAAATAAAAATTTAGCTGGG + Intergenic
1056265301 9:84890789-84890811 AAAGAAATACACCTGAATCTGGG + Intronic
1056376016 9:86011653-86011675 AATTAAATAAAAATGAAGCCGGG - Intronic
1056579337 9:87879220-87879242 AAATAATAAAAGCTGAAGCTTGG - Intergenic
1057418865 9:94891826-94891848 AAATAATAACAGAAGAAGGTTGG - Intronic
1057614169 9:96573320-96573342 AAAAAAATACAGATGAGAATCGG + Intronic
1057834293 9:98431854-98431876 AAATAAATACAAAATTAGCTGGG - Intronic
1058803985 9:108572207-108572229 AAATAAATACAAATGTATATTGG + Intergenic
1059926693 9:119216871-119216893 AACTGAAAACAGATGAAGTTTGG + Intronic
1060284023 9:122233049-122233071 AAGTAAATAAATGTGAAGCTGGG - Intergenic
1060519432 9:124285952-124285974 AAATAAATACAGATAAACTGAGG + Intronic
1060847411 9:126848381-126848403 AAGTAAAGACAGATGATGCTGGG - Intergenic
1061883822 9:133581359-133581381 AAAAAAATAAAAATGAGGCTTGG - Intronic
1202786176 9_KI270719v1_random:22218-22240 AAAGAAATACAGAGCAATCTAGG - Intergenic
1186162281 X:6790127-6790149 AGATATATACAGATGTAGATAGG + Intergenic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1186323014 X:8451194-8451216 AAATAACTACAGAAGGAGTTTGG + Intergenic
1186337963 X:8611845-8611867 AAATGATAACAGATGAACCTTGG + Intronic
1186571649 X:10721214-10721236 AAATAAAGAAAAATGAAGTTGGG + Intronic
1186973653 X:14876036-14876058 AAATATATACATAAGAAGATTGG + Intronic
1187073612 X:15912691-15912713 AAATAAATACAGATAAACATGGG + Intergenic
1187315643 X:18191794-18191816 AAATAAATACAAGTAAAACTGGG + Intronic
1187410135 X:19044094-19044116 AAATCAATGCTGATGATGCTAGG + Intronic
1187666499 X:21616845-21616867 AAACTAATTAAGATGAAGCTAGG - Intronic
1187865724 X:23721386-23721408 AAAAAAATAGAGATGGGGCTGGG - Intronic
1187976966 X:24712379-24712401 AAAGAAATGCATATGAGGCTGGG - Intronic
1188059273 X:25580851-25580873 AAATAAATTCATATAAATCTTGG - Intergenic
1188063329 X:25627671-25627693 AAACTAATACATTTGAAGCTTGG + Intergenic
1188479297 X:30620945-30620967 AAATAAAAAAAAATGTAGCTGGG + Intergenic
1188707517 X:33354175-33354197 AAATAAAGACAGAGTAAGCCAGG + Intergenic
1188873790 X:35405392-35405414 AAATAAATAAAGACCAAGCACGG - Intergenic
1189425427 X:40896165-40896187 AAATAAATACAAATAAAGGAAGG - Intergenic
1189465512 X:41275506-41275528 AATTAAATACATTTTAAGCTGGG - Intergenic
1189555351 X:42139093-42139115 ACATGATTACAAATGAAGCTGGG - Intergenic
1189762008 X:44331535-44331557 AAATGAATACAAGTGAAGCTGGG + Intronic
1189769350 X:44408053-44408075 AAAAAAAAACAGAGAAAGCTGGG - Intergenic
1189893483 X:45629640-45629662 AAATAACAACACCTGAAGCTGGG + Intergenic
1189930725 X:46006168-46006190 AAAAAAATACACAGGAGGCTGGG - Intergenic
1190235783 X:48614417-48614439 AAAAAAATACAGTTGAGGCCAGG - Intergenic
1190522527 X:51294849-51294871 AATAAAATACAAATGAAACTAGG - Intergenic
1191607366 X:63077503-63077525 AATTAACTACAGATGATGCCAGG + Intergenic
1192805784 X:74507249-74507271 AAAAAATCACAGATGAGGCTGGG - Intronic
1193133943 X:77948868-77948890 AAATAAATACAAATAAATATTGG - Intronic
1193242805 X:79192771-79192793 AAATAAATAAAGATGAAAAAAGG - Intergenic
1193247099 X:79242180-79242202 AAATAAACACAAATGCAGGTGGG - Intergenic
1193279753 X:79632443-79632465 AAATAAATACATATTAAACTGGG - Intergenic
1193782684 X:85723195-85723217 AAATAAATAAAGATTGAACTGGG - Intergenic
1193845265 X:86462361-86462383 AAATAAATGCAAATGATGATGGG + Intronic
1194522938 X:94941452-94941474 AAATAAATAAATAAGAACCTTGG - Intergenic
1194682770 X:96873733-96873755 AAATAAGTACAAATAAAACTAGG + Intronic
1194845421 X:98801437-98801459 GAATAATTACAGATGAAGTTTGG + Intergenic
1195267436 X:103196482-103196504 AAATAAATAAAACTTAAGCTGGG + Intergenic
1195768302 X:108320024-108320046 ACATAGATACAGATGCAGGTAGG + Intronic
1196015501 X:110935752-110935774 AAATAATTACAGATGCTGCAAGG - Intergenic
1196622565 X:117840199-117840221 ATATACATACACATGAACCTGGG + Intergenic
1196821404 X:119703985-119704007 AGGAAAAAACAGATGAAGCTGGG - Intergenic
1197027541 X:121772750-121772772 AAAGAAAAACACATCAAGCTAGG - Intergenic
1197481694 X:126994754-126994776 ACAGAAATACAGATGAAGGTCGG - Intergenic
1198016761 X:132619330-132619352 AAATATATACAGATGATGTCCGG + Intergenic
1199125981 X:144121063-144121085 AAATAAATGCAAATGAAGTGTGG + Intergenic
1199549844 X:149047344-149047366 AAAAGAATACAAATGGAGCTGGG - Intergenic
1199669069 X:150126982-150127004 AAATAAATAAATAAGAAGCCAGG + Intergenic
1199800269 X:151243806-151243828 ATATATATACATATGAAGCTAGG - Intergenic
1201495202 Y:14585343-14585365 AAATAAATAAAGAGGAAACTTGG + Intronic
1201577511 Y:15477023-15477045 CTGTGAATACAGATGAAGCTTGG + Intergenic
1201767710 Y:17588061-17588083 AAAAAAAAAAAAATGAAGCTGGG + Intergenic
1201833843 Y:18317924-18317946 AAAAAAAAAAAAATGAAGCTGGG - Intergenic