ID: 933240691

View in Genome Browser
Species Human (GRCh38)
Location 2:79917433-79917455
Sequence TAGTTTTTCACCTCAGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 388
Summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 359}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933240691_933240695 22 Left 933240691 2:79917433-79917455 CCTTTCTCTGAGGTGAAAAACTA 0: 1
1: 0
2: 4
3: 24
4: 359
Right 933240695 2:79917478-79917500 AGAAATATACATAGTTGGCACGG 0: 1
1: 0
2: 1
3: 33
4: 450
933240691_933240694 17 Left 933240691 2:79917433-79917455 CCTTTCTCTGAGGTGAAAAACTA 0: 1
1: 0
2: 4
3: 24
4: 359
Right 933240694 2:79917473-79917495 TCAAAAGAAATATACATAGTTGG 0: 1
1: 0
2: 1
3: 65
4: 599

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933240691 Original CRISPR TAGTTTTTCACCTCAGAGAA AGG (reversed) Intronic
900371644 1:2334800-2334822 TTCTTTTCCACCTGAGAGAACGG - Intronic
901845307 1:11978414-11978436 TAGTTCCTGCCCTCAGAGAATGG + Intergenic
903287045 1:22283878-22283900 AAGTTCTCCACCTCACAGAAGGG - Intergenic
903386614 1:22930983-22931005 TAGTTCTTCACCCCAGTGACTGG - Intergenic
904039155 1:27574473-27574495 TAGTTTTTCACGTGAGGAAAGGG + Intronic
905070458 1:35220669-35220691 TAGTTTTTCTCCTGAGTGGAAGG - Intergenic
905524843 1:38628794-38628816 TAGTTTTTCAACTCAAGGACAGG + Intergenic
906649388 1:47501920-47501942 TATTTATTCTGCTCAGAGAAAGG + Intergenic
906804783 1:48770171-48770193 CAGTTTTGCACCACAGAGGAAGG - Intronic
907890871 1:58635572-58635594 TTGTATTTCTCCCCAGAGAATGG - Intergenic
908743169 1:67349430-67349452 TTGTTTTTCTCCTCTGACAAAGG + Intronic
908813500 1:68008574-68008596 TGGTGTTTGAGCTCAGAGAATGG - Intergenic
910483477 1:87684051-87684073 TTGTTTTTCTCATCAGAGGAAGG - Intergenic
911155599 1:94633860-94633882 TAGTTCTTCACCTGTGAAAAAGG + Intergenic
911339229 1:96617341-96617363 CAGTGTTTGAGCTCAGAGAATGG - Intergenic
912071033 1:105809910-105809932 GGGTTTTTCTCCTCAGACAAAGG + Intergenic
912905948 1:113707444-113707466 AAGTTTTTCATTTCAGAGAAGGG - Intronic
915610060 1:156984662-156984684 CATTTTAGCACCTCAGAGAAGGG - Intronic
916216432 1:162399177-162399199 CAGTTTTTCAGCTCATAGAAGGG - Intronic
917217553 1:172693426-172693448 GGGTTTATCTCCTCAGAGAAAGG + Intergenic
917580046 1:176367565-176367587 GAGTATTTCACCTCAGATATTGG + Intergenic
918591973 1:186250058-186250080 TAGGATTTCTCCTCAGAAAATGG + Intergenic
918672306 1:187233907-187233929 TAGTTATATACCCCAGAGAAAGG - Intergenic
918890305 1:190257967-190257989 TGGTGTTTGAGCTCAGAGAATGG - Intronic
920743852 1:208606955-208606977 TAGTATTGCAGCTCATAGAATGG - Intergenic
920896027 1:210050046-210050068 TTGAATTTCACCTCAGAAAATGG + Intronic
921004165 1:211076244-211076266 CAGTGTTTGACCTCTGAGAATGG + Intronic
921503685 1:215939512-215939534 AAGATTTTCATCTCAGAAAAGGG - Intronic
921519536 1:216142597-216142619 TAGTTTTACAGCTGAGAAAATGG - Intronic
921914696 1:220594051-220594073 TAATTTGTCACATCAGAGAAAGG - Intronic
922313628 1:224421170-224421192 GAGTTTTTCACCTAAGGAAATGG - Intronic
924032862 1:239904387-239904409 TAGTTATTAACCTCAGAGACAGG + Intronic
924152488 1:241142793-241142815 TTGATTTTCTCCTCAGAAAACGG + Intronic
1062922320 10:1289586-1289608 TGGTTTTCCACCTCAGAAAGTGG - Intronic
1063087743 10:2834864-2834886 TCGTTTTTCACATAATAGAATGG + Intergenic
1064708085 10:18093625-18093647 TAATCTTCCTCCTCAGAGAAGGG - Intergenic
1064928844 10:20601205-20601227 TATTTTTTGAACTTAGAGAACGG + Intergenic
1064984561 10:21197349-21197371 AAGTTTTTCTTCTCAGAGAATGG + Intergenic
1065272894 10:24054419-24054441 TACTTTCTCTCCTCAGAGATGGG - Intronic
1065890319 10:30115841-30115863 TAGCCTTTCTCCACAGAGAAAGG + Intergenic
1066701322 10:38132200-38132222 TAGTTTTTCACCACTGATTATGG + Intergenic
1068050735 10:51946662-51946684 TAGTTTTCCTCCTAAGAGACAGG + Intronic
1068837573 10:61571115-61571137 GAGTTTATCTCCTCAGACAAAGG + Intergenic
1071378060 10:85030896-85030918 GAGTTTATCTCCTCAGACAAAGG - Intergenic
1071917189 10:90307485-90307507 TATTTTTACACATCATAGAAAGG + Intergenic
1072367072 10:94722698-94722720 TTGTTTTTCTCCACAGAAAAGGG + Intronic
1073050759 10:100665659-100665681 TAGTTTTCCACTTCAGAGAAAGG - Intergenic
1073644704 10:105288944-105288966 TAGAATATAACCTCAGAGAATGG + Intergenic
1073917037 10:108417537-108417559 TAGTTATTCAACTCTGAGAGGGG - Intergenic
1074555068 10:114481349-114481371 TAGTTTCTCTCCTTAGAGCATGG - Intronic
1075877168 10:125817423-125817445 TATATTATCACCTTAGAGAAGGG - Intronic
1077752055 11:4983106-4983128 TATTTATTCAACTGAGAGAATGG - Intronic
1078596810 11:12694260-12694282 TTGTTCTTCACTTGAGAGAAAGG + Intronic
1079711736 11:23692524-23692546 TAGTTTTACAACTTGGAGAAAGG - Intergenic
1079888254 11:26016496-26016518 TAGTTCTTCACATAAGAGGATGG - Intergenic
1080204958 11:29717562-29717584 TTGAATTTCACCTCAGAAAATGG + Intergenic
1080915643 11:36656064-36656086 TAGTTTGAGACCTCAGGGAAGGG + Intronic
1081087493 11:38820237-38820259 TAGTTTTGCAACTTGGAGAAAGG + Intergenic
1081238850 11:40679340-40679362 TTGAATTTCTCCTCAGAGAATGG - Intronic
1081487317 11:43541426-43541448 TAGTCTTTCATCTCAAAGTAAGG + Intergenic
1081718705 11:45270071-45270093 ATGTGTTTCACCTCAGAGCATGG + Intronic
1082592145 11:55025168-55025190 TAGTTTTTAACCTGAGATATTGG + Intergenic
1084120566 11:67066606-67066628 TAGTTTTTTGCCTCAGAGTTTGG - Intronic
1084656612 11:70523392-70523414 GAGTTTGTGACCTCAGAGCAGGG + Intronic
1085489177 11:76898559-76898581 TAGTTTCTCATTTCAGATAATGG + Intronic
1085549575 11:77355951-77355973 TAGATTTTGACATAAGAGAAAGG - Intronic
1085884564 11:80506488-80506510 TAGTTTTCCTCCTAAGAGTAAGG - Intergenic
1086023828 11:82266089-82266111 TAATTTTTCACCTAAGAAGATGG - Intergenic
1086799555 11:91154613-91154635 TAGTTTTTATCCTGGGAGAATGG + Intergenic
1087425800 11:97984028-97984050 TAGTATTTTACCTCAGACTATGG - Intergenic
1087489756 11:98810044-98810066 TAGTTTTCCACCAAAGAGCAAGG - Intergenic
1087793573 11:102432590-102432612 TTGAATTTCTCCTCAGAGAATGG - Intronic
1088143748 11:106649644-106649666 TTGTATTTCTCCTCAGAAAATGG + Intergenic
1088191565 11:107233840-107233862 CAGTTTTTGACCTCTCAGAAAGG + Intergenic
1091566173 12:1649781-1649803 TTGTTTCTCACCTCAAAGGATGG - Intergenic
1092470798 12:8778605-8778627 TAGTTTATTACCTAACAGAAAGG - Intronic
1093539928 12:20269349-20269371 TTGTTCTTCACCTCAACGAATGG - Intergenic
1094200574 12:27791319-27791341 TTGTCTTTCACCTCTCAGAATGG - Intronic
1094759093 12:33508674-33508696 TTGTTTTTTATCTTAGAGAAAGG - Intergenic
1095531380 12:43190432-43190454 CAGTTGTTCCCATCAGAGAAGGG + Intergenic
1096441850 12:51649859-51649881 TTGTATTTCTCCTCAGAAAATGG + Intronic
1097609862 12:61806997-61807019 TTGAATTTCTCCTCAGAGAATGG - Intronic
1100405552 12:94270091-94270113 TATTTGTACCCCTCAGAGAATGG + Intronic
1101430174 12:104620148-104620170 TATTTTGTCACCACACAGAATGG + Intronic
1101500994 12:105303350-105303372 TCGATTTGCACATCAGAGAAGGG - Intronic
1102332504 12:112046303-112046325 CAGTGTTTCCCCTCAGAGGAGGG + Intronic
1102424618 12:112832835-112832857 TATTTATTCATTTCAGAGAAAGG - Intronic
1102794428 12:115676141-115676163 CAGTTTTTCATCTCATAGATAGG + Intergenic
1103222369 12:119256520-119256542 CAGTTTTTCATCTGTGAGAAGGG - Intergenic
1104079907 12:125420686-125420708 TTGATTTTCTCCTCAGAAAATGG + Intronic
1104141182 12:125987254-125987276 TAGTTTTGCAACTTAGAGTAAGG - Intergenic
1104797829 12:131531938-131531960 TGGATTTTAACTTCAGAGAATGG - Intergenic
1105720641 13:23110669-23110691 TCTTTTTTCCCCTCAGAAAATGG - Intergenic
1106068564 13:26383370-26383392 TATTTTTTCCCATCAGGGAAAGG - Intronic
1106352876 13:28951387-28951409 TAGTCTTTCACCACTGAGTATGG + Intronic
1106984641 13:35331376-35331398 CAGTTTTTGTCATCAGAGAATGG - Intronic
1107302691 13:38982550-38982572 TAGTTTCACAACTCGGAGAAAGG - Intronic
1109334047 13:60970754-60970776 TTGTATTTCTCCTCAGAAAATGG - Intergenic
1109372179 13:61437197-61437219 TAGTTTTGCAACTCAGAGCAAGG + Intergenic
1109582723 13:64363597-64363619 GAGTTTATCTCCTCAGACAAAGG - Intergenic
1111072504 13:83187459-83187481 TTGAATTTCACCTCAGAAAATGG - Intergenic
1111551377 13:89817905-89817927 TTGTATTTCTCCTCAGAAAATGG - Intergenic
1111600266 13:90464316-90464338 TTGTTTTTCACATTAGAGAAGGG + Intergenic
1111621535 13:90731594-90731616 TTGAATTTCTCCTCAGAGAACGG - Intergenic
1112556401 13:100472503-100472525 TACTTCATCACCTAAGAGAAGGG + Intronic
1113189761 13:107730926-107730948 TAGGTTTTCAGCTCAGACAAGGG + Intronic
1115309246 14:31962959-31962981 CAGTTTTTGTCCTCAGAGGAGGG - Intergenic
1115837010 14:37417625-37417647 TAATTTTTAACCTCAGAAGAAGG - Intronic
1116327084 14:43543504-43543526 TAGTTTTACTTCCCAGAGAAGGG + Intergenic
1116518348 14:45824568-45824590 TTCTTTTTCACATCAGGGAAAGG + Intergenic
1116762035 14:49026751-49026773 TTGAATTTCACCTCAGAAAATGG - Intergenic
1116793693 14:49366661-49366683 TAGTTTTACAACTTAGAGCAAGG - Intergenic
1117005643 14:51418660-51418682 CAGTGTTTGAGCTCAGAGAATGG - Intergenic
1118281923 14:64437279-64437301 GAGTTTTTCATCTTAGAGATTGG - Intronic
1118597951 14:67450784-67450806 TTGAATTTCTCCTCAGAGAATGG - Intronic
1119611231 14:76064303-76064325 TAAATTGTCACCTCAGAGATTGG + Intronic
1120394017 14:83944660-83944682 TAGTATTTCTCCTCAGAAAACGG + Intergenic
1120621871 14:86774970-86774992 TTGAATTTCACCTCAGAAAATGG - Intergenic
1121423148 14:93829850-93829872 GAGCTTTCCACTTCAGAGAACGG + Intergenic
1121867393 14:97375607-97375629 TAATTTTTAACCTCTTAGAAAGG + Intergenic
1123878082 15:24644999-24645021 TAACTGATCACCTCAGAGAATGG + Intergenic
1124635345 15:31361358-31361380 TGGTTTCTCACCTCTGACAAGGG + Intronic
1124713178 15:32031300-32031322 GAGTTTCTAACCTGAGAGAAAGG - Intronic
1126746162 15:51828714-51828736 TACTTCTTCCCCTCAGAGGAGGG - Intergenic
1127663163 15:61119478-61119500 TATTTTTTCCCCCCAGAGACAGG + Intronic
1128239493 15:66092135-66092157 TAGATTTCCACTGCAGAGAAGGG + Intronic
1128437583 15:67669939-67669961 TAGATATTTACCTAAGAGAAAGG + Intronic
1129012612 15:72436178-72436200 CAGTTTTTCACCACTGAGTATGG + Intergenic
1131659454 15:94498575-94498597 TTGAATTTCTCCTCAGAGAATGG - Intergenic
1132701860 16:1225399-1225421 TCCTTCTGCACCTCAGAGAAGGG + Intergenic
1135954640 16:26946001-26946023 TTGGTTTTCACATCAGAGGAGGG - Intergenic
1138023747 16:53506132-53506154 CTGTTTGTCACCTCAGTGAATGG - Intergenic
1138839126 16:60476690-60476712 TAATTTTTCACCTTAGATACTGG + Intergenic
1140451755 16:75076472-75076494 TAATTTCTCCCCTCAGTGAAGGG - Intronic
1140627818 16:76815538-76815560 TAGTTTTTAAAATCAGAAAAGGG - Intergenic
1145965967 17:28917514-28917536 TAGTTTTTAAACACAGGGAATGG - Intronic
1146668234 17:34719232-34719254 CAGTTTTTAACCTCTGAAAATGG + Intergenic
1148703642 17:49608588-49608610 TAGTTTTTCTCCTTAGAGGCAGG + Intronic
1150323591 17:64237364-64237386 TAGTTTTTTTCCTAAGGGAAAGG + Intronic
1151510771 17:74558325-74558347 TAGGTATTTATCTCAGAGAATGG - Intergenic
1152132830 17:78487318-78487340 TATTTTTAAAGCTCAGAGAAGGG + Intronic
1153800478 18:8663655-8663677 CAATTTTTCACCCAAGAGAAAGG + Intergenic
1153885473 18:9460703-9460725 CATTTTTTCCCCTCAGAGAGTGG + Intergenic
1154293196 18:13128536-13128558 TAGTTTTTCTCTTTAGAGCAAGG - Intergenic
1155662050 18:28260871-28260893 TAATTTTTCACAGCAGAGTAGGG + Intergenic
1155679606 18:28473797-28473819 TTGAGTTTCCCCTCAGAGAATGG - Intergenic
1155773105 18:29725004-29725026 TTGTATTTCTCCTCAGAAAATGG + Intergenic
1156443810 18:37219313-37219335 TGGTGTTTGACCTCTGAGAACGG - Intronic
1157341072 18:46779038-46779060 GAGTTTTTCTTCTCAGACAAAGG - Intergenic
1159375716 18:67589975-67589997 TAGTTTTACAACTTAGAGCAAGG - Intergenic
1160331381 18:77995074-77995096 TTGTTTTTCAACTTAGAAAATGG + Intergenic
1164245327 19:23423184-23423206 AAGTATTTCACCTAAAAGAAGGG - Intergenic
1164308735 19:24028360-24028382 AAGTATTTCACCTAAAAGAAGGG + Intergenic
1164533887 19:29069741-29069763 TAGCTTTTCACACGAGAGAAAGG + Intergenic
925487490 2:4351809-4351831 TAATCATTCACCTCAGTGAATGG + Intergenic
925788713 2:7459274-7459296 TACTTTTTAACCTCAGCGTAAGG + Intergenic
927046797 2:19287152-19287174 TAGTTTTTGGCACCAGAGAAGGG - Intergenic
927387955 2:22558276-22558298 TTGTTTTTTCCCTCAGAGATTGG - Intergenic
927579574 2:24230187-24230209 TAATTTTCCACCTCAGTGGATGG + Intronic
928452981 2:31395324-31395346 TAGTCTTTCACCTGTGGGAAGGG - Intronic
931151327 2:59577068-59577090 TACTTTTTCAACTCAAAGCATGG - Intergenic
932584414 2:73017227-73017249 AAGTTGTTTACCTCAGAGGATGG + Intronic
932907753 2:75772063-75772085 TAGTTTTGCAACTCGGAGCAAGG + Intergenic
932960585 2:76408531-76408553 TTGAATTTCACCTCAGAAAATGG - Intergenic
932979250 2:76643843-76643865 TAGTTTGTCCACTCAGGGAATGG - Intergenic
933240691 2:79917433-79917455 TAGTTTTTCACCTCAGAGAAAGG - Intronic
934577667 2:95413282-95413304 TTGTTTATCACATCAAAGAAGGG + Exonic
934608012 2:95712725-95712747 TAGTTTTTCAACCCACAAAATGG - Intergenic
934639959 2:96021985-96022007 TTGTTTATCACATCAAAGAAGGG + Exonic
934862508 2:97776012-97776034 TAATTTTTATCCTCAGGGAAAGG - Exonic
934960421 2:98668095-98668117 TTGAATTTCACCTCAGAAAATGG - Intronic
935269222 2:101419336-101419358 TCATTTTTCAGCTCAGAGAAAGG + Intronic
936541351 2:113354612-113354634 TAGTTTTTCAACCCACAAAATGG - Intergenic
936811385 2:116407340-116407362 TTGATTTTCTCCTCAGAGAATGG - Intergenic
936976126 2:118224283-118224305 GAGTTGTAAACCTCAGAGAAAGG + Intergenic
937527760 2:122791614-122791636 CAGGTTTTCACCTCATAAAAGGG + Intergenic
939417956 2:141924910-141924932 TCTTTTTTTTCCTCAGAGAATGG + Intronic
939514133 2:143145159-143145181 TAATGTTTCACCTGAGAGTAAGG - Intronic
940037462 2:149325863-149325885 TACTGTTGCACCTCAGGGAATGG + Intergenic
940576810 2:155518321-155518343 TAATTTCTTACCTCAGAAAATGG - Intergenic
940924711 2:159351646-159351668 TAGATTTTCACCTCAAATATTGG - Intronic
941393001 2:164938125-164938147 TATTTTTTCTTATCAGAGAAAGG - Intronic
941525685 2:166603862-166603884 TAGCTGATCACCTTAGAGAATGG + Intergenic
941536046 2:166723221-166723243 TTGAATTTCACCTCAGAAAATGG + Intergenic
942338846 2:174921344-174921366 TAGTTTTTCCACTCGGAGAGAGG - Intronic
943006221 2:182390857-182390879 TGGTTGTTCTCCTCAGAGAAAGG - Intronic
943213783 2:185004351-185004373 TAGTTTTTCACTTAAGATAATGG - Intergenic
943233639 2:185290480-185290502 CAGTTTTTGAGCTCTGAGAATGG + Intergenic
943428118 2:187762016-187762038 ATGTTTCTCACTTCAGAGAAGGG + Intergenic
943982415 2:194571641-194571663 TAGTTTTTAAGCTCAGTGAAGGG + Intergenic
944095123 2:195957441-195957463 GTGTTTTGCTCCTCAGAGAATGG - Exonic
944138314 2:196425811-196425833 TAGTTTTTCAACTCAGTTTATGG - Intronic
945728315 2:213500995-213501017 TACTTTTTCCCCTCTGGGAACGG - Intronic
946128723 2:217587479-217587501 AAGTTTTTGTCCCCAGAGAAGGG + Intronic
946271077 2:218594757-218594779 TTGTTTTTAATCTCAGAGAGAGG + Exonic
946753602 2:222919601-222919623 AAGGTTTTCACCTCAGGAAAGGG - Intronic
947682390 2:232046479-232046501 TAGTTTGTCACTATAGAGAAAGG + Intronic
1168982910 20:2023187-2023209 TACTTTTTCATCTGAGAAAATGG - Intergenic
1169332485 20:4727410-4727432 TAGTTTTTCACTTTAGCAAAGGG + Exonic
1169355859 20:4904441-4904463 TTGTTTTTTTCTTCAGAGAAAGG - Intronic
1169772993 20:9221612-9221634 TATTTTTCCTCCTCTGAGAATGG + Intronic
1170947908 20:20908609-20908631 AAGTTTTTAAACTCAGAGCAGGG - Intergenic
1171514858 20:25721228-25721250 GAGTTTTTCACTTAAGATAATGG + Intergenic
1174313413 20:49677468-49677490 TAGCATTTCTGCTCAGAGAATGG - Intronic
1174854595 20:54031335-54031357 TAGCTTTTGATATCAGAGAATGG + Intronic
1177339831 21:19784268-19784290 TTGAATTTCACCTCAGAAAATGG + Intergenic
1177663081 21:24113309-24113331 ATGTTTTTCACTCCAGAGAAAGG - Intergenic
1177760986 21:25402081-25402103 TTGTATTTCTCCTCAGAAAATGG - Intergenic
1177977019 21:27863945-27863967 TAGTTTTTCAGTTCCTAGAAAGG + Intergenic
1178694240 21:34779428-34779450 CAAATTTTCATCTCAGAGAATGG + Intergenic
1178901594 21:36603347-36603369 CTGCTCTTCACCTCAGAGAAAGG - Intergenic
949245534 3:1922373-1922395 TGGTTTATCTCCTCAGACAATGG - Intergenic
950739475 3:15038668-15038690 TAATTGTTCACCTCACAGTAAGG + Intronic
951129462 3:19024548-19024570 TGGTTTTTCTCCTTGGAGAATGG + Intergenic
951918241 3:27824202-27824224 TATTTTTTCCCTTCAGAGGAAGG + Intergenic
952304876 3:32136832-32136854 AAGGTTTTCAGCTCACAGAAAGG + Intronic
955880295 3:63537173-63537195 AAGTTTACCATCTCAGAGAAAGG - Intronic
956053946 3:65278708-65278730 CATTTTTTAACCCCAGAGAAGGG - Intergenic
957267263 3:77983170-77983192 TTGAATTTCACCTCAGAAAATGG + Intergenic
957358136 3:79117957-79117979 TAGTTTTTCAATTCACAGAAAGG - Intronic
957874673 3:86130064-86130086 TAGTTTTTCCCCTTCCAGAAAGG - Intergenic
957945523 3:87057974-87057996 TTGTATTTCTCCTCAGAAAATGG + Intergenic
958512825 3:95070675-95070697 TTGTTTGTGATCTCAGAGAAAGG - Intergenic
958831714 3:99098425-99098447 TAGAATTTCTCCTCAGAAAATGG - Intergenic
960359512 3:116694527-116694549 TAGTTTTCCACTTCCCAGAATGG + Intronic
961101705 3:124204764-124204786 TAGTTTTTAAACTAAGAGATGGG - Intronic
961643828 3:128381870-128381892 TCCTTTTCCACCTCAGGGAAAGG - Intronic
962491617 3:135898804-135898826 TAGTATTTCTGCTAAGAGAAAGG - Intergenic
964157675 3:153605261-153605283 TTGTTTTTCAATTCAGAGGAAGG + Intergenic
965101991 3:164309999-164310021 TAGAATTTCTCCTCAGAAAATGG + Intergenic
965194884 3:165580979-165581001 TTTTTCTTCAGCTCAGAGAATGG - Intergenic
965251812 3:166352184-166352206 GGGTTTTTCACCTCAGACAAAGG + Intergenic
965672205 3:171158456-171158478 TAGTTGTTCACCTGCGAGCAGGG - Intronic
966236062 3:177702973-177702995 TCGTTTCTCACCTCAAATAATGG - Intergenic
966445341 3:179996033-179996055 GAGTTTATCTCCTCAGACAAAGG - Intronic
970635585 4:18005970-18005992 TTGAGTTTCACCTCAGAAAATGG + Intronic
970801386 4:19976832-19976854 TTGAATTTCACCTCAGAAAATGG + Intergenic
972180047 4:36453109-36453131 TTTTTTCTCTCCTCAGAGAATGG + Intergenic
974206053 4:58704914-58704936 TTGATTTTCTCCTCAGAAAATGG - Intergenic
974334088 4:60517647-60517669 TAGTTTTTCCCCTCTGAAAATGG - Intergenic
974569855 4:63630389-63630411 TAGTTATACACCTAAAAGAAAGG + Intergenic
974654364 4:64800129-64800151 TGGTGTTTGACCTCTGAGAATGG + Intergenic
975841064 4:78474742-78474764 TTGTTTTTCACCACTGAGGATGG - Intronic
976310436 4:83606413-83606435 TAATTTTTTTCCTCAGAGAAAGG + Intergenic
976462040 4:85322861-85322883 TATTTATTCATATCAGAGAAAGG + Intergenic
977930717 4:102746051-102746073 TGGTTTATCTCCTCAGACAAAGG + Intronic
978043541 4:104099114-104099136 TTGAATTTCACCTCAGAAAATGG - Intergenic
979373305 4:119914767-119914789 TTGTATTTCTCCTCAGAAAATGG + Intergenic
979510655 4:121550164-121550186 TAGTGTTTGAGCTCTGAGAACGG - Intergenic
979766694 4:124472255-124472277 GGGTTTTTCTCCTCAGACAAAGG - Intergenic
980292387 4:130860098-130860120 TTGAATTTCTCCTCAGAGAATGG - Intergenic
981392040 4:144202384-144202406 AACTTTTTAACTTCAGAGAAGGG - Intergenic
981720285 4:147795086-147795108 TAGTTTTTTTCCTTAGAGACAGG + Intronic
981773124 4:148333286-148333308 TAGTTTTTCATAACATAGAAAGG - Intronic
982608175 4:157539600-157539622 TTGAATTTCACCTCAGAAAATGG + Intergenic
983110786 4:163746888-163746910 TAGTTTTTAGCCTCTGAGAAAGG - Intronic
983337563 4:166416182-166416204 TTGAATTTCACCTCAGAAAATGG + Intergenic
983785286 4:171722078-171722100 GGGTTTTTCTCCTCAGACAAAGG + Intergenic
983945361 4:173580333-173580355 TAGTGTTTCAATTCAGTGAATGG + Intergenic
984880771 4:184408323-184408345 TAGAATTTCAGCTAAGAGAAGGG - Intronic
986019008 5:3783553-3783575 TAGTGTTCCACTTAAGAGAAAGG - Intergenic
986593344 5:9394277-9394299 TTGATTTGGACCTCAGAGAATGG - Intronic
989515001 5:42332214-42332236 TAGTCTTCCACATAAGAGAAGGG + Intergenic
990911769 5:60859673-60859695 TAGTTTTTCTTCTCACAGTATGG - Intergenic
991494534 5:67214451-67214473 TGGTTTCTCACAGCAGAGAAGGG + Intergenic
991927992 5:71723622-71723644 TAGATGTTAACCTCTGAGAAAGG - Intergenic
992771882 5:80056048-80056070 CATTTTTCCACTTCAGAGAATGG - Intronic
994291720 5:98034524-98034546 GGGTTTATCTCCTCAGAGAAGGG + Intergenic
994545684 5:101163489-101163511 CAGTGTTTGACCTCCGAGAATGG + Intergenic
994695725 5:103071186-103071208 TAGTTTTACACCTGTTAGAATGG - Intergenic
994823262 5:104680388-104680410 TTGATTTTCTCCTCAGAAAATGG - Intergenic
994836803 5:104865607-104865629 GGGTTTATCTCCTCAGAGAAGGG - Intergenic
994895950 5:105702564-105702586 TAATTTTTAAACTCAGAGACAGG + Intergenic
995132335 5:108643757-108643779 TAGGCTTTCACCTCTGGGAATGG - Intergenic
995256795 5:110056163-110056185 TTGTATTGCACTTCAGAGAAGGG + Intergenic
995805733 5:116050364-116050386 TATTTGTTCACTTCAGATAATGG + Intronic
995836433 5:116404404-116404426 TTTTTTGTCACCTCATAGAAAGG + Intronic
996488569 5:124065714-124065736 TAGCTGGTCACCCCAGAGAATGG + Intergenic
996641570 5:125761423-125761445 TTGTATTTCTCCTCAGAAAATGG - Intergenic
996782023 5:127197778-127197800 TGGTGTTTGAGCTCAGAGAATGG + Intergenic
997181480 5:131833044-131833066 TTGAATTTCTCCTCAGAGAATGG + Intronic
997575711 5:134975424-134975446 TTGTTTTTCCCCACAGAGACAGG - Intronic
998404834 5:141868470-141868492 CAGTTTTTCCCCTAAGTGAAGGG + Intronic
998493725 5:142568754-142568776 CAGTGTTGCACCTCAGAGGAAGG + Intergenic
1000420264 5:161030718-161030740 TAGTTCTTCACCACAGGGAGAGG - Intergenic
1003987591 6:11452442-11452464 CAGTGTTTGAGCTCAGAGAACGG + Intergenic
1004056092 6:12139998-12140020 TGGTGTTTGAGCTCAGAGAAAGG + Intronic
1004652229 6:17621166-17621188 TAGCATTTCACCTCTTAGAATGG + Intronic
1004834502 6:19515946-19515968 TAGAATTTCTCCTCAGAAAATGG - Intergenic
1005326766 6:24709587-24709609 TAGTTTTGCTCCTCATAGATAGG + Intronic
1005345768 6:24888689-24888711 CTGTATTTCATCTCAGAGAAAGG + Intronic
1007233559 6:40371244-40371266 TAGTTTTTCACCATTGAGTATGG + Intergenic
1007912448 6:45529522-45529544 TAGTTTTTAACCAGGGAGAAAGG - Intronic
1008265800 6:49424674-49424696 TTGATTTTCATCTCACAGAATGG - Intergenic
1008724235 6:54396762-54396784 TCATTTTACACCTAAGAGAATGG - Intergenic
1008967565 6:57328659-57328681 TAGGTATACACCTGAGAGAAAGG - Intronic
1010268424 6:73892834-73892856 TAGTTCTTTACAGCAGAGAATGG + Intergenic
1011167362 6:84463944-84463966 TAGTTATGCACCTAAGAAAAGGG + Intergenic
1011884668 6:92078923-92078945 TGGTGTTTGAGCTCAGAGAACGG + Intergenic
1012921130 6:105222022-105222044 GGGTTTATCTCCTCAGAGAAAGG + Intergenic
1013139106 6:107313038-107313060 TAGTTTTCAAACTAAGAGAATGG - Intronic
1013475698 6:110505531-110505553 TTGATTTGCACATCAGAGAAGGG + Intergenic
1016120234 6:140335187-140335209 TAGTTAATCTCCTCAGACAAAGG + Intergenic
1016315421 6:142780340-142780362 TAGTTTTTCACTTCAGTGAAAGG + Intronic
1018075994 6:160214228-160214250 CAGTTTTTGAGCTCTGAGAATGG - Intronic
1018423301 6:163658708-163658730 AAGTTTCTTTCCTCAGAGAAAGG - Intergenic
1019211973 6:170413915-170413937 TAGTGTCTGACCTCTGAGAAGGG - Intergenic
1021312915 7:19115631-19115653 TTGTTTTTCCCCTCAGAGGAAGG + Exonic
1021798141 7:24278472-24278494 TGGTTTTTGAGCTCTGAGAATGG - Intergenic
1022197949 7:28087581-28087603 TCCTTTTTCCCCTCAGAAAATGG - Intronic
1022725926 7:32981543-32981565 AAGTCTATCACCTCAGAGACAGG - Intronic
1023034603 7:36119420-36119442 TAGTTATACACCCAAGAGAAAGG + Intergenic
1023470890 7:40517928-40517950 TAGTTTTTCCTTTCAGATAATGG - Intronic
1024040212 7:45547227-45547249 GAGTTTATCTCCTCAGACAAAGG + Intergenic
1024939985 7:54752373-54752395 GAGTTTTTCATCTTAGAGATTGG - Exonic
1025047675 7:55706106-55706128 AAGTCTATCACCTCAGAGACAGG + Intergenic
1028004300 7:85542651-85542673 CAGTGTTTCAGCTCAGAGAATGG - Intergenic
1028917330 7:96273849-96273871 TGTTTTTTCACCTCCTAGAATGG - Intronic
1029886683 7:103880044-103880066 TAGTTTTTCATTTCAGAAAAGGG - Intronic
1030181111 7:106710042-106710064 TAGTGTTTGAGCTCTGAGAATGG + Intergenic
1030458428 7:109801754-109801776 CAGTTTATCTCCTCAGACAAAGG + Intergenic
1030657111 7:112180548-112180570 TAGAAAATCACCTCAGAGAAGGG + Intronic
1031963689 7:128011967-128011989 GAATTTTTCACATCAGAAAAGGG + Intronic
1033450216 7:141455795-141455817 TAGGTTTTCATCTCAGAGAAAGG + Intronic
1033905258 7:146193759-146193781 TTGTATTTCTCCTCAGAAAATGG + Intronic
1034002959 7:147436771-147436793 TAGTTTTACAACTTAGAGCAAGG + Intronic
1034851850 7:154501264-154501286 TTGAATTTCACCTCAGAAAATGG - Intronic
1034866848 7:154649375-154649397 TAGGTATTCACCCAAGAGAAAGG - Intronic
1035988888 8:4465760-4465782 TATTTTCTCACCTCTGAGAATGG + Intronic
1037398370 8:18467522-18467544 CAGTGTTTGAGCTCAGAGAATGG + Intergenic
1038661940 8:29505051-29505073 TATTCTTTCATCTCAGAAAAAGG + Intergenic
1038833849 8:31096288-31096310 TAGGTTTTCATTTCATAGAATGG + Intronic
1038979635 8:32744324-32744346 TAATTTTTCACAACAGAAAATGG - Intronic
1039415266 8:37388324-37388346 GAGTTGTTCACCTTAGAAAAGGG - Intergenic
1039843183 8:41308204-41308226 AAGTTTTTAACCTCTGAGACGGG - Intronic
1040446073 8:47494923-47494945 TATGTTTTCACCCCAGTGAAGGG + Intronic
1041742071 8:61166581-61166603 TTCTCTTTTACCTCAGAGAAGGG - Intronic
1041865840 8:62572037-62572059 TTGAATTTCACCTCAGAAAATGG + Intronic
1041985860 8:63921938-63921960 GAGTTTATCTCCTCAGACAAAGG - Intergenic
1042801919 8:72728198-72728220 CAGTTTTTAACTTGAGAGAATGG + Intronic
1043077365 8:75719047-75719069 TACTTTTGCATCTCAGAGATTGG + Intergenic
1043341520 8:79245724-79245746 TAGTTTTACAACTCAGACCAAGG - Intergenic
1043938830 8:86173867-86173889 TGGTGTTTGAGCTCAGAGAATGG - Intergenic
1046183031 8:110677393-110677415 TAGTTTTACAGCTTGGAGAAAGG + Intergenic
1047266170 8:123311311-123311333 CAGATTTTTACCTTAGAGAAAGG - Intergenic
1047563385 8:126013451-126013473 TAGATTTGCAAATCAGAGAAGGG + Intergenic
1049272834 8:141705127-141705149 AAGTTTTGCACCTCAGAGAATGG - Intergenic
1051210036 9:14731645-14731667 TAGTTTTTCACTTGACAGAAAGG - Intergenic
1051361283 9:16283746-16283768 AACCTTTTCATCTCAGAGAATGG + Intergenic
1052227279 9:26105826-26105848 TGGTTTGTCTCCTCAGACAAAGG - Intronic
1052294507 9:26882174-26882196 TGATTTTTCTCCTCAGAAAATGG - Intronic
1054864099 9:69982255-69982277 TAGGTTTTCATCTTAGACAAAGG - Intergenic
1055175640 9:73314306-73314328 TTGAATTTCTCCTCAGAGAATGG + Intergenic
1055649656 9:78394996-78395018 TAGTTTTTGATCTCTGAGCAAGG - Intergenic
1057231016 9:93321301-93321323 CAGTTTTACATCTCAGGGAAGGG - Intronic
1058062539 9:100513291-100513313 TTGTTTTTCTTCTCAGATAATGG + Exonic
1058384502 9:104418284-104418306 TATTTTTACTCCTCTGAGAAAGG + Intergenic
1058400303 9:104609633-104609655 TAGTTTTTATCCCCAGAAAAGGG + Intergenic
1058751885 9:108047451-108047473 TAGTTTTTCATCTCTCAAAATGG + Intergenic
1059300103 9:113305792-113305814 TAGTTTTTCACCTAATTGATGGG - Intergenic
1059817113 9:117929283-117929305 TAGTTTTTGCACTCAGAGAGTGG + Intergenic
1060133911 9:121133123-121133145 CAGTGTTTGAGCTCAGAGAACGG - Intronic
1185768160 X:2743173-2743195 TCGTTTTTCAACTAAGAGATTGG + Intergenic
1187657468 X:21493665-21493687 TCATTGTTCACCTCTGAGAAAGG - Intronic
1188429909 X:30094857-30094879 ATGGTTTTCAGCTCAGAGAAAGG + Intergenic
1191008545 X:55737532-55737554 CAGTTTTTCACCACTGAGCATGG + Intronic
1191122446 X:56920639-56920661 TGGTATTTCAGCTCTGAGAATGG - Intergenic
1192039154 X:67598788-67598810 TTGTTTTTCTTCTCAGGGAAAGG + Intronic
1192353366 X:70376249-70376271 TTGTTAGTCAGCTCAGAGAAGGG - Intronic
1192406458 X:70890866-70890888 CAGTGTTTGAGCTCAGAGAATGG + Intronic
1193073882 X:77334593-77334615 CAGTGTTTCAGCTCTGAGAATGG + Intergenic
1193402644 X:81064296-81064318 TGGTGTTTAAGCTCAGAGAATGG + Intergenic
1193460591 X:81786869-81786891 TTGTATTTCTCCTCAGAAAATGG + Intergenic
1193638378 X:83981558-83981580 AAGTTTTTTACCTAAGATAATGG - Intergenic
1193857485 X:86623145-86623167 CATTTTCTCAACTCAGAGAAAGG - Intronic
1194369533 X:93055402-93055424 TAGCTTTGCACATAAGAGAAGGG - Intergenic
1194443246 X:93958548-93958570 GAGTTTATCTCCTCAGAAAAAGG - Intergenic
1195154483 X:102109690-102109712 TTGAATTTCTCCTCAGAGAATGG - Intergenic
1195614943 X:106904552-106904574 TAATTTTTCAACACAGAAAATGG + Intronic
1196007490 X:110851783-110851805 TAGTTTTCCAAATCAGAGGATGG + Intergenic
1196110842 X:111945659-111945681 TAGTCTATCATCTCAGACAAAGG - Intronic
1196391269 X:115210092-115210114 TTGTATTTCTCCTCAGAAAATGG - Intronic
1197169750 X:123418897-123418919 TAGCTATTTACCTAAGAGAAAGG + Intronic
1197387134 X:125815224-125815246 GAGTTTATCTCCTCAGACAAAGG + Intergenic
1199169983 X:144724214-144724236 TATTTTTTCTTCTGAGAGAATGG + Intergenic
1199203914 X:145124894-145124916 TTGATTTTCTCCTCAGAAAATGG + Intergenic
1200405886 Y:2811122-2811144 TAGTGTTTGAGCTCTGAGAATGG - Intergenic
1201314403 Y:12629580-12629602 CAGTGTTTGAGCTCAGAGAATGG - Intergenic