ID: 933235504

View in Genome Browser
Species Human (GRCh38)
Location 2:79859779-79859801
Sequence CTCTGACTCCAGCAGCTAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 169}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933235504_933235508 1 Left 933235504 2:79859779-79859801 CCATTTAGCTGCTGGAGTCAGAG 0: 1
1: 0
2: 2
3: 14
4: 169
Right 933235508 2:79859803-79859825 AACTGGGTTTCATCTTGGTTTGG 0: 1
1: 0
2: 0
3: 19
4: 213
933235504_933235509 23 Left 933235504 2:79859779-79859801 CCATTTAGCTGCTGGAGTCAGAG 0: 1
1: 0
2: 2
3: 14
4: 169
Right 933235509 2:79859825-79859847 GTATCTACTTGCCATCTGTCTGG 0: 1
1: 0
2: 1
3: 7
4: 103
933235504_933235507 -4 Left 933235504 2:79859779-79859801 CCATTTAGCTGCTGGAGTCAGAG 0: 1
1: 0
2: 2
3: 14
4: 169
Right 933235507 2:79859798-79859820 AGAGTAACTGGGTTTCATCTTGG 0: 1
1: 0
2: 1
3: 14
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933235504 Original CRISPR CTCTGACTCCAGCAGCTAAA TGG (reversed) Intronic
900777390 1:4595141-4595163 CTCTGTCTCCAGCTCCTAGAAGG + Intergenic
901493363 1:9607775-9607797 CTCTGACTCGAGCAGGTAAGGGG + Exonic
904272150 1:29357081-29357103 CTCTGACTCCAGCAGTTTAAGGG - Intergenic
904978540 1:34477344-34477366 CTCTGACACCTGCAGCAAAGGGG - Intergenic
907419120 1:54334986-54335008 CTCTGACTCAAGCAGCACAGAGG + Intronic
907741407 1:57169754-57169776 CTCTGACTTAACCACCTAAAAGG - Intronic
907900391 1:58735791-58735813 GGCTGTCTGCAGCAGCTAAATGG + Intergenic
910167903 1:84347208-84347230 CCCTGACTAGAGCAGCTCAAAGG - Intronic
910828067 1:91430148-91430170 CACTGCCTCCAGAAGCTATAAGG - Intergenic
910934086 1:92472985-92473007 CTGTTACTCCAGCAGACAAAAGG + Intergenic
913128362 1:115814384-115814406 CTTTGACCCCAGGAGCTAACTGG + Intergenic
920378592 1:205522773-205522795 CTAGACCTCCAGCAGCTAAAGGG + Intronic
922327627 1:224543546-224543568 CACTGACTCCACAAGCCAAAAGG - Intronic
922899348 1:229124012-229124034 GTCTGACTCTAGCAGCAAAGGGG - Intergenic
1064222095 10:13450230-13450252 TTCTGACTCCACAAGCTAATTGG - Intronic
1064896851 10:20246660-20246682 CTTTGACTCTAACATCTAAATGG + Intronic
1066390030 10:34971122-34971144 CTCTGATTGCTGCAGCTAACAGG - Intergenic
1067817032 10:49487514-49487536 CACTGGCACCAGCAGCTAAGTGG - Intronic
1070241413 10:74685830-74685852 CTCTGACTCCTTCAGTCAAAAGG + Intronic
1075651821 10:124132337-124132359 CTCTGACTCCAGCAGGTGAGTGG - Intergenic
1077888348 11:6402264-6402286 CTCTGACCCCTGCAGCTCAGGGG + Intronic
1078019257 11:7641566-7641588 CTCTGACACCAGATGGTAAACGG + Exonic
1078929592 11:15902739-15902761 CTCGGGGTCCAGCAGCTAACAGG - Intergenic
1082103827 11:48198075-48198097 CTCTGGCTCCAGCTGCTCTACGG + Intergenic
1083429239 11:62605394-62605416 CTCTTGATCCAGCACCTAAATGG - Intronic
1084746454 11:71172980-71173002 CTCAGCCTCCAGCAGCCCAATGG - Intronic
1086193645 11:84110647-84110669 CTCTGAGTCCATCAGAGAAAAGG + Intronic
1089763963 11:120749490-120749512 CTCTGAGCCCAGCAGCCCAATGG - Intronic
1090017073 11:123095657-123095679 CTCTGATTCCAGCAAGTACAAGG + Intronic
1090823835 11:130369381-130369403 CTCAGACTTCAGCAGCCATATGG + Intergenic
1090869622 11:130731651-130731673 CTCTGACTGCAACAGCTAGGGGG - Intergenic
1091146614 11:133285568-133285590 CTCAGACTTCAGCTGTTAAAAGG + Intronic
1091226983 11:133963399-133963421 CTCTGGCCCCAGCAGCCCAAAGG + Intergenic
1096073120 12:48787125-48787147 CTCTGTCTCCAGCAGCTCTGGGG - Intronic
1096263710 12:50108025-50108047 CTCTTTCTCCAGCTGCTCAATGG - Exonic
1097268095 12:57757123-57757145 CCCTGAGTCCAATAGCTAAAAGG - Intronic
1098881808 12:75925157-75925179 CTCAGACTCCAGTAGCTGAAGGG - Intergenic
1102201841 12:111062869-111062891 CTCTGGCTCCAGCAAGTGAAAGG + Intronic
1103592602 12:122002938-122002960 TTCAGACTCCAGTAGCTAACAGG + Intronic
1104127803 12:125863994-125864016 CTCTGACACAATCAGCTAAGAGG + Intergenic
1105765302 13:23553403-23553425 CCCAGACCCCAGCGGCTAAATGG - Intergenic
1108396080 13:49993225-49993247 CTATGACTCTGGCAGCTAAATGG + Intergenic
1108496924 13:51034449-51034471 CACTGGCTTCAGCAGCTAAGCGG - Intergenic
1109422835 13:62135964-62135986 CTTTGACTCCAGGGTCTAAAAGG + Intergenic
1112560067 13:100505055-100505077 TTCTGACTCCAGATCCTAAATGG + Intronic
1112710199 13:102118920-102118942 CTCTTACTCCAGCAACGTAAAGG - Intronic
1113822603 13:113225711-113225733 CTCTGACTCCAGGAGCTGGACGG - Intronic
1115839593 14:37453521-37453543 CTCAGAGTCAAGCAGGTAAAGGG - Intronic
1121168839 14:91836363-91836385 CACTGCCTCCAGCAGGTAACCGG - Intronic
1122082930 14:99279149-99279171 CTCTCACTGCAGCAGCCACAGGG + Intergenic
1122562806 14:102628857-102628879 CTCTGACTGCAGTAGAGAAAAGG - Intronic
1122676937 14:103423401-103423423 CTCTGATGCCAGCAGCAAAGTGG - Intronic
1122881785 14:104693572-104693594 CTCTGCCCACAGCAGCTGAATGG - Intronic
1125084268 15:35712371-35712393 CTCTGACTCCAAAATCTATATGG + Intergenic
1126037029 15:44556206-44556228 GTCTAACTCCAGAAGCTAAGCGG - Intronic
1126176057 15:45736660-45736682 ATATCACTACAGCAGCTAAATGG - Intergenic
1128879530 15:71230572-71230594 CCCTGTCTCCAGCAGCAAAATGG - Intronic
1129755153 15:78093630-78093652 CTGTGTCTGAAGCAGCTAAAAGG - Intronic
1132379568 15:101357440-101357462 CTCTGAATCCTGGAGCTAGAGGG + Intronic
1138510298 16:57504828-57504850 CCCTGACTCCTCTAGCTAAAAGG - Intergenic
1141668756 16:85480498-85480520 CTGTGACTGCAGCTGCTGAAGGG + Intergenic
1141937478 16:87251091-87251113 CGCTGACTCCAGGAGCTGAGAGG + Intronic
1147658769 17:42105812-42105834 CTCTGGCTCCAGCAGCAGCAGGG - Exonic
1147771705 17:42872498-42872520 CTCTGTCTCCAGCAGCTTCCGGG - Intergenic
1148126383 17:45239404-45239426 CTCTGACTCCAGCATATAATGGG + Intronic
1148212133 17:45814999-45815021 CCCTGAGTCCAGCAGAGAAAGGG + Intronic
1150647933 17:66991525-66991547 AACAGACTCAAGCAGCTAAATGG - Intronic
1150709738 17:67520596-67520618 CTCTGCCTCTAGCATCTACAGGG + Intronic
1151407245 17:73896588-73896610 CTCCGACTCCAGCACCCAGAGGG - Intergenic
1151559989 17:74864809-74864831 CTCTGGCCCCAGCACCTTAATGG + Exonic
1152488894 17:80615389-80615411 TCCTGACTCCTGCAGCTAAGGGG - Intronic
1153574572 18:6507738-6507760 CTCTGACTCCAACAGTCAAAGGG - Intergenic
1153592780 18:6691683-6691705 ATCTGGCTCCAACAGCAAAATGG - Intergenic
1153925154 18:9828978-9829000 CTGTGACAGCAGCAGGTAAATGG - Intronic
1155163107 18:23211457-23211479 CCCTGGCTCCAGCAGCTCCAAGG + Intronic
1155492016 18:26408748-26408770 CTCTGACTCCATTGGATAAAGGG - Intergenic
1157549742 18:48573235-48573257 CTCTGACCCCAGCAGCTCTGTGG - Intronic
1161663304 19:5560332-5560354 CTCTGAGTCCTGCAGCCAACAGG + Intergenic
1162031967 19:7921429-7921451 GTCTTCCTCCAGCAGCTCAAGGG + Exonic
1162860628 19:13504116-13504138 CTCTCACTCCTGGAGCTAACTGG + Intronic
1163049693 19:14673037-14673059 CTCTGTCTCCAGTTGCAAAAAGG + Intronic
1164094672 19:21996516-21996538 CTCTGACTTTAGTAACTAAAAGG + Intronic
1164570707 19:29372394-29372416 CTCACACTTCAGCAGCTACAGGG - Intergenic
1165324205 19:35104736-35104758 CTCTGATGCCAACAGCTTAATGG + Intergenic
926086215 2:10022019-10022041 CTCTGCCTCCAGCACTTCAACGG - Intergenic
926885545 2:17595068-17595090 ATCTCACTCCAGCAGCTGTATGG - Intronic
927754542 2:25698218-25698240 CTCGGATTTCAGCAGCTGAACGG + Intergenic
927996676 2:27492037-27492059 CTCTTACCCCAGCAAATAAAAGG - Exonic
929023560 2:37577494-37577516 CTCTGCCTCCAGCAAAGAAATGG + Intergenic
932122196 2:69112280-69112302 CTCTGAGTTCATCAGCAAAATGG - Intronic
932606673 2:73170028-73170050 GCCTGCCTCCAGCAGCTAAGGGG - Intergenic
932922506 2:75933217-75933239 TTCTGAATCCTGCAGCTCAAAGG + Intergenic
933235504 2:79859779-79859801 CTCTGACTCCAGCAGCTAAATGG - Intronic
933925753 2:87090407-87090429 GCCTGCCTCCAGCAGCTAAGGGG + Intergenic
934901409 2:98162843-98162865 CTCTGACTCCAGCTCCTAAAAGG - Exonic
935225421 2:101048057-101048079 CTCCGACTCCTGCAACTACACGG + Intronic
935741700 2:106154476-106154498 CTCTGCCTCCAGCAGCACATGGG - Intronic
936952004 2:117987077-117987099 TACTGACACCAACAGCTAAAAGG + Intronic
938042380 2:128086241-128086263 CTGTGTCTCCAGCACCTCAAGGG + Intergenic
1168778722 20:470558-470580 ATTTGACTCCTGCAGCAAAAAGG - Intergenic
1169637280 20:7706402-7706424 CTCTAAATCCATCAGCAAAATGG + Intergenic
1170847867 20:19977172-19977194 CTCTGACCCCAGCCCCTAAGAGG - Intronic
1172092491 20:32443878-32443900 TTCTGACTCCTGCTCCTAAATGG + Exonic
1174109845 20:48191392-48191414 CTCTTACTCCAGCAGGGACATGG - Intergenic
1176975167 21:15312623-15312645 CCCTGGCTCCAGAAGATAAAGGG + Intergenic
1177279456 21:18961932-18961954 CTCTGACTCCAGCCTCTACCTGG + Intergenic
1178479982 21:32971312-32971334 CCCTGAATCCAGGAGCCAAATGG + Intergenic
1180692616 22:17729874-17729896 CTCTGCCTCCAGCAGTGGAAGGG + Intronic
1182810952 22:33116211-33116233 CTCTGACTGCAGCAGGTCGATGG + Intergenic
1183114303 22:35678021-35678043 CTCTGACACCTGCAGCTTGAAGG + Intergenic
1184385843 22:44174154-44174176 CTCTCACTCCACCAGCTCAAGGG - Intronic
1184937627 22:47736542-47736564 CCCTAACTCCAGCAGGGAAAGGG - Intergenic
1185074029 22:48673571-48673593 CTCTCAGTCCAGCAGCGACAGGG - Intronic
954334479 3:49908343-49908365 CTCAGAGGCCTGCAGCTAAAGGG + Intronic
954527464 3:51284683-51284705 CTCTGGCTCAGGCTGCTAAATGG - Intronic
955532380 3:59887455-59887477 CTCTGACTGCTGCAGCCAGAGGG - Intronic
958260250 3:91372047-91372069 CTGTGATCCCACCAGCTAAAAGG - Intergenic
960125593 3:113995041-113995063 TTTTGACTCCTGCAGCAAAATGG + Intronic
961600062 3:128053288-128053310 CTTTGTATCCAGCTGCTAAAGGG + Intronic
963626000 3:147673383-147673405 CTCTGAATACAGAAGATAAATGG + Intergenic
966745490 3:183271508-183271530 CTCTAACACCAGTAGCTACATGG - Exonic
966912676 3:184568345-184568367 CTCTGCCTCCTGCAGATACATGG + Intronic
968803714 4:2759064-2759086 ATCTGACTTCAACAGCTACAAGG - Intergenic
969424637 4:7116992-7117014 CTCTGGACTCAGCAGCTAAAGGG + Intergenic
970917287 4:21350813-21350835 CTCTTACTCTAGCAGGTAAGTGG - Intronic
974181228 4:58386731-58386753 CCCTGACTCCAGCAGAGGAAAGG + Intergenic
979977249 4:127212183-127212205 CTCTGACTCAAGCACTTAACAGG + Intergenic
981604615 4:146528264-146528286 CTCTGATTGCTGCAGCTAACAGG - Intergenic
982984911 4:162194986-162195008 CTCTGCATCCAGCATCTATAAGG + Intergenic
983141607 4:164156345-164156367 CTCTGACTTCAGTAGGAAAATGG + Intronic
985424548 4:189816608-189816630 CTCTCACTCAAAGAGCTAAAAGG + Intergenic
986335831 5:6754739-6754761 CTCTTTCTCCAGCAGCACAACGG + Exonic
990072380 5:51799706-51799728 CTGACACACCAGCAGCTAAAAGG + Intergenic
991583543 5:68180525-68180547 GGCTTACTCCAGCAGCTAAGTGG - Intergenic
991954289 5:71977060-71977082 CAATGACTCCAGCTGCTAAAAGG - Intergenic
992573026 5:78079844-78079866 CTCTGATGCCAGAAGCAAAAAGG - Intronic
993802738 5:92363877-92363899 GTCTGACTCCAGCACCCCAAAGG - Intergenic
993884959 5:93405274-93405296 CTCTGAATCCAGCTGGAAAATGG - Intergenic
999859247 5:155627822-155627844 ATCTTACTCCAGCACCTAATGGG - Intergenic
1000610718 5:163370983-163371005 CTCTGAACCCAGCAGCTAAGAGG + Intergenic
1001052371 5:168423664-168423686 CTCTGAGTCCAGCTGCTCAAAGG - Exonic
1003127321 6:3365522-3365544 CTCCATCTCCAGCACCTAAATGG - Intronic
1005506939 6:26477687-26477709 CTCTGTCACCAGCAGCCAGAGGG - Intergenic
1005877003 6:30018678-30018700 CTCTGACCTGAGCAGATAAAAGG + Intergenic
1012173406 6:96048125-96048147 CTCTGACCACAGCAAGTAAAGGG + Intronic
1016214654 6:141582963-141582985 TTCTGATTAAAGCAGCTAAAAGG - Intergenic
1018897716 6:168032358-168032380 CTTTGACTACAACAGATAAACGG - Intronic
1021096309 7:16539709-16539731 CTCCAGCTCCAGCTGCTAAAAGG + Intronic
1021173704 7:17425365-17425387 CTCTAACTACCTCAGCTAAATGG + Intergenic
1021769322 7:23983119-23983141 CTCAGACTCCAGCAGGAATAGGG + Intergenic
1022487919 7:30794604-30794626 ATCTGACTCCGGGAGCTGAAGGG + Intronic
1022807878 7:33841234-33841256 CCCTCAGTCCAGCAGCTCAAAGG + Intergenic
1024119326 7:46221104-46221126 CGCTGACTCAGGCAGCTAACGGG + Intergenic
1024554880 7:50594970-50594992 CTCAGACTCCAGCAGCCAACAGG + Intronic
1024932974 7:54683964-54683986 CTCTGGCTCCACCATCTAATGGG + Intergenic
1025526171 7:61814323-61814345 CACTGACTCCAACAGTAAAAAGG + Intergenic
1025549563 7:62227055-62227077 CACTGACTCCAACAGTAAAAAGG + Intergenic
1026108453 7:67439228-67439250 CTCTGAATCCAGCAGGTACCTGG - Intergenic
1026678401 7:72447316-72447338 CTCTCACTCCAGCAAGAAAACGG + Intergenic
1030875677 7:114810422-114810444 CCCTGATTCCATCAGCTGAAAGG + Intergenic
1033674320 7:143522832-143522854 CTCTGACTCCAGCTGAGAAGAGG + Intergenic
1033697515 7:143806615-143806637 CTCTGACTCCAGCTGAGAAGAGG - Intergenic
1034079105 7:148260289-148260311 CTCTGACTCCAGAGACAAAACGG - Intronic
1035198691 7:157245073-157245095 CTATGATTGCATCAGCTAAATGG - Intronic
1036817000 8:11909692-11909714 CTCTGATTGCTGCAGCTAACAGG + Intergenic
1042157333 8:65858634-65858656 GTCTGACTCAAGCACATAAATGG + Intergenic
1044277315 8:90316913-90316935 CTCTTAATCCAGCAGCCAGATGG + Intergenic
1044614859 8:94129459-94129481 CTCTGATTCATGCATCTAAAGGG - Intronic
1044982898 8:97733966-97733988 CTGTAACTCCAGCTGCTAATAGG + Intergenic
1046313398 8:112468332-112468354 CTCTTACTCCAGCAGATACTGGG - Intronic
1048806921 8:138249667-138249689 CTCTGACCCCAGCAGAGAACAGG + Intronic
1049124325 8:140773288-140773310 TTCTAACTCCAGCACCTACATGG - Intronic
1050489059 9:6167998-6168020 CTCTGGCTCCAGCAGCTTCTAGG - Intergenic
1051683995 9:19638065-19638087 CTCTTTCTCCAGCAGTAAAATGG - Intronic
1051874646 9:21778317-21778339 CTTTGACACAAGCAGTTAAATGG + Intergenic
1052348888 9:27438087-27438109 CTGTGAATCCAGCTTCTAAAAGG - Intronic
1056613236 9:88138738-88138760 CACCGACTCCAACAGATAAAAGG - Intergenic
1057551176 9:96051795-96051817 CTCTTTCTCCACCAGCAAAAAGG + Intergenic
1061860851 9:133468115-133468137 CTCGGTCTCCACTAGCTAAAAGG - Intronic
1062224564 9:135442209-135442231 CTCTGATTGCTGCAGCTAACAGG + Intergenic
1062485267 9:136771350-136771372 CTCTGATTCCAGCAGCCAGCGGG - Intergenic
1187426649 X:19183373-19183395 CACTCACTCCAGCAGGTAAATGG + Intergenic
1188150146 X:26664044-26664066 ATCTGACTTCATGAGCTAAAAGG - Intergenic
1190013075 X:46802117-46802139 CTCCTACTCCAGCTGCTGAATGG - Intergenic
1193418798 X:81258093-81258115 CTCTGATTTCAGCAGTAAAAAGG - Intronic
1200947969 Y:8865144-8865166 CTCTGATTGCTGCAGCTAACAGG - Intergenic