ID: 933229991

View in Genome Browser
Species Human (GRCh38)
Location 2:79796159-79796181
Sequence CTGTCCTAACAGTGTTAAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 136}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933229991_933229995 27 Left 933229991 2:79796159-79796181 CCGTCTTAACACTGTTAGGACAG 0: 1
1: 0
2: 1
3: 12
4: 136
Right 933229995 2:79796209-79796231 ATTAGATATCCAATCTTTTCTGG 0: 1
1: 0
2: 1
3: 14
4: 151
933229991_933229993 -1 Left 933229991 2:79796159-79796181 CCGTCTTAACACTGTTAGGACAG 0: 1
1: 0
2: 1
3: 12
4: 136
Right 933229993 2:79796181-79796203 GAGACAGACCTTGTCAAACAGGG 0: 1
1: 0
2: 0
3: 8
4: 182
933229991_933229992 -2 Left 933229991 2:79796159-79796181 CCGTCTTAACACTGTTAGGACAG 0: 1
1: 0
2: 1
3: 12
4: 136
Right 933229992 2:79796180-79796202 AGAGACAGACCTTGTCAAACAGG 0: 1
1: 0
2: 3
3: 19
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933229991 Original CRISPR CTGTCCTAACAGTGTTAAGA CGG (reversed) Intronic
902238770 1:15074518-15074540 CTGTTCTACCAGGGTTAAGGAGG - Intronic
906594304 1:47061039-47061061 CAGAACTAACAGTGTTAAGAGGG + Intergenic
909702143 1:78537743-78537765 CTGTGCTACCAGTACTAAGAGGG + Exonic
909715798 1:78704614-78704636 ATCTCCTAAAAGTGCTAAGATGG - Intergenic
910876218 1:91881237-91881259 CTGTCCTTTGAGTTTTAAGAAGG - Intronic
911933514 1:103935514-103935536 CCATCCTAACAGTGTTAAGCAGG + Intergenic
916370452 1:164088351-164088373 CTGTCCTTTCAGTTTTATGAAGG - Intergenic
917149815 1:171931200-171931222 AAGACGTAACAGTGTTAAGATGG + Intronic
917961115 1:180145481-180145503 CTGTCTTAACAGTGCTAACATGG - Intergenic
917991267 1:180381709-180381731 CAGTAAAAACAGTGTTAAGAAGG + Intronic
919233952 1:194813566-194813588 CTGTCAGAACAATGTAAAGAAGG + Intergenic
923058621 1:230449259-230449281 GTGTCCAAACAGAGTGAAGAGGG - Intergenic
1068769897 10:60809512-60809534 CTGGCTTTAGAGTGTTAAGAAGG + Intergenic
1070812241 10:79304261-79304283 CTGTCCTAACACTGTCCTGAAGG + Intronic
1074338741 10:112605309-112605331 CTGTAAGAACAGTGTTGAGAGGG + Intronic
1075263897 10:120984601-120984623 CTGTTCTCACAGTGCTAATAAGG + Intergenic
1081863720 11:46348193-46348215 CTGTTCTATCAGTGCCAAGAAGG - Intronic
1093941424 12:25059245-25059267 CTGTCTTAACTGTATTAAGAAGG - Intronic
1094322058 12:29195057-29195079 CTTTCCTAACAGTGATCAAAAGG - Intronic
1094332706 12:29313108-29313130 GTTTCCTACCAGGGTTAAGAGGG + Intronic
1095293642 12:40504532-40504554 CTTTCCTAACAATGTTAATATGG - Intronic
1095358429 12:41305808-41305830 TTGTCTTAACATTGTCAAGATGG - Intronic
1096049841 12:48597910-48597932 CTGACCCATCAGTGCTAAGAGGG + Intergenic
1098008640 12:66026314-66026336 CTGTTCTAACAGGGATGAGATGG - Intergenic
1100705299 12:97194303-97194325 CTGTCCTCACAGGGTTAACAAGG - Intergenic
1101507642 12:105361751-105361773 CTGTCCTGCCAGTGTTCAAAGGG - Intronic
1102941593 12:116947335-116947357 ATTTCCTGACAGTGTTAACAAGG + Intronic
1103583263 12:121932387-121932409 CTGTCTTGAAAGTGTTAAGTAGG + Intronic
1103605477 12:122082777-122082799 CATTCCTTACAGTGTCAAGAGGG - Intronic
1104044102 12:125149719-125149741 ATGTCCTCACAGTGATAAGAGGG + Intergenic
1105049345 12:133034880-133034902 CTCTCCTAACACTGTTACAATGG - Intergenic
1106121436 13:26862989-26863011 CTACCCTAAGAGTGTGAAGAGGG + Intergenic
1109872501 13:68352316-68352338 CCTTGCTAACAATGTTAAGAAGG + Intergenic
1111739723 13:92188881-92188903 CTGCTCTAACAGAGCTAAGAAGG - Intronic
1112309789 13:98308240-98308262 CTGTCCTATCTGTGTTAATCAGG + Intronic
1113418822 13:110154130-110154152 CATTCCTGACAGTGTGAAGATGG + Intronic
1114985949 14:28229703-28229725 CTTTACTAACAGTGTGAAAATGG - Intergenic
1115279292 14:31643035-31643057 CTGTCCTAACAGTTTTTTGGTGG + Intronic
1115779349 14:36752186-36752208 CTGTCCTAATAGTGGTAAAATGG - Intronic
1117573015 14:57068007-57068029 CTTGTCTAACAGTGCTAAGAAGG + Intergenic
1120811587 14:88808958-88808980 CTGTCCTCCCAGTGTGCAGATGG + Intergenic
1124092683 15:26621330-26621352 CTGTCCCATCAGGGTGAAGACGG + Exonic
1127540222 15:59930084-59930106 CTATCCTTACAGTGGGAAGAGGG + Intergenic
1130203678 15:81855961-81855983 CTTTACTAACAGTGTGAAAACGG - Intergenic
1132269697 15:100512825-100512847 CTCTACCAACAGTGTTAGGAGGG - Intronic
1133663750 16:7944916-7944938 CTTTCAAAACAGTGTGAAGATGG - Intergenic
1135908241 16:26534324-26534346 CTGACCTAACAGAAATAAGAAGG + Intergenic
1138652445 16:58468422-58468444 CTGGCCTAACACTGTTAATGAGG - Intronic
1149177298 17:53888637-53888659 CCATCCTAACAGTGGTAAGGTGG - Intergenic
1154953930 18:21237204-21237226 AAGACCTAACATTGTTAAGATGG - Intergenic
1156132398 18:33992350-33992372 CTGTCATAACAGTGTTGATCTGG - Intronic
1156267767 18:35503824-35503846 CTGTGCTCAGAGTGTTAAGTAGG + Intergenic
1156562870 18:38148498-38148520 CAGCCCTAACAGTGTGAAGAAGG - Intergenic
1156847594 18:41686128-41686150 AAGTCATAATAGTGTTAAGATGG + Intergenic
1158830779 18:61275711-61275733 CTGACCAAACATTGGTAAGAGGG + Intergenic
1159525543 18:69584157-69584179 CTGTTTTAACAGTGTTTTGATGG - Intronic
1159527117 18:69606647-69606669 TTGTCCTAACAGTTTTTAAATGG - Intronic
1159669422 18:71204565-71204587 CTGCCTTAACAGTTTTAAAAAGG + Intergenic
1160548398 18:79677714-79677736 CTGTCCTTACAGTGTGAACCAGG + Intergenic
1161644683 19:5445768-5445790 CAGCCCTGACAGTGTGAAGAAGG - Intergenic
1168082483 19:54020452-54020474 CTGCCTTATCAGTGTTACGAAGG + Intergenic
925354813 2:3232648-3232670 CTGTCCTAACAGTGTTGAAATGG - Intronic
927087894 2:19689434-19689456 GTGTCCTAACCGTGTTGAGTTGG - Intergenic
931983168 2:67715815-67715837 CTGTTCTAACCCTGCTAAGAGGG + Intergenic
933229991 2:79796159-79796181 CTGTCCTAACAGTGTTAAGACGG - Intronic
933423521 2:82082315-82082337 CTGACCTAACAGGTTTAATAAGG + Intergenic
936789756 2:116137632-116137654 CTGTCCTCACATTGTGAGGATGG + Intergenic
937284763 2:120743333-120743355 CTGGAATTACAGTGTTAAGATGG - Intronic
939260303 2:139799480-139799502 CTGTTCTAAGATTTTTAAGAAGG + Intergenic
940441192 2:153718778-153718800 CTGACCTCACAGTGTTGTGAAGG + Intergenic
941011086 2:160299986-160300008 CTGTCATGACAGTGTGAACAAGG + Intronic
941196280 2:162456088-162456110 CAGTTAAAACAGTGTTAAGAGGG - Intronic
944922026 2:204424795-204424817 CAGTCATAGCAGTGTTAAGAGGG + Intergenic
947562683 2:231171370-231171392 GTGTCTTAACAGTGTTGAAAGGG + Intronic
947694569 2:232174032-232174054 AAGACTTAACAGTGTTAAGATGG - Intronic
1169411696 20:5376398-5376420 CTCTCCTAACAGAGTGAATATGG + Intergenic
1172828005 20:37806797-37806819 CTGTCCAATCAGAGTTAGGAGGG + Intronic
1173613414 20:44387468-44387490 ATGGCCTCACAGTGTTAAGTGGG + Intronic
1182599854 22:31453193-31453215 TTGTCCTAACAATTTTGAGAGGG - Intronic
949528057 3:4925552-4925574 CTGGCCTAGTATTGTTAAGATGG + Intergenic
951002089 3:17574482-17574504 CTGTGCTAACAGTGTTGGAAAGG - Intronic
955213245 3:56961745-56961767 CTGGCCTAGAATTGTTAAGAGGG - Intronic
956920877 3:73927946-73927968 TTTACCTAAAAGTGTTAAGAGGG - Intergenic
958817628 3:98933295-98933317 TCTTCCTAGCAGTGTTAAGAGGG + Intergenic
959999082 3:112712101-112712123 CTGCTCTGACAGTATTAAGAAGG + Intergenic
962315843 3:134359091-134359113 CTCTCCTGCCAGTGTGAAGAGGG - Intronic
963701768 3:148635453-148635475 CAGTTCTAACAGTGTTTTGATGG - Intergenic
963913655 3:150837887-150837909 CAGTTAAAACAGTGTTAAGAGGG - Intergenic
964296254 3:155237175-155237197 CAGACAAAACAGTGTTAAGAGGG - Intergenic
965036611 3:163447488-163447510 CTGCTAAAACAGTGTTAAGAGGG + Intergenic
965424617 3:168506550-168506572 CTTTCTCAACAGTGTTGAGAAGG - Intergenic
965452793 3:168858958-168858980 ATGTCCTACAAGTGTTACGAAGG - Intergenic
965466892 3:169040957-169040979 CAGTCTTAGCAATGTTAAGAAGG - Intergenic
966156978 3:176927171-176927193 CTCTTCTAACAGCGTTAAAAGGG + Intergenic
969948389 4:10807886-10807908 CTGTCTTGACAGTTGTAAGATGG + Intergenic
971065323 4:23025508-23025530 CTGACCCAGCAGTGTTATGAAGG - Intergenic
974155710 4:58069536-58069558 CTCTCCTAAGAGTCTTATGAAGG - Intergenic
976218731 4:82739204-82739226 ATGTCTTACCAGTGTTGAGAGGG - Intronic
978118762 4:105052780-105052802 CAGCCAAAACAGTGTTAAGAGGG + Intergenic
979117281 4:116841662-116841684 TTTTCCTAACAGAGTGAAGAAGG - Intergenic
984085455 4:175304972-175304994 CTTTCCTTACTGTGTTCAGAAGG - Intergenic
986833195 5:11605172-11605194 TTCTCCTAACAGTGCCAAGAGGG + Intronic
986903981 5:12470823-12470845 CAGTCAAGACAGTGTTAAGAGGG + Intergenic
987749717 5:22023874-22023896 ATGACATAACTGTGTTAAGAGGG - Intronic
988120579 5:26955996-26956018 CTGTCTTAATACTGTTAAAATGG - Intronic
989654759 5:43734417-43734439 CAGTCCAAGCAGGGTTAAGAGGG - Intergenic
992913819 5:81426749-81426771 CTGTCTTAACAGTTGGAAGAGGG - Intronic
994743232 5:103647086-103647108 GTGTCCTCACAGGGTTAACAAGG + Intergenic
995710049 5:115026206-115026228 TTGATCTAACTGTGTTAAGAAGG - Intergenic
998643214 5:144035389-144035411 CTTTCCTCACAGTGCTTAGAAGG + Intergenic
999493195 5:152071607-152071629 CTATCCTAACAGTATAAACAGGG + Intergenic
1001268220 5:170290615-170290637 CTGTCCTAACAGTTGTCAGTTGG - Intronic
1002156843 5:177288973-177288995 CTGCCCTAACACTGTTAGGGAGG - Intronic
1002682151 5:180974865-180974887 CTATCCTAACAGTTGTGAGATGG - Intergenic
1003454981 6:6273790-6273812 TTGTGCTAACAGTCTTAGGATGG + Intronic
1005241176 6:23829757-23829779 GAGACTTAACAGTGTTAAGACGG - Intergenic
1006358537 6:33574580-33574602 CTGTCATCACAGTGGTATGAAGG + Intronic
1014227394 6:118863585-118863607 CCATCATAACAGTATTAAGAGGG + Intronic
1017858461 6:158373018-158373040 CTGTCTGAGCAGTGTTAAGTTGG - Intronic
1020031811 7:4938570-4938592 CCGTTGTAACAGTATTAAGAGGG - Intronic
1021304717 7:19018549-19018571 CTGTGAAAACAGTGCTAAGACGG + Intergenic
1021416166 7:20387618-20387640 CTGTCATAACTGTGGAAAGAGGG + Intronic
1024522190 7:50315157-50315179 CTGACCAAACAGTGTCAAGTAGG - Intronic
1026815808 7:73510684-73510706 CTTTCCTAACAATGTGAAGATGG + Intronic
1026923406 7:74172795-74172817 CCTTCATAGCAGTGTTAAGATGG - Intergenic
1032929784 7:136653243-136653265 CTGCCCGTATAGTGTTAAGAAGG - Intergenic
1033397037 7:140985293-140985315 ATTTCCTAACCCTGTTAAGAAGG + Intergenic
1034706213 7:153147516-153147538 CCATTCTAACAGTATTAAGAGGG + Intergenic
1035113443 7:156504154-156504176 CTGCCCTGGCAGTGTGAAGACGG + Intergenic
1035216243 7:157369609-157369631 CTTTAATAACAATGTTAAGAAGG - Intronic
1037304532 8:17491702-17491724 CTGTTCTAACGGTGTTCAAAAGG + Intergenic
1038677340 8:29635283-29635305 CTGTTCTAACAGTGTAGTGACGG - Intergenic
1039197079 8:35044485-35044507 TTGTAATAACAGTATTAAGAGGG - Intergenic
1050335498 9:4586099-4586121 CTGCAATAACAGTTTTAAGATGG + Exonic
1052144673 9:25034183-25034205 CAGTTCTAACAGTTTTAAGGTGG - Intergenic
1052502378 9:29308166-29308188 CTGTCCTCACACTGCTATGAAGG + Intergenic
1056140983 9:83679204-83679226 CTTTCCTAATAGGGTTAAAATGG - Intronic
1057197787 9:93124678-93124700 CTGTGGTCACAGTGTTTAGATGG - Intronic
1057387724 9:94619280-94619302 CTGTCCTCACCCTATTAAGAGGG - Intronic
1058362514 9:104165774-104165796 CAGTCCTAATAGTGCTATGATGG - Intergenic
1059676622 9:116546540-116546562 CTGTCCTAGGAGTGTGAAGATGG + Intronic
1186008587 X:5103637-5103659 CTGGCAAAACAGTGATAAGATGG - Intergenic
1189102047 X:38200775-38200797 CTGTAGTAACAGTATTAACAGGG - Intronic
1189131700 X:38505467-38505489 CTCACCTAACAGAGTTGAGAAGG - Intronic
1190271588 X:48868204-48868226 CTGTTCAAACATTGTTCAGAAGG + Intergenic
1190649052 X:52551193-52551215 CTGTGCTCACAGTGTAAATAAGG + Intergenic
1193040451 X:76998764-76998786 ATCCCCCAACAGTGTTAAGAAGG - Intergenic
1197777431 X:130128116-130128138 CTGTTCTCCCAGTGTTCAGAAGG + Intergenic
1199248778 X:145636511-145636533 CAGTCAAAACAATGTTAAGAGGG + Intergenic
1200068005 X:153514232-153514254 CTGTCCCAACAGTGGCAGGAGGG + Intergenic