ID: 933229175

View in Genome Browser
Species Human (GRCh38)
Location 2:79786022-79786044
Sequence TATGCAAGACCACCCTTAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 53}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933229175_933229180 14 Left 933229175 2:79786022-79786044 CCTGTTAAGGGTGGTCTTGCATA 0: 1
1: 0
2: 0
3: 3
4: 53
Right 933229180 2:79786059-79786081 ACATTGTTATTGATTGGAAGAGG 0: 1
1: 0
2: 1
3: 19
4: 224
933229175_933229179 8 Left 933229175 2:79786022-79786044 CCTGTTAAGGGTGGTCTTGCATA 0: 1
1: 0
2: 0
3: 3
4: 53
Right 933229179 2:79786053-79786075 GGAAACACATTGTTATTGATTGG 0: 1
1: 0
2: 3
3: 18
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933229175 Original CRISPR TATGCAAGACCACCCTTAAC AGG (reversed) Intronic
907854511 1:58288938-58288960 CATGCAAGAATACCCTGAACTGG + Intronic
908266247 1:62382070-62382092 AATGCAAGACAACTCTTGACAGG + Intergenic
915864876 1:159488534-159488556 TATGTAAAACAACCATTAACAGG - Intergenic
921431629 1:215072723-215072745 AATGCAAGACCATCTTTAAGAGG - Intronic
1063182673 10:3619421-3619443 TATTCAAGGCCACCCTTACCTGG - Intergenic
1074764886 10:116693177-116693199 TATGCAAGGCCAGCATTATCAGG + Intronic
1075203970 10:120430872-120430894 TTTGCAAGCCCACCCTTCAAAGG - Intergenic
1077270706 11:1678292-1678314 TAGGCAAGCTCACCCTTACCTGG + Intergenic
1077843900 11:6003840-6003862 TATGCAAGAACCCACTTACCTGG + Intergenic
1080813271 11:35727332-35727354 TCAGCAAGTCCATCCTTAACTGG + Intronic
1081762575 11:45586802-45586824 TATTAATGACCACACTTAACAGG - Intergenic
1085027178 11:73243076-73243098 TGTGGAAGACCACTCTTCACAGG + Intergenic
1085390928 11:76181802-76181824 TATCCAAGACCACCCCCAACAGG - Intergenic
1092273262 12:7039704-7039726 TCTGCAAAACCCCCCTTAAGAGG - Intronic
1093399173 12:18722934-18722956 AATGGAAGACCACCTATAACTGG + Intronic
1104717140 12:131023545-131023567 TATGGTATACCACCCTTCACAGG - Intronic
1120039394 14:79735625-79735647 TATACACTACCACCCTTTACAGG - Intronic
1121390630 14:93570481-93570503 TATGGAAGACTTCCCTTTACAGG - Intronic
1151310913 17:73291929-73291951 TACGGAAGACCACCCTTGCCTGG + Intronic
1153988735 18:10376397-10376419 TATGCAAGCACAGCCTTGACAGG - Intergenic
1155351125 18:24907330-24907352 TAGGCAAGACCACTCTTCAGAGG + Intergenic
1156145750 18:34175245-34175267 CATGGAAGACCCCACTTAACAGG + Intronic
1157465039 18:47936413-47936435 TATGTATGACCACCCTAGACAGG - Intergenic
1159131646 18:64286980-64287002 AAGGCAAACCCACCCTTAACTGG - Intergenic
1159658476 18:71062026-71062048 TATGCTAGACCTCCCTCACCAGG - Intergenic
1162264225 19:9557801-9557823 TATGAAAGCCCACACATAACTGG - Intergenic
1164864126 19:31589887-31589909 GATGAAAGACCACGATTAACAGG + Intergenic
925106794 2:1298798-1298820 TAGGCAAACCCACCCTTAATTGG + Intronic
926663011 2:15489341-15489363 TAGTCAAGACCAACCTTAAAAGG - Intronic
931052769 2:58432271-58432293 GATGCACCACCACCCTTAAAAGG - Intergenic
931661777 2:64571717-64571739 TAGACAAAATCACCCTTAACTGG - Intronic
933229175 2:79786022-79786044 TATGCAAGACCACCCTTAACAGG - Intronic
937189357 2:120079549-120079571 TATGAAGGACCACCCCTATCAGG + Intronic
1171896936 20:30816249-30816271 TAGGCCACACCACCCTGAACGGG - Intergenic
1180133493 21:45844259-45844281 TGTGCAAGACCTCCCTAAAGTGG - Intronic
1180579078 22:16812290-16812312 TGTGCACTACCAGCCTTAACAGG - Intronic
962348635 3:134640849-134640871 GAAGCAAGACAACCCTTAAGAGG - Intronic
972887666 4:43511875-43511897 TATGCAAGACAATCATTATCTGG - Intergenic
987730691 5:21768525-21768547 TATGCAAGAACATAGTTAACAGG + Intronic
988334335 5:29886486-29886508 TATGAAAGACCACCATTTATTGG + Intergenic
997793025 5:136779613-136779635 TATGCGAGACCACCCCTCTCTGG + Intergenic
1005096857 6:22125868-22125890 TATGCAAGTTGACTCTTAACAGG - Intergenic
1014408535 6:121084099-121084121 CAGGCAAGACCACCCTTGATGGG - Intronic
1023241349 7:38151194-38151216 TATGCAAGACCACCCTGCAGAGG - Intergenic
1024491789 7:49994252-49994274 TATGCAGGACCACCCAAAAGTGG - Intronic
1026421673 7:70243784-70243806 TATTCATGACTACTCTTAACAGG + Intronic
1030384697 7:108854558-108854580 TATGAATGACCACACTGAACTGG + Intergenic
1031683010 7:124697475-124697497 TTTACAAGACCACCTTTTACTGG + Intergenic
1037443493 8:18941499-18941521 GATGCAAGCCCACCATTAAATGG + Intronic
1042949307 8:74184713-74184735 AGTGAAAGACCACCCATAACTGG - Intergenic
1042990993 8:74639650-74639672 TATGCAAGAACATTTTTAACAGG - Intronic
1043111059 8:76183177-76183199 TAAGCTAGACTAACCTTAACAGG - Intergenic
1049195427 8:141313117-141313139 TATGGAAGCCCTCCCTGAACTGG + Intergenic
1049531262 8:143156778-143156800 CATGCAAGGCCAGCCTTTACAGG + Intergenic
1049931420 9:460647-460669 TCTGAAAGAACTCCCTTAACTGG - Intronic
1189563331 X:42213750-42213772 AATGCAAGTCAACCCATAACAGG + Intergenic
1194628338 X:96252140-96252162 TATCCAAGAATACTCTTAACAGG - Intergenic