ID: 933239766

View in Genome Browser
Species Human (GRCh38)
Location 2:79907152-79907174
Sequence ATGTTCTGCTTTAAGATTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 296}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933239766_933239768 8 Left 933239766 2:79907152-79907174 CCTGAAATCTTAAAGCAGAACAT 0: 1
1: 0
2: 2
3: 29
4: 296
Right 933239768 2:79907183-79907205 CATTATGTTTTATGTTAATATGG 0: 1
1: 0
2: 2
3: 41
4: 476
933239766_933239769 24 Left 933239766 2:79907152-79907174 CCTGAAATCTTAAAGCAGAACAT 0: 1
1: 0
2: 2
3: 29
4: 296
Right 933239769 2:79907199-79907221 AATATGGTTTTCTATAAAATAGG 0: 1
1: 1
2: 4
3: 62
4: 700

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933239766 Original CRISPR ATGTTCTGCTTTAAGATTTC AGG (reversed) Intronic
902931035 1:19731712-19731734 TTGTTCTGCTTTGTGCTTTCTGG + Intronic
905837975 1:41145682-41145704 ATGTTCTGCATAATGATGTCTGG + Intronic
907577700 1:55542402-55542424 ATGATCTGATTTAAGATCACTGG - Intergenic
912323234 1:108734123-108734145 ATTTTCTGCTTTGAGATTTAGGG + Intronic
914727988 1:150344457-150344479 CTGTTCTGCTGTGAGTTTTCGGG - Exonic
915582907 1:156825996-156826018 ATGGTCTGGTTTCAGATTTTGGG + Intronic
916375989 1:164153500-164153522 ATGTTATTCTTCAAGGTTTCTGG + Intergenic
917778912 1:178369943-178369965 TAGTTCTACTTTAAGATGTCAGG + Intronic
918912992 1:190597465-190597487 AATTTCTGCTTTAAAATTGCTGG + Intergenic
919323868 1:196080870-196080892 ATGTAAAGCTTTAAAATTTCTGG + Intergenic
919502810 1:198358946-198358968 ATGTTCTGATTAAAAATTTGTGG - Intergenic
920577537 1:207072500-207072522 ATGTTCTGTGTTAAGATTAATGG - Exonic
921835866 1:219777776-219777798 ATTTTCTACTTTAATACTTCTGG - Intronic
922171343 1:223158333-223158355 AGATTCTGCTTTAACATTTTTGG + Intergenic
922382806 1:225049647-225049669 ATTTTCTCCTTGAAGATTTATGG + Intronic
922941253 1:229468835-229468857 TTGTTTTTCTTTCAGATTTCTGG + Intronic
923965785 1:239137231-239137253 ATCTTTTCCTTTAAGATTTTAGG + Intergenic
924079459 1:240378847-240378869 ATGTTTTTCTTTAATATTTGAGG + Intronic
924481274 1:244436719-244436741 GTCTTATGCTTTAAAATTTCGGG - Intronic
1063984376 10:11485961-11485983 ATGTTGTGTTTTAAGATTGGAGG - Intronic
1064826162 10:19403845-19403867 ATGTTCTGCCTTATAATTTGGGG - Intronic
1066075777 10:31875029-31875051 ATGGTCTTCTGTAAGTTTTCTGG - Intronic
1067904337 10:50275189-50275211 ATGTTCTGGTTTAAGAAATTAGG - Intergenic
1068224310 10:54086759-54086781 ATGTTCTGCTTTAGCTTTCCTGG + Intronic
1068287438 10:54958796-54958818 AAGTTTTGCTTTAAGTATTCTGG - Intronic
1068799417 10:61122484-61122506 AAATTCTGCTTTAAGTTTTAGGG - Intergenic
1072181111 10:92981164-92981186 TTCTTCTGGTTTAAGTTTTCTGG - Intronic
1072711061 10:97715671-97715693 GTGTTCTGTTTGAAGATTTGGGG + Exonic
1072836687 10:98722432-98722454 ATGCTCTGGTTTCAGATTTCTGG + Intronic
1074647811 10:115483012-115483034 ATGGTATGTTTTAACATTTCTGG + Intronic
1076576930 10:131475543-131475565 ATGTTCTCCTTTCGGATTTCGGG - Intergenic
1079942219 11:26695531-26695553 ATGTTTTACATTATGATTTCAGG - Intronic
1080818577 11:35782981-35783003 ATGTTCAGCTTTGTGATTTTAGG - Intronic
1080997498 11:37621736-37621758 ATGTTCTGCTTCAGGAGTTTGGG - Intergenic
1081962682 11:47149877-47149899 AACTTCTGCTTGAACATTTCTGG + Intronic
1082961755 11:58924518-58924540 ATGTTTCCCTTTAATATTTCTGG + Intronic
1083536418 11:63471758-63471780 AAATTCTGATTTAAGATTACAGG + Intronic
1085971808 11:81600876-81600898 ATGTCATTCTTTAAGAGTTCAGG + Intergenic
1086163026 11:83744623-83744645 ATCATCTGCTTTCAGAATTCTGG + Intronic
1086948779 11:92870036-92870058 ATGTGTTGCTCTAAAATTTCAGG + Intronic
1088198449 11:107302502-107302524 ATGTTCTTATTTACTATTTCAGG - Intergenic
1090371224 11:126254495-126254517 ATGTTCCCCTTTAAGATCTATGG - Intronic
1093107302 12:15104020-15104042 ATGTCCTTCTTTAACCTTTCTGG + Intergenic
1093475528 12:19550220-19550242 ATGTTGTTCTTTCAGACTTCTGG - Intronic
1093603971 12:21067091-21067113 ATTCTATGCTTTATGATTTCAGG - Intronic
1095185767 12:39198970-39198992 TTATTCTGCTTTAAGTTTTAGGG - Intergenic
1095370192 12:41458017-41458039 ATGTTCTTCATGAAGTTTTCTGG - Intronic
1095535302 12:43239076-43239098 GAGTTCTGTTTTAACATTTCTGG + Intergenic
1096608561 12:52785834-52785856 AAGTTGTGTTTTTAGATTTCAGG - Intergenic
1099359574 12:81683498-81683520 GTGTTTTGTTTTAAGATTGCTGG - Intronic
1099373497 12:81866863-81866885 ATATTCTTCTTTAAGATTTTTGG + Intergenic
1099517126 12:83610720-83610742 GTCTTCTGCTTCAGGATTTCAGG - Intergenic
1099657374 12:85510220-85510242 ATGTTCTATTTTAAGATTAACGG + Intergenic
1099898684 12:88681046-88681068 CTGGTCTGATTTAGGATTTCTGG + Intergenic
1100060009 12:90563634-90563656 AAGCTCTGCTTTAAGATTAAAGG + Intergenic
1100846359 12:98662219-98662241 ATGTTCTGATTTAGGGTTTGAGG + Intronic
1106120182 13:26853413-26853435 ATCTTGTGCTTTATGATTCCAGG + Intergenic
1106818376 13:33435124-33435146 ATATTTGGCCTTAAGATTTCAGG - Intergenic
1107964083 13:45584177-45584199 ATGCTCTGCATTAGAATTTCTGG + Intronic
1108312746 13:49211947-49211969 AAATTCTGTTTGAAGATTTCTGG - Intergenic
1109210629 13:59531455-59531477 AAGTTCTGCTTTAATTATTCTGG - Intergenic
1109803498 13:67406030-67406052 AAGTTTTCCTTTAACATTTCAGG - Intergenic
1109918412 13:69022751-69022773 ATCTTCTGATTTATTATTTCTGG - Intergenic
1111003038 13:82210273-82210295 ATGTTCTGTTTTGAAATTCCGGG - Intergenic
1111574191 13:90128908-90128930 ACTTTCTGTTTTAAGATTTGGGG + Intergenic
1111836951 13:93400038-93400060 ATATTCTGATTGAACATTTCAGG + Intronic
1112398728 13:99057335-99057357 GTTTTGTGCTGTAAGATTTCAGG - Intronic
1112689132 13:101870111-101870133 ATTTTCTGCTATAGGATTTTAGG + Intronic
1112950421 13:104988818-104988840 TTGTTCTGCTTTAGGTGTTCTGG + Intergenic
1115354039 14:32428142-32428164 TTATCCTGCTTTAAGATTGCTGG + Intronic
1115708254 14:36020605-36020627 ATTTGCTGCTTTAAATTTTCTGG + Intergenic
1116373815 14:44171734-44171756 ATGTTATGCTTTAAGTTCTAGGG + Intergenic
1116832468 14:49735575-49735597 ATGTATTACTTTAACATTTCTGG + Intronic
1118402475 14:65392469-65392491 CTTATCTGCTTTAAAATTTCTGG + Intergenic
1119128841 14:72153307-72153329 ATGTTCTGCTTTAAACTCTGTGG - Intronic
1122581085 14:102772032-102772054 ATGTTCTCCCAAAAGATTTCGGG + Intergenic
1125128012 15:36247732-36247754 ATGTTCTGAATTAAGAATCCTGG + Intergenic
1125653972 15:41340809-41340831 ATGCTCTGCATCAAGATATCAGG - Intronic
1126658409 15:51006192-51006214 ATGTTCTGCTTTAAATGCTCTGG - Intergenic
1126669104 15:51100211-51100233 ATGTTGTGATTTAAGTTTTGAGG + Intronic
1127199374 15:56626537-56626559 ATGCTTTACTTTAATATTTCGGG + Intergenic
1127613736 15:60662609-60662631 AGGTTCTTCGTTAGGATTTCTGG - Intronic
1128088229 15:64900379-64900401 ACCTTTTACTTTAAGATTTCTGG - Intronic
1128625945 15:69203656-69203678 ATGATCTGCTTCAAGAATTTAGG - Intronic
1129309708 15:74697852-74697874 TTGTTGTGATTTAAGAGTTCTGG + Intergenic
1129625297 15:77191702-77191724 CTATTGTGCTTTAAGAATTCAGG + Intronic
1129657500 15:77533867-77533889 ATCTTGTGCTTTAAGCTTCCAGG - Intergenic
1130160771 15:81397791-81397813 ATGTCCTGCCTTTAGATATCAGG - Intergenic
1130768003 15:86892512-86892534 ATGTGCAGCTTTAAGATATTGGG + Intronic
1135286156 16:21195005-21195027 AAGTTCTGCTTTAGCATTTTTGG + Intergenic
1136901902 16:34049700-34049722 CTGTTTTGCTTTAAGTTGTCAGG - Intergenic
1137350617 16:47711230-47711252 CTGTTTAGTTTTAAGATTTCTGG + Intergenic
1137448378 16:48547246-48547268 ACTTTATGTTTTAAGATTTCTGG + Intronic
1138262083 16:55631107-55631129 AGGTTTTGTTTTAAGATTTTGGG - Intergenic
1138364450 16:56462536-56462558 AAATTCTGTTTGAAGATTTCCGG + Exonic
1139815781 16:69669994-69670016 AAGCTTTTCTTTAAGATTTCTGG - Exonic
1140089766 16:71828164-71828186 CTGCTCTGCTTTCAGATTGCTGG - Intergenic
1144358203 17:14466241-14466263 ATGTCCTGGTTAAATATTTCTGG + Intergenic
1144433778 17:15220952-15220974 CTGCTCTGCTTTCAGACTTCAGG - Intergenic
1144637204 17:16917835-16917857 ATGTTCTGCTTCATGATCTGGGG + Intergenic
1146195402 17:30808216-30808238 ATGTTCTGATTTAGCAGTTCTGG - Intronic
1146776897 17:35627386-35627408 ATTTCCTGCTTCAAGATTTCAGG - Exonic
1148034587 17:44649371-44649393 ATGTTCTGCTTTTCCCTTTCTGG - Intergenic
1149724040 17:58874125-58874147 ATGCTCTGCTTTTAGATAGCTGG - Intronic
1151794055 17:76330666-76330688 ATTTTTTGTTTTAAAATTTCAGG - Exonic
1153184749 18:2473634-2473656 GTGTCTTCCTTTAAGATTTCAGG - Intergenic
1154246207 18:12702139-12702161 ATATTCTGCTGTAAGATATCAGG - Intronic
1155078245 18:22381983-22382005 AAGCTCTGCTTTAAGATATCTGG + Intergenic
1155312749 18:24540486-24540508 ATGTACTGCTTTTAGAATTGTGG + Intergenic
1155357947 18:24971779-24971801 ATTTTCTACATTGAGATTTCTGG - Intergenic
1155416642 18:25605878-25605900 ATGTTCTGCTGAGAGAGTTCAGG + Intergenic
1156974486 18:43201692-43201714 ATATTCTTCTTTAAAAATTCTGG + Intergenic
1157004567 18:43566554-43566576 ATGTTCTGTTTGAAGCATTCGGG - Intergenic
1157056236 18:44232323-44232345 CTGTTTTGCTTTAAAACTTCAGG - Intergenic
1157495027 18:48150700-48150722 ATTCTCTGCTTTGAGATTCCCGG - Intronic
1159146722 18:64463807-64463829 ATGGTCTGCATAAAGATTTTAGG - Intergenic
1159739272 18:72145080-72145102 ATCTTCTGCTGAAATATTTCTGG - Intergenic
1160126532 18:76178032-76178054 ATCTACAGTTTTAAGATTTCTGG + Intergenic
1162987982 19:14284040-14284062 ATGTTTTGATTTCAGACTTCTGG - Intergenic
1163924497 19:20326811-20326833 TTTATCTGCTTTAGGATTTCAGG - Intergenic
1164795771 19:31027305-31027327 ATCTTCTTCATTAAGGTTTCTGG + Intergenic
1165354500 19:35295433-35295455 CTGTTCTGGATTATGATTTCAGG + Exonic
1165485556 19:36093415-36093437 ATGTTCTGGTTTTTGATTTGAGG + Intronic
925457823 2:4031392-4031414 ATATTCTTCTTTAAAATTTTGGG - Intergenic
925465303 2:4102615-4102637 AAGTTCTGCTTTCTGATTTCTGG + Intergenic
927260898 2:21088928-21088950 ATTTTTCACTTTAAGATTTCTGG + Intergenic
928812981 2:35252226-35252248 ATTCTGTGCTTCAAGATTTCAGG - Intergenic
929244170 2:39684172-39684194 ATCTTGTGGTTTAAGATTTAGGG + Intronic
929391187 2:41470941-41470963 ATTTTCTGCCTTAAGATCTGTGG + Intergenic
929514018 2:42589914-42589936 AAGTTCTGCAGTAAGATTTAGGG + Intronic
930912319 2:56643977-56643999 ATGCTTTGCTTTCAGACTTCTGG + Intergenic
931474350 2:62572109-62572131 GTGTCCTGCTTTAACATTCCTGG + Intergenic
931587646 2:63845678-63845700 ATGTACTGTATTAGGATTTCTGG + Intronic
931809210 2:65838102-65838124 ATGTTCTGCCCTCAGATTTCAGG + Intergenic
931898524 2:66761400-66761422 ATGTTTTGTTTTATGAATTCAGG - Intergenic
931908634 2:66870093-66870115 ATGGTCAGCGTGAAGATTTCAGG + Intergenic
932911854 2:75814646-75814668 ATGTTCTGGTTTTATATTGCTGG - Intergenic
933095615 2:78175246-78175268 ATTTTCTGCTGAAAGATGTCAGG - Intergenic
933239766 2:79907152-79907174 ATGTTCTGCTTTAAGATTTCAGG - Intronic
933448082 2:82408429-82408451 ATGTTCTGCTTTAAATATTGAGG + Intergenic
933569542 2:83993325-83993347 ATGTTGATTTTTAAGATTTCAGG - Intergenic
934964505 2:98708432-98708454 ATGTTAGACTTTAGGATTTCAGG - Intronic
935137344 2:100319439-100319461 ATGTTCTGTTTCATGATTTAGGG - Intronic
935156664 2:100489062-100489084 ATGTTCTTCTTCAACATCTCTGG + Intergenic
935225221 2:101047027-101047049 CTTTTCTGTTTTGAGATTTCAGG + Intronic
936411774 2:112265145-112265167 CTTTTCTGCTTTAACATTTTGGG - Intergenic
937375027 2:121330347-121330369 ATGTTCTGCTTTGTAATTTGGGG - Intergenic
938949198 2:136241606-136241628 ATGTTCTGCTCTGTGATCTCTGG + Intergenic
939299551 2:140317847-140317869 GTGTTGTACTTTAAAATTTCTGG - Intronic
940212701 2:151272522-151272544 ATGTTCTATTTTAATATTTTGGG - Intronic
940467169 2:154045798-154045820 TTCCTCTGCTTTAAGGTTTCTGG - Intronic
940521014 2:154747957-154747979 ATGTTCTTCCTCAAGTTTTCTGG + Intronic
941147349 2:161866017-161866039 GTGTTCTGTTTTAAAGTTTCTGG - Intronic
941836071 2:170022195-170022217 ACCTTCTACTTTAAGGTTTCAGG - Intronic
942484767 2:176427266-176427288 TTGTTGTGCCTTAAGATTTCTGG - Intergenic
942868551 2:180707108-180707130 AAATTCTGCTTTAGGGTTTCAGG + Intergenic
945052461 2:205836925-205836947 AGGTTCTGATTTAATATGTCTGG + Intergenic
946068761 2:217012907-217012929 ATGTTCTGATTTAAGAGTATGGG + Intergenic
948134156 2:235623444-235623466 ATTTGCTGCTTCAAGGTTTCAGG + Intronic
1169543228 20:6623474-6623496 ATGCACTGCTTGAATATTTCTGG + Intergenic
1169642104 20:7764124-7764146 AAGTTTTGCTTTATGTTTTCTGG - Intergenic
1169907841 20:10621264-10621286 ATGTTCAGCTAATAGATTTCTGG + Intronic
1170132736 20:13040129-13040151 ATCTTCTTATTTAACATTTCTGG + Intronic
1170371739 20:15656331-15656353 ATTTCCTGCTTAAAGATTGCAGG - Intronic
1171910915 20:30951648-30951670 TTTTTATGCTTTAAGATTTAAGG - Intergenic
1171948435 20:31399284-31399306 ATATTCTGCTGTAATATTTGGGG + Intergenic
1177382560 21:20364522-20364544 ATGGTCTGCTCTAAGATTTATGG - Intergenic
1177650014 21:23948601-23948623 ATGTTCTGCTTTAAAAAATGTGG + Intergenic
1177694382 21:24553396-24553418 ATGTTCTCTTTGATGATTTCAGG + Intergenic
1178182215 21:30174691-30174713 AGGTTCTGCTTTAATAGATCTGG - Intergenic
1203289363 22_KI270735v1_random:18489-18511 ATGTTTTGCTTTAAGTTGTTAGG + Intergenic
949165819 3:939529-939551 ATGTTCTGCTTTTAGCTTTATGG - Intergenic
949171499 3:1004284-1004306 AATTTCTGTTTTAAGATTTCTGG + Intergenic
949205072 3:1428242-1428264 ATGTTCTGCTTTATTATTTTAGG - Intergenic
949399294 3:3648755-3648777 AGGTTCTGCAAAAAGATTTCAGG - Intergenic
949863012 3:8523657-8523679 CGGTTCTGCTTTAAGATTGGAGG + Intronic
951146312 3:19231914-19231936 ATGTATTGATTTAATATTTCAGG - Intronic
951981492 3:28572045-28572067 ATATTCTGATTTAAGTTTTCTGG + Intergenic
953054665 3:39378437-39378459 AAATTCTGCTTTGAGATTTTTGG + Intergenic
953662252 3:44899770-44899792 ATGTTCTGGCTGAAGATCTCTGG + Intronic
954487325 3:50865214-50865236 ATGTTGTGCTTTCAAATTTTAGG + Intronic
956067615 3:65413677-65413699 TTGTTCAGCTATTAGATTTCAGG + Intronic
956849592 3:73216801-73216823 ATGTTCTCCTTCCAGATCTCCGG - Intergenic
957136991 3:76301136-76301158 ATGTCCTTCCTTTAGATTTCTGG - Intronic
959005051 3:101010588-101010610 ATTTTGTGCTTTAAGTTTTTAGG - Intergenic
959911468 3:111768541-111768563 ATGATCTGCTATAAGATTTCAGG + Intronic
960568462 3:119161208-119161230 ATGTTCTGCTTTAAGAAACATGG - Intronic
961232676 3:125332052-125332074 ATATTCTGCTTTTACATTTATGG - Intronic
962379313 3:134884305-134884327 ATGTACTGCTGGAAGAATTCTGG + Intronic
963419237 3:145038617-145038639 TTGTTTTGTTTTAAGCTTTCAGG - Intergenic
963526231 3:146417897-146417919 ATGTACTGCTTTACAATTTCTGG + Intronic
966101445 3:176273934-176273956 ATGTGCTGCTTTAATAATTAGGG - Intergenic
967183357 3:186925727-186925749 ATGTTCTACTCTGAGGTTTCTGG + Intergenic
971027723 4:22605183-22605205 ATGTTCTTCTATACGATGTCTGG - Intergenic
971877150 4:32322106-32322128 ATCTTTTGGTTTAAAATTTCCGG - Intergenic
973684425 4:53354744-53354766 AAATTCAGCTTTAAAATTTCAGG - Intronic
973900331 4:55463012-55463034 ATGTACTGCTGTAACAATTCTGG + Intronic
975105121 4:70559168-70559190 ATTTTCTCCTTTAAACTTTCTGG + Intergenic
975992371 4:80269840-80269862 ATTTTCTGCTTTGTGATATCTGG + Intronic
976116159 4:81729584-81729606 TTGTTCTGGTTAGAGATTTCTGG + Intronic
976485080 4:85592392-85592414 ATATTCTGGTTTAATAATTCTGG + Intronic
977095027 4:92731036-92731058 ATGTGGTGGTTTAAGCTTTCAGG + Intronic
977144004 4:93412385-93412407 TTGTTTTGCTTTAAGATATGGGG - Intronic
977571210 4:98631642-98631664 TTGTTCTGTTTTAAGACCTCAGG + Intronic
978082008 4:104605282-104605304 TTCTTCTGTTATAAGATTTCTGG + Intergenic
978966995 4:114752350-114752372 ATTTTCATCTTTAAAATTTCAGG - Intergenic
979467985 4:121062437-121062459 ATGTTCTGCATTATTATTTCTGG + Intronic
981982928 4:150817551-150817573 ATTTTCTGCTTTAATACTTTTGG - Intronic
982271161 4:153590302-153590324 ATGTTCTGGTTAAATGTTTCTGG + Intronic
982824549 4:159985920-159985942 ATGTTATATTTTCAGATTTCTGG + Intergenic
982980444 4:162127356-162127378 TTGTTCTGTTTTAAAATTGCTGG + Intronic
983813623 4:172095640-172095662 ATGCTCTGCTTTATGATGTTGGG - Intronic
983963392 4:173781087-173781109 ATGTTATACTTTAAGTTTTAGGG - Intergenic
984197234 4:176672861-176672883 ATGTTCAGCTTTAATATTAGTGG + Intergenic
984260368 4:177437452-177437474 ATATCCTGCTTTAAGATACCAGG + Exonic
987576464 5:19734654-19734676 ATGTTCTCCTTTAATGTTTAGGG + Intronic
987788936 5:22538425-22538447 ATTATCTGCTGTAAGATATCAGG - Intronic
988013700 5:25525966-25525988 ATGATGTACTTTGAGATTTCTGG - Intergenic
989667359 5:43871323-43871345 ATTTTAGGCTTTAAGATTTTTGG + Intergenic
990066353 5:51720228-51720250 ATGTTCTACATTAAGATTCAGGG + Intergenic
991102783 5:62811776-62811798 CTGTTCTGTTTTAAGAATTATGG + Intergenic
991459862 5:66846625-66846647 ATGTTATGGTATAAAATTTCTGG + Intronic
992064675 5:73095348-73095370 ATGTGCTGCCCAAAGATTTCAGG - Intergenic
992137923 5:73766636-73766658 AAGTTCTGATTTAATTTTTCTGG + Intronic
993485621 5:88480601-88480623 ATGTTTGCCTTTAAGATTTTAGG - Intergenic
994613964 5:102079858-102079880 ATGTTCTGCTTTTAGCTTTATGG - Intergenic
995010014 5:107247043-107247065 ATATTGTTCTTTAAGATTTCTGG - Intergenic
995635537 5:114185984-114186006 ATATTCTGCTTTAAAAATTAAGG - Intergenic
996761760 5:126993078-126993100 ATGGTCTGCTTTAAAATAACGGG - Intronic
996781109 5:127187475-127187497 ATGTTCGGCTTTAAGCTATTAGG - Intergenic
997275801 5:132587709-132587731 TTGTTCTGCTTCAAAATTTTGGG + Intronic
997705125 5:135943430-135943452 AATTTATACTTTAAGATTTCAGG + Intronic
997956760 5:138284755-138284777 AAGTTCTGATTTAAGAGGTCTGG + Intergenic
998737449 5:145158752-145158774 TAGTTCTGCTTTAAGTGTTCAGG - Intergenic
998991205 5:147819629-147819651 ATGTTCAAGGTTAAGATTTCAGG + Intergenic
999023193 5:148193383-148193405 ATGTTCTGATTTAAGATGGTAGG + Intergenic
999598786 5:153236678-153236700 ATGTACAGCTTTAAGATTATTGG + Intergenic
999732789 5:154487843-154487865 GTGGTCTGCTTCAAGGTTTCAGG - Intergenic
1000272848 5:159702986-159703008 ATGCACTGGTTTAAGACTTCTGG + Intergenic
1002045733 5:176540907-176540929 AAGTTCAGATTTCAGATTTCTGG - Intergenic
1002795974 6:471257-471279 ATTTTCTACTGTAAGATATCAGG - Intergenic
1004839821 6:19570116-19570138 ATGTTCTCCTCTAAGAGTCCAGG - Intergenic
1004961001 6:20788412-20788434 ATGTTCTTCTGTAAGCTTTATGG + Intronic
1008035287 6:46738741-46738763 GGTTTCTGCTTTTAGATTTCTGG - Intergenic
1008278812 6:49571825-49571847 ATGTTCTGTTTTAAAACTTTAGG + Intergenic
1008697642 6:54059203-54059225 ATGTGCTGCTTCTAGTTTTCTGG + Intronic
1009721659 6:67479365-67479387 ATTTTTAGCTTTAACATTTCTGG + Intergenic
1009813785 6:68704276-68704298 TTGCTCTGCTTTTAGATTTGGGG + Intronic
1010151853 6:72741927-72741949 ATCTTCTGTTTTAAGTTTTAGGG + Intronic
1010402756 6:75465788-75465810 ATGATCTGATTTAAGTTTTTGGG - Intronic
1010454439 6:76038762-76038784 ATGTTCTGTGATCAGATTTCAGG - Intronic
1010936224 6:81865639-81865661 ATTTTCTTCATTCAGATTTCTGG + Intergenic
1010950340 6:82029678-82029700 ATCTTCTGGTTTATGATTTGAGG - Intergenic
1011295455 6:85822047-85822069 CTGTTATGCTTTAAGTTTTAGGG - Intergenic
1012383661 6:98651765-98651787 ATAGTCTGCTTTAATATTTATGG + Intergenic
1012859012 6:104536646-104536668 TTTTTCTGCTTTAAGTTTTAGGG + Intergenic
1015022771 6:128496281-128496303 CTTTTCTGCCTTAAGATTTAGGG - Intronic
1016771456 6:147856840-147856862 GTGTTAAGCTTTAAGCTTTCTGG + Intergenic
1017425791 6:154319900-154319922 ATGTTGTGATTTAAAATTTTGGG - Intronic
1017697862 6:157036813-157036835 ATGTTTTTCCTTATGATTTCAGG + Intronic
1017812659 6:157995235-157995257 ATCTTCTCCTTTTAGATTTCAGG + Intronic
1017998540 6:159557072-159557094 GTTTTATGCTTTTAGATTTCTGG - Intergenic
1021031118 7:15737232-15737254 ATGTTCTGTTTTTTGACTTCAGG + Intergenic
1022348894 7:29547537-29547559 AGGTTACGTTTTAAGATTTCAGG + Intergenic
1022433161 7:30347975-30347997 ATGTTTTGCCTTAATATCTCAGG + Intronic
1023108197 7:36784035-36784057 ATGTTCTGCTTTCAAGTTACAGG - Intergenic
1023118713 7:36887628-36887650 TTGATCAGCTCTAAGATTTCTGG + Exonic
1023340567 7:39214922-39214944 ATGTTCATCTCTAACATTTCAGG - Intronic
1023662390 7:42483212-42483234 ATTTGCTGCTTGAGGATTTCAGG - Intergenic
1023785070 7:43698119-43698141 AGGTTATGCTTTAATGTTTCTGG - Intronic
1024239721 7:47424909-47424931 ATGCCCTGCTGTGAGATTTCTGG - Intronic
1026636248 7:72084355-72084377 ATTTTCTGCTGGAAGATTTATGG - Intronic
1027500378 7:78942575-78942597 AAGTTGTGTTGTAAGATTTCTGG + Intronic
1028129904 7:87158562-87158584 ATGTTCTGCATCAAGAATTATGG - Intronic
1028890935 7:95987872-95987894 AAGTTCTGCTTTAGGCTTTTGGG - Intronic
1029049398 7:97668866-97668888 ATGTTCTACTTTGAGATCACTGG - Intergenic
1030225096 7:107141972-107141994 CTGCTCTGCTGTTAGATTTCAGG - Intronic
1032681730 7:134191633-134191655 GTGATCTGTTTTATGATTTCAGG + Exonic
1037577200 8:20218601-20218623 ATGATCTGCTTTGACATTTGGGG + Intronic
1038077665 8:24095288-24095310 ATTTTCTCCTTTATGCTTTCTGG - Intergenic
1039563144 8:38529076-38529098 ATCTTCTGCTTTCAGATTTAAGG + Intergenic
1043191818 8:77233147-77233169 ATGTTCTGGAGTAAGTTTTCAGG + Intergenic
1044251582 8:90009017-90009039 ATGATCTGCCTTAAGTTTTAAGG - Intronic
1044418952 8:91968991-91969013 ATGGTCTGCTTTAAAATTCTTGG + Intronic
1044783978 8:95775238-95775260 ATGTTGTACTTTAAGCCTTCTGG + Intergenic
1044908937 8:97036030-97036052 GTGTTCTGCTTTATGATTTCAGG + Intronic
1044999356 8:97867036-97867058 TTGTTCTGCCTTTATATTTCAGG + Intergenic
1045071372 8:98507800-98507822 ATGTTCTTCCTTCAGATATCCGG + Intronic
1045388925 8:101695750-101695772 ATGTTCTCCTTTTAGATGTGAGG + Intronic
1045444983 8:102251818-102251840 ATGATCTGCATGAAGATTCCTGG + Intergenic
1045791516 8:105989544-105989566 ATGTTCTGCATTATGATGTAGGG + Intergenic
1045834129 8:106500377-106500399 ATGTTCTTCTATACGATGTCTGG - Intronic
1045983031 8:108214559-108214581 ATTTTCTACTTTAAAATTCCTGG - Intronic
1047633580 8:126734705-126734727 AAGTTCTGTTTTAGGATATCTGG + Intergenic
1048256904 8:132911996-132912018 ATGTTCAGCTCTGAGCTTTCTGG + Intronic
1050159947 9:2707914-2707936 ATTTTGAGTTTTAAGATTTCAGG + Intergenic
1051489996 9:17652082-17652104 ATTTTCTGCTTTCACATTTCTGG + Intronic
1051858356 9:21595928-21595950 ATTTTGTGCTTCAAAATTTCTGG + Intergenic
1052272267 9:26639177-26639199 ATCTTCTCCTTTATGCTTTCAGG - Intergenic
1052475244 9:28951293-28951315 ATATTCTGCTTTGAGATTTTGGG + Intergenic
1052674493 9:31602409-31602431 ATGTTTTGAGTTAAGATTCCAGG - Intergenic
1052822785 9:33151982-33152004 ATGTTTTCCTTTATGACTTCAGG - Intronic
1053293967 9:36900124-36900146 ATTTTCCACTTTAAGAGTTCAGG + Intronic
1055325700 9:75126314-75126336 ATGTGTTGCTTTCATATTTCAGG - Intronic
1056232534 9:84561318-84561340 ATGTTGTGTGTTAAGATTTCAGG + Intergenic
1057132721 9:92665846-92665868 ATCTTGTGTTTTAAGATTTCTGG - Intronic
1058538045 9:105982645-105982667 AGTTTCTGCTTTTAGATTTTTGG + Intergenic
1058786333 9:108392446-108392468 AAATTTTGCTTTAAAATTTCTGG - Intergenic
1059209467 9:112499425-112499447 ATGTTCTGCTTTAAAAGTTGTGG + Intronic
1059504545 9:114786249-114786271 ATCTCTTGCCTTAAGATTTCTGG - Exonic
1060318918 9:122537262-122537284 ATGTTCTGCTATACAATGTCTGG + Intergenic
1186099407 X:6139670-6139692 AGGGACTGCTTTAGGATTTCAGG - Intronic
1186770699 X:12815376-12815398 AGGTTCTGCTTTAACTTCTCCGG + Intronic
1187709298 X:22037854-22037876 ATGTTTGGCTTTTAGAGTTCTGG - Intronic
1188832598 X:34918362-34918384 GTTCTCTGCTTTTAGATTTCTGG + Intergenic
1188968801 X:36587471-36587493 ATCTCCTGCTTTAAAATTTCAGG + Intergenic
1191154574 X:57258329-57258351 ATTTTCTTCTCTAAGATTTATGG - Intergenic
1193390081 X:80915433-80915455 TTTTTCAGCTTCAAGATTTCTGG - Intergenic
1194046604 X:89014001-89014023 ATGCTCTGCTTATAGATTTGAGG - Intergenic
1194383510 X:93224055-93224077 ATTTCCTGCTTCAAGATTTCAGG + Intergenic
1194738342 X:97541937-97541959 ATGTTGGGCTTTAAAATTTTTGG + Intronic
1195374180 X:104210186-104210208 ATGTTCCGATTTAGGCTTTCAGG + Intergenic
1197450755 X:126613494-126613516 ATGTTCTGTTTTGACATTTTTGG - Intergenic
1197644765 X:129005431-129005453 ATGTTCTGCTTTTAGGTGTTAGG - Intergenic
1198786582 X:140295417-140295439 ATATTCTGATCTGAGATTTCTGG + Intergenic
1199010088 X:142747388-142747410 ATGTTCTCCTGTAAGATTCCAGG + Intergenic
1201681431 Y:16648112-16648134 ATTTTCTAGTGTAAGATTTCTGG + Intergenic
1202075482 Y:21034023-21034045 CTGCTCTTCTTTAAGAGTTCTGG - Intergenic