ID: 933239385

View in Genome Browser
Species Human (GRCh38)
Location 2:79902946-79902968
Sequence AACCTTGGAATATTTACTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 183}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933239385 Original CRISPR AACCTTGGAATATTTACTCT TGG (reversed) Intronic
902267558 1:15278950-15278972 AACTTTGGAATGTTTTCCCTGGG + Intronic
907754059 1:57292746-57292768 AACCCTTGACTATGTACTCTTGG - Intronic
909687885 1:78371569-78371591 GATCTTGGAATACTTGCTCTTGG - Intronic
910031126 1:82725139-82725161 AATCAAGGAATATTTAGTCTTGG + Intergenic
910244547 1:85124494-85124516 AGTCTTGGAATATCTACTGTGGG + Intronic
910713311 1:90204019-90204041 AACCTTGAAATGTACACTCTGGG - Intergenic
911627328 1:100139489-100139511 CACTATTGAATATTTACTCTAGG - Intronic
912744021 1:112230214-112230236 AACCATGGAATATTTAGACTTGG + Intergenic
915803086 1:158815494-158815516 GCCCTTGTAAAATTTACTCTAGG - Intergenic
916520171 1:165556515-165556537 AAGCCTAGAATATTTACTATTGG - Intronic
917497570 1:175555169-175555191 ACCCATGGAATATCTCCTCTGGG - Intronic
919148288 1:193662726-193662748 ACACATTGAATATTTACTCTGGG + Intergenic
921580207 1:216887451-216887473 AAAATAGGAAAATTTACTCTTGG + Intronic
921758519 1:218885335-218885357 AACCTTGAGATTTGTACTCTTGG + Intergenic
922010099 1:221574842-221574864 ACCCTTGGAAGAATTACTATAGG - Intergenic
923196308 1:231671455-231671477 AACCTAGGAAGATTTACCATAGG - Intronic
1063734779 10:8740459-8740481 AACCTTGGTATAATATCTCTGGG + Intergenic
1066367794 10:34793480-34793502 ATCCTTAGAAAGTTTACTCTGGG + Intronic
1068079254 10:52299470-52299492 AACATTGTAATATTTACACTTGG - Intergenic
1068642913 10:59431250-59431272 AATCTTGAAATATTTAATATTGG + Intergenic
1070773680 10:79097468-79097490 AACCTTTGTTTATTTACTTTGGG + Intronic
1071710977 10:88049113-88049135 AGCATTTGAATATTTACTATAGG - Intergenic
1072381839 10:94880216-94880238 AGCCTTGCAATGTCTACTCTTGG + Intergenic
1074574814 10:114658627-114658649 AAACTTGGAATTATTACCCTGGG - Intronic
1078476014 11:11630881-11630903 AACCTTAGTCTATTGACTCTTGG + Intergenic
1078574611 11:12488895-12488917 TTCCTTGGAATTTTAACTCTGGG - Intronic
1078835855 11:15028845-15028867 CATTTTGGAACATTTACTCTAGG + Intronic
1081506303 11:43720747-43720769 AAACTTGGAAGATTTACTATAGG + Intronic
1085939391 11:81190523-81190545 AACATTGAAATATTTACTATGGG + Intergenic
1088156919 11:106817309-106817331 AAGCTTGGAGTATTTGCACTAGG + Intronic
1089439400 11:118502542-118502564 GAACTGGGAATACTTACTCTAGG + Exonic
1089699270 11:120234643-120234665 AACCTTGGAATCGCTACTCAAGG + Intergenic
1090456340 11:126852802-126852824 AACCCTGGGATCTTTGCTCTTGG + Intronic
1090524986 11:127523849-127523871 ACCCTTGGAATAATTTTTCTTGG - Intergenic
1090986915 11:131775723-131775745 ATACTTGGTATATTTATTCTAGG + Intronic
1092674066 12:10896958-10896980 ATCACTGCAATATTTACTCTTGG + Intronic
1093841586 12:23909037-23909059 AACCTTTGAATTTTTATTTTGGG - Intronic
1095535219 12:43238098-43238120 AATCTTGGAATAAATAGTCTTGG - Intergenic
1095743672 12:45633929-45633951 AACTTTGGACTGTTTAATCTGGG - Intergenic
1099731812 12:86513761-86513783 AGTCTTGGAATATTTACTTAAGG + Intronic
1100653636 12:96617659-96617681 AACCTTGGAAGATAGACTTTGGG - Intronic
1101719446 12:107338541-107338563 AACCCTGGAATATTCAGTCCAGG - Intronic
1103881369 12:124168330-124168352 TCCCTTGAAATATTTGCTCTGGG - Intronic
1107884699 13:44865742-44865764 AACCTTGGGATACTTTGTCTTGG - Intergenic
1109421645 13:62120250-62120272 CATCTTGGAATATTTATTTTTGG + Intergenic
1109487597 13:63047763-63047785 AACCCAGGAATATTTTCTCAAGG - Intergenic
1109855398 13:68120259-68120281 GACTTTGAAATATTAACTCTTGG + Intergenic
1117002629 14:51386464-51386486 TTTCTTGGAATATTTGCTCTTGG + Intergenic
1118241415 14:64062663-64062685 AAGTGTGGAATATTTATTCTGGG + Intronic
1119645315 14:76343691-76343713 CAGCTTGGAACATTTGCTCTTGG - Intronic
1119803402 14:77465410-77465432 CCCCTTGGAATAATTACCCTTGG + Intronic
1120787832 14:88552858-88552880 AATCCTTAAATATTTACTCTTGG - Intronic
1126962808 15:54016637-54016659 AACTTTGGATTATATACTTTTGG + Intronic
1127947941 15:63773859-63773881 AACATTTGAATTTTTATTCTTGG + Intronic
1130675689 15:85950034-85950056 TACCTTGGTATATTTTCACTTGG - Intergenic
1132370301 15:101292970-101292992 AACACTGCAACATTTACTCTAGG + Intronic
1134843186 16:17417837-17417859 CCTCTTAGAATATTTACTCTGGG + Intronic
1135257865 16:20955662-20955684 AACCCTGAAATATTTACTATTGG + Intronic
1135300688 16:21324281-21324303 AACCTAGGAGTATTTTCCCTAGG + Intergenic
1135640431 16:24115244-24115266 ATCCTTGGGATAAATACTCTTGG - Intronic
1140203581 16:72914548-72914570 AACCTGCAAATATTTACTCATGG + Intronic
1140683085 16:77404499-77404521 AATCTTAGAAAATTTACTATGGG + Intronic
1140971315 16:80015600-80015622 GACCTTGGAGTTTTTGCTCTTGG - Intergenic
1144470283 17:15533829-15533851 AACATTGAAATTTTTAATCTAGG + Intronic
1149296121 17:55264249-55264271 ATTTTAGGAATATTTACTCTGGG - Intergenic
1154472559 18:14719229-14719251 AACCCTTGAATATTCTCTCTAGG - Intergenic
1155420644 18:25651970-25651992 CCTCTTGGAATATTTGCTCTTGG - Intergenic
1155764248 18:29607318-29607340 GCTTTTGGAATATTTACTCTTGG + Intergenic
1159296983 18:66504665-66504687 AACCATGGAGTATTTACTCCAGG + Exonic
1159379776 18:67641785-67641807 AAGATTAAAATATTTACTCTGGG + Intergenic
1160197028 18:76764292-76764314 AAGCTTGAAACATTTACTATTGG - Intergenic
1162338157 19:10074276-10074298 TCTCTTGGAATATTGACTCTTGG - Intergenic
1166911231 19:46159621-46159643 AACCATGGAATATTTGAACTTGG + Intronic
925683510 2:6448036-6448058 TACTTTGCATTATTTACTCTAGG - Intergenic
927020526 2:19012058-19012080 AATCTTGGAATAGTTATCCTAGG + Intergenic
928286727 2:29996507-29996529 AACCAGGGAATATTTATTCAAGG + Intergenic
931590006 2:63872412-63872434 AACATTTGAATATTTACTGTGGG + Intronic
932977557 2:76622604-76622626 GATCTTGGAATATTTTCTGTGGG + Intergenic
933060411 2:77729726-77729748 TACATTAGAATATTTACTCCAGG + Intergenic
933239385 2:79902946-79902968 AACCTTGGAATATTTACTCTTGG - Intronic
933906626 2:86900318-86900340 TACCTTGGTATAATTTCTCTTGG - Intergenic
934024847 2:87993317-87993339 TACCTTGGTATAATTTCTCTTGG + Intergenic
934158663 2:89227494-89227516 AACTTTGGATTATTCTCTCTCGG + Intergenic
934208611 2:89954933-89954955 AACTTTGGATTATTCTCTCTCGG - Intergenic
936365542 2:111851364-111851386 CACCTTGGTATAATTTCTCTTGG + Intronic
936959793 2:118061174-118061196 AATCTTGGAATACTCTCTCTGGG - Intergenic
937698852 2:124840401-124840423 GAGCCTGGAATATTTTCTCTGGG + Intronic
939088181 2:137746877-137746899 AACCTTGCAGTATTTTCTCTAGG + Intergenic
941900141 2:170670242-170670264 AAGCCTAAAATATTTACTCTTGG + Intergenic
942563196 2:177242238-177242260 AACCTGGCAACATTTACACTTGG - Intronic
942728356 2:179035727-179035749 AAACTTGGAATTGTAACTCTGGG - Intronic
942772431 2:179537975-179537997 AACCATGGAAAATTTCATCTTGG + Intronic
945630586 2:212270649-212270671 GGCCTTGAAATATTTACTCTTGG + Intronic
947484371 2:230534510-230534532 GAACTTGAAATTTTTACTCTTGG - Intronic
948647632 2:239417324-239417346 AAGCTTGGAATATTTAACATTGG + Intergenic
1171315694 20:24192104-24192126 AACCTTGTATTTTTTACTTTAGG + Intergenic
1176801931 21:13438664-13438686 AACCCTTGAATATTCTCTCTAGG + Intergenic
1181333634 22:22114192-22114214 AACTTTTGAATATTTACGCAAGG + Intergenic
952007301 3:28856724-28856746 AAGCCTAAAATATTTACTCTAGG + Intergenic
952278208 3:31898085-31898107 AATATTGGAATCTTTAGTCTGGG + Intronic
956599512 3:71004800-71004822 AGCTTTGGAATATTTTCTTTTGG + Intronic
956670814 3:71687816-71687838 AACTTGGGAATACTTACACTAGG + Intronic
956981530 3:74644464-74644486 ATCCTTAGAATACTTTCTCTGGG - Intergenic
957305267 3:78449683-78449705 AACCTGAGAATATGTACTCAAGG - Intergenic
958745841 3:98133021-98133043 AACCACGGAATGTTTTCTCTTGG + Exonic
958747089 3:98149709-98149731 AACCACGGAATGTTTTCTCTTGG + Exonic
958882401 3:99687558-99687580 CACCTAGGAATATATACACTAGG + Intronic
960446996 3:117761363-117761385 AACCTTAGAATAATTGGTCTTGG + Intergenic
960876114 3:122296578-122296600 AACTTTGAAATCTCTACTCTTGG - Intergenic
962506553 3:136052077-136052099 AACATAGGAATATTTAATGTTGG - Intronic
962846032 3:139274732-139274754 CATCTTGGAACATTCACTCTTGG + Intronic
964986984 3:162754310-162754332 ATCCTTTGAATATTTTCTGTGGG - Intergenic
965023895 3:163273117-163273139 AAACTTGGAGAATTAACTCTCGG + Intergenic
965253490 3:166372538-166372560 AACCTCTGAATATTTAGTCAAGG + Intergenic
965351293 3:167614416-167614438 AACCTTGGAAACTGTAGTCTGGG - Intronic
965416979 3:168408119-168408141 AACCTTGTAATATTATTTCTAGG - Intergenic
965912912 3:173803319-173803341 AACATTTCAATATTTACCCTGGG + Intronic
967575697 3:191088909-191088931 AAAATTGGAATATTTAGTCTAGG - Intergenic
967643260 3:191894314-191894336 ATCCTTGGTATATTTCCTATGGG + Intergenic
967882378 3:194310872-194310894 AATCTTGGAAGATTAAATCTTGG - Intergenic
968152796 3:196351945-196351967 AAGCTAGGAATCTTTACTCCAGG + Exonic
969186504 4:5478631-5478653 ATCCTTGGAGTGTTTTCTCTGGG - Intronic
969629561 4:8328499-8328521 AACCTTGGAATGTCTGTTCTAGG - Intergenic
970049263 4:11895216-11895238 ATCATTGGCATATTTTCTCTTGG + Intergenic
970720618 4:18984473-18984495 TTCTTTGGAATATTTTCTCTAGG + Intergenic
972113936 4:35603989-35604011 AACCTTGAAAAATTTACCTTTGG + Intergenic
972144056 4:35999372-35999394 AACTTAGAAATATTTATTCTAGG - Intronic
980420657 4:132555835-132555857 AACCTTGGGAGATATTCTCTAGG + Intergenic
980621635 4:135314332-135314354 TACCTTGTATTATTTACTCTTGG + Intergenic
983097615 4:163582963-163582985 GACGTTGGAATACTTTCTCTAGG + Intronic
984676500 4:182554295-182554317 AAAGTTGGAATATTTAAACTGGG - Intronic
986292253 5:6409753-6409775 AACCTTGCAATATCTCCTTTAGG + Intergenic
987742542 5:21928699-21928721 GAGCTTTGCATATTTACTCTTGG + Intronic
990480067 5:56201698-56201720 ACACTTTGAATATTTACTCTGGG - Intronic
990645468 5:57838784-57838806 ACTCTAGGCATATTTACTCTTGG - Intergenic
993698447 5:91090575-91090597 AACCCTGGAAAATATACTCTAGG + Intronic
995527065 5:113058698-113058720 AACATTGGGTAATTTACTCTGGG - Intronic
997898604 5:137742517-137742539 ATTCCTTGAATATTTACTCTGGG + Intergenic
998379917 5:141717013-141717035 ATTCCTGGAATATTTACTCTGGG + Intergenic
999943185 5:156567121-156567143 TACTTTGAAATATTTTCTCTTGG + Intronic
1000802109 5:165740501-165740523 AACACTGGCATATTTATTCTAGG + Intergenic
1001070038 5:168578165-168578187 ATGCTTGGAAAAGTTACTCTGGG + Intronic
1002623122 5:180504419-180504441 AGCCATTCAATATTTACTCTAGG - Intronic
1004660472 6:17705812-17705834 CCCCTTGGAATCTTAACTCTGGG - Intronic
1005159937 6:22847643-22847665 CAGCCTGAAATATTTACTCTTGG - Intergenic
1005336143 6:24798415-24798437 CACCTTGAAATACTCACTCTTGG - Intronic
1008228693 6:48956170-48956192 AACCTTGGAGTAATTGCTTTAGG - Intergenic
1008676017 6:53819493-53819515 AAACTTAAAATATTTAGTCTTGG + Intronic
1008916631 6:56794865-56794887 AATCTTGGGATCTTTTCTCTTGG - Intronic
1009805220 6:68593581-68593603 AATCTTGGAAGGTTTAATCTTGG + Intergenic
1010340432 6:74744660-74744682 AACTTTGGAAAATATACTTTTGG - Intergenic
1011178598 6:84593053-84593075 AACCTTTGAGTTTCTACTCTAGG - Intergenic
1013107162 6:107035425-107035447 AAACTTTGAATAATGACTCTAGG + Intronic
1014338719 6:120174829-120174851 AACTTTAGAAAATTTATTCTCGG - Intergenic
1015216517 6:130756295-130756317 TTCCTTGGATTATTTGCTCTGGG + Intergenic
1018999893 6:168741217-168741239 AATCTTGGAATTTATACTTTTGG + Intergenic
1019038615 6:169084106-169084128 TACCTTGTAATAGTCACTCTAGG - Intergenic
1020698148 7:11442048-11442070 AAATTTTGTATATTTACTCTTGG - Intronic
1023354202 7:39350916-39350938 AAACTTGGAAAATCTTCTCTTGG - Intronic
1023594264 7:41812404-41812426 ACCCTTGGAATCTCTATTCTAGG + Intergenic
1024878829 7:54060889-54060911 AAGAGTGGCATATTTACTCTGGG - Intergenic
1026922876 7:74169453-74169475 AAGCCTGGAATATCCACTCTGGG + Intergenic
1027463400 7:78483918-78483940 CACCTTGGAATCTTTCCTCAAGG - Intronic
1027893906 7:84015764-84015786 AACCTTTTAACATTTGCTCTGGG + Intronic
1028124958 7:87102331-87102353 ATCCTTAGACTATTTTCTCTAGG + Intergenic
1028756959 7:94447819-94447841 AACTTTGGAATATATACTTCTGG + Intergenic
1028776285 7:94680931-94680953 AACCGTGGACTATTTCTTCTTGG - Intergenic
1030367667 7:108663768-108663790 AACCTTGAAATATCCACTGTGGG - Intergenic
1031199057 7:118654524-118654546 AATGCTGTAATATTTACTCTAGG + Intergenic
1032218764 7:129978095-129978117 ATCCTTGGAATAGTTAATATTGG + Intergenic
1033981872 7:147175187-147175209 AATCTTGGAAGATTTAATCCTGG - Intronic
1034162178 7:149001888-149001910 AAGCCTGGAACATTTACTCCTGG + Intergenic
1034284631 7:149876410-149876432 AAACTTGGAATAGGTACCCTGGG + Intronic
1035637079 8:1155458-1155480 AACCTTAGAAAATTCACTCTCGG + Intergenic
1037751515 8:21685351-21685373 AGCCTTGGAAAGTTTGCTCTAGG - Intergenic
1037892551 8:22631026-22631048 AAGCCTGAAATATTTACTGTTGG - Intronic
1039165458 8:34674538-34674560 AACCTTGGAACATTTAAAATTGG - Intergenic
1040544790 8:48390432-48390454 AGCCTTGGAATCTTGACACTGGG + Intergenic
1041008560 8:53519174-53519196 AACCTTGGAATCTGCACTCTTGG + Intergenic
1043724613 8:83594579-83594601 ATCTTTGGCATATTTTCTCTTGG - Intergenic
1045316789 8:101050076-101050098 TGCCTTGAAATATTTATTCTTGG - Intergenic
1046783143 8:118237212-118237234 AACCTTGGATAAATTACTCTAGG + Intronic
1047381297 8:124366270-124366292 CCCCTTGGAACATTTTCTCTGGG + Intronic
1049126571 8:140794636-140794658 AACCTTGTACTATATTCTCTTGG + Intronic
1049938961 9:526397-526419 AACCCTTGAATATTGGCTCTAGG + Intronic
1050331543 9:4550826-4550848 AAACCTAGAATATTTACTATTGG - Intronic
1050682180 9:8124456-8124478 AACATTGGAATATTTAATAATGG + Intergenic
1051349491 9:16185513-16185535 TACCTTGGATTACTCACTCTGGG - Intergenic
1051350143 9:16191385-16191407 AAACTTGGGAAATTTCCTCTGGG - Intergenic
1055700305 9:78937749-78937771 ATCCTTGGAAAATTCATTCTAGG - Intergenic
1059752264 9:117258919-117258941 TACCTTTGTATATCTACTCTAGG - Intronic
1060162775 9:121381597-121381619 ACCCTTGAAATATTTTTTCTTGG + Intergenic
1186573535 X:10741150-10741172 AACCTTGGACTATTAAAGCTAGG + Intronic
1186640186 X:11447582-11447604 AAGCTGAAAATATTTACTCTCGG + Intronic
1187286622 X:17911103-17911125 AACCATGTTATATTTAATCTGGG + Intergenic
1187407247 X:19015153-19015175 ACCCAGGGAATATTTACTCAAGG + Intronic
1188198288 X:27265966-27265988 AATCTTGGAATATTTTCTGATGG + Intergenic
1188535267 X:31190113-31190135 AACATTGTTATATTTCCTCTGGG - Intronic
1190790216 X:53692705-53692727 AACCTAGGTATCTTAACTCTAGG + Intergenic
1195305391 X:103576980-103577002 ATTTTTGGAATATTCACTCTTGG - Intronic
1198037588 X:132816987-132817009 AACCTTGGAACATGTAATCAAGG + Intronic
1199002117 X:142651232-142651254 AACCTTGGTTTATTTACCCTAGG + Intergenic