ID: 933243063

View in Genome Browser
Species Human (GRCh38)
Location 2:79944383-79944405
Sequence CTGAGTCATCACTTTAAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 138}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933243063_933243065 7 Left 933243063 2:79944383-79944405 CCAACTTTAAAGTGATGACTCAG 0: 1
1: 0
2: 0
3: 14
4: 138
Right 933243065 2:79944413-79944435 GAAAAAAAGTTTGGACTTCTAGG 0: 1
1: 0
2: 1
3: 38
4: 372
933243063_933243064 -2 Left 933243063 2:79944383-79944405 CCAACTTTAAAGTGATGACTCAG 0: 1
1: 0
2: 0
3: 14
4: 138
Right 933243064 2:79944404-79944426 AGATATTCAGAAAAAAAGTTTGG 0: 1
1: 1
2: 7
3: 73
4: 676

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933243063 Original CRISPR CTGAGTCATCACTTTAAAGT TGG (reversed) Intronic
907104746 1:51872403-51872425 CTGACTGATTTCTTTAAAGTGGG - Intronic
907745706 1:57211499-57211521 TTGAATCATCACTTTAAGGATGG + Intronic
911610530 1:99955057-99955079 CTGAGGCATCACTTGAAACTGGG - Intergenic
914981102 1:152415086-152415108 CAGTTTCATCTCTTTAAAGTTGG + Intergenic
916120101 1:161521956-161521978 TTAAGTCATTACTTTAAGGTCGG + Intronic
916307018 1:163347780-163347802 CTGACTCATCACTCTCAATTTGG - Exonic
916954990 1:169822857-169822879 CTGTGTCATAATTTTAAAGAGGG - Intronic
917622834 1:176815149-176815171 CTCTGTCATCACTTTACTGTTGG - Intronic
923919041 1:238543685-238543707 ATGAGACATCACATAAAAGTTGG - Intergenic
924286752 1:242494949-242494971 CTAAGTCCTCCCTTGAAAGTGGG + Intronic
924414305 1:243843259-243843281 CTGAGTCATCACTAGAGAGTGGG - Exonic
1062806876 10:428924-428946 GTGAGACATCACTATAAAGCTGG - Intronic
1068823827 10:61410577-61410599 CTGATTGATCACTTTGAAATAGG + Exonic
1068926364 10:62543696-62543718 ATGTGTCATGACTTTGAAGTTGG + Intronic
1077506041 11:2930351-2930373 CTGAGTCATCGCTTTCCAGCTGG + Intergenic
1077746205 11:4908944-4908966 CTGAGTCATCACTTCACAGCAGG - Intronic
1081713074 11:45230430-45230452 GGGAGACATCAGTTTAAAGTGGG - Intronic
1083620683 11:64048010-64048032 CTGAGCCACCACTTCAGAGTGGG + Intronic
1086527877 11:87750322-87750344 CTGTGACATTTCTTTAAAGTGGG - Intergenic
1088042316 11:105402187-105402209 ATGTGTTATCACTTTTAAGTAGG - Intergenic
1088148546 11:106715456-106715478 CTGAGGCATCACTTAAATTTGGG - Intronic
1089409278 11:118225621-118225643 CTTAGTCACCACTTCAAAATAGG + Intergenic
1091215104 11:133896334-133896356 TTGAGTCGTGAGTTTAAAGTGGG + Intergenic
1091686805 12:2568168-2568190 CTGAGCCATCACATTCAAATTGG + Intronic
1095325610 12:40888188-40888210 CTGATTTATCACTATAAATTAGG - Intronic
1095917671 12:47496480-47496502 TACAGTCATCAATTTAAAGTTGG - Intergenic
1099158874 12:79214626-79214648 CTGTGTAATCACTTGAAAGTAGG + Intronic
1102861274 12:116338493-116338515 CAGTCTCCTCACTTTAAAGTGGG + Intergenic
1103626535 12:122224799-122224821 CTGAGGCAACATTTTAAACTTGG - Intronic
1104245116 12:127032209-127032231 CTGAGTCACTATTTTAAAATTGG + Intergenic
1106897349 13:34318089-34318111 ATGGGTGATCACATTAAAGTTGG + Intergenic
1108644742 13:52415877-52415899 CTGAGTCATCACGGCAAAGATGG + Exonic
1111191365 13:84811599-84811621 CTGAGTCATCAGTTTAATGATGG + Intergenic
1112208924 13:97353906-97353928 CAGAGCTACCACTTTAAAGTAGG - Intronic
1113084936 13:106559241-106559263 CTGACTGATAACTTAAAAGTTGG - Intronic
1115899897 14:38133598-38133620 CTGTGTCCTCACTTATAAGTAGG - Intergenic
1120166375 14:81205828-81205850 CTGATTCATCTCTGTAAAGTAGG + Intronic
1120548634 14:85841894-85841916 CAGAGTCATAATTTTAAATTTGG + Intergenic
1120991452 14:90381120-90381142 CTGAATCATCTCTATACAGTAGG + Intergenic
1121485426 14:94310833-94310855 CTCAGTCATCACTTTAAGACTGG - Intronic
1122082705 14:99277060-99277082 TTGAGTCATCAATTCAAATTTGG + Intergenic
1122504662 14:102224559-102224581 CTAATTCATCACATTAAATTGGG + Intronic
1128713726 15:69891721-69891743 CTGGGTGATCACATGAAAGTAGG - Intergenic
1133142583 16:3758592-3758614 CTGAGACTTCACTTTATATTTGG - Intronic
1133385813 16:5369540-5369562 CTGCTTCTTCACTGTAAAGTGGG - Intergenic
1134890443 16:17837092-17837114 CTGAGTCATCACCTAAAAGACGG + Intergenic
1140222214 16:73052071-73052093 CTGACACATCCCTTTACAGTCGG + Intronic
1140258886 16:73360060-73360082 CTGAGTTATCACTTATTAGTTGG + Intergenic
1140270098 16:73457815-73457837 CTGAGTCATCACCATGAAGTAGG - Intergenic
1145949152 17:28802406-28802428 AGCAGTCATCACTTTAAAGCTGG - Intronic
1148222337 17:45871891-45871913 CTGAGTCATCACACGAGAGTGGG + Intergenic
1149128178 17:53260819-53260841 ATAAGTCCTCACTTAAAAGTGGG + Intergenic
1151985034 17:77537136-77537158 CGGCCTCATCACTTTAAAATAGG + Intergenic
1153080782 18:1222127-1222149 CTGAGTCATCAGCTGAGAGTAGG - Intergenic
1153516841 18:5911660-5911682 CTTAGGCAACATTTTAAAGTAGG + Intergenic
1156126748 18:33914923-33914945 GTGAGTCATCACATTACAGATGG + Intronic
1158165153 18:54531884-54531906 CTTAGTCATTACTTTTAATTTGG - Intergenic
1158502292 18:58013593-58013615 GTGAGTCAAAACTTTAAAGGTGG - Intergenic
1162606205 19:11710021-11710043 CTCAGACATCACGTTAAAGAAGG + Intergenic
1162856327 19:13471222-13471244 CTGAGACCTCATTTGAAAGTAGG - Intronic
1166794099 19:45415829-45415851 CTGTTTCCTCACTGTAAAGTGGG + Intronic
1167064614 19:47175133-47175155 CTGAGGCTTGACTTTACAGTAGG - Intronic
1168577388 19:57524527-57524549 CTGATTGTTCACTTTAAAGCTGG + Intergenic
927143987 2:20148986-20149008 CCAAGCCAGCACTTTAAAGTCGG - Intergenic
929132856 2:38595532-38595554 CACAGTCATCACTTAAAAGCTGG + Intronic
930094481 2:47556531-47556553 CAGGGTCACCAATTTAAAGTTGG + Intronic
932929167 2:76013337-76013359 CTGAGTCTTTACTCTAAATTGGG - Intergenic
933243063 2:79944383-79944405 CTGAGTCATCACTTTAAAGTTGG - Intronic
933507494 2:83197189-83197211 TTGATTGATCACTTTAAAGGAGG - Intergenic
940935311 2:159487479-159487501 CTGAATCCTCACCTTCAAGTAGG + Intronic
941155179 2:161969101-161969123 CTGAGACTTGAATTTAAAGTAGG + Intronic
941628189 2:167853806-167853828 CAGAATCTTCATTTTAAAGTAGG - Intergenic
941724545 2:168847051-168847073 CTTAGTCATCCCTTTAATGTTGG - Intronic
942320963 2:174735537-174735559 CTGAGTTAACTCTTTCAAGTAGG + Intergenic
945322471 2:208441112-208441134 CTGAGTAACCACCTTCAAGTTGG + Intronic
946525148 2:220510217-220510239 CTCAGTCATCACTTTGAATGAGG + Intergenic
1170026532 20:11894560-11894582 TTAAATCACCACTTTAAAGTAGG - Intronic
1177308157 21:19348337-19348359 CTGAGCCTTTACTTTATAGTAGG - Intergenic
1177970728 21:27786518-27786540 CTGAGTCATGACTTTTAGTTTGG - Intergenic
1182197607 22:28535169-28535191 ATGACTCATGACTTTACAGTTGG + Intronic
1183270488 22:36859599-36859621 CTGAGTTCTCAGTGTAAAGTGGG - Intergenic
1184964903 22:47964491-47964513 CTGAGTCATCATTCAAAACTTGG - Intergenic
951187361 3:19729491-19729513 CTGTGTTGTCACTTTAAAATGGG + Intergenic
953455734 3:43040641-43040663 CTGGGTCTTCACTTTCAGGTTGG + Intronic
959974263 3:112440377-112440399 CTTATTCATCACTATCAAGTAGG + Intergenic
965628762 3:170709007-170709029 CTCACTCATCACCTTAAAATTGG + Intronic
966548439 3:181178322-181178344 CAGAGGCATCAATGTAAAGTTGG - Intergenic
967120132 3:186375308-186375330 CAGATTCTTCACTTAAAAGTGGG - Intergenic
968322969 3:197787827-197787849 CTCAGTCATCTCCATAAAGTAGG - Intergenic
968800197 4:2738234-2738256 CTGACCCATCACCATAAAGTAGG + Intergenic
969726032 4:8918659-8918681 CTGTGTCTTCACTTTACAGATGG + Intergenic
976538937 4:86250548-86250570 TTGATTCCTCACTTCAAAGTTGG - Intronic
978682113 4:111394229-111394251 CTCAGTCCTCACTTTAAATGAGG - Intergenic
978718816 4:111879739-111879761 CTGAGTCATCCCTTTCAATTTGG + Intergenic
983531950 4:168819449-168819471 CTGAATCTTCTCTTTAAACTGGG - Intronic
983540885 4:168908232-168908254 GTGAGTCATCACTTAAAAATTGG + Intronic
984489282 4:180412099-180412121 TTCAGCCATCACTTTAAACTTGG + Intergenic
986874730 5:12094353-12094375 CTGAAGCATCACATGAAAGTGGG + Intergenic
986957367 5:13169801-13169823 CTGATTCAACACTTAAAAGATGG + Intergenic
987933208 5:24429105-24429127 CTGTTTCATCTTTTTAAAGTTGG - Intergenic
989016974 5:36948047-36948069 TAGAATCATCACTGTAAAGTTGG + Intronic
989101175 5:37824587-37824609 CAAAGTCATCACTTTGAAATAGG - Intronic
991350683 5:65717780-65717802 CACAGTCATGAATTTAAAGTGGG + Intronic
991511216 5:67378515-67378537 CTGAGTCTTCATTTTAACATAGG - Intergenic
993239162 5:85357994-85358016 CAGAGTCATAATTTTAAATTTGG - Intergenic
993582933 5:89685381-89685403 TTCTCTCATCACTTTAAAGTTGG - Intergenic
995654752 5:114413060-114413082 ATGAGTCACAACTTTAAAATGGG + Intronic
995924272 5:117351408-117351430 CTGCGTCATCACATGAAAGAAGG - Intergenic
1000442526 5:161280719-161280741 CTAAGTCATCTCTCTCAAGTTGG + Intergenic
1000919732 5:167123622-167123644 ATGAGGCATCCCTTTAGAGTGGG - Intergenic
1001279197 5:170374252-170374274 CTGAGTCTTCACTGTGAAGAAGG + Intronic
1005176763 6:23055575-23055597 CTGAGTGATGGCTTTACAGTTGG - Intergenic
1006997214 6:38272517-38272539 CAGAGTCATCCATTTAAAATTGG - Intronic
1008058905 6:46975897-46975919 CTAAGTCTTCACTTTAGAGCTGG + Intergenic
1013283619 6:108661763-108661785 CTGGGTCATCACTGTCAACTGGG + Intronic
1014735303 6:125087633-125087655 ATGTGTCATCTCTTTAAATTTGG + Exonic
1015643114 6:135358709-135358731 CTGTGTTATCATTTTAAAGGAGG - Intronic
1016420606 6:143878636-143878658 CTGAATCAACACTATAAAGAAGG + Intronic
1021219952 7:17964028-17964050 CTGAGTTATTATTTTAAAGCAGG - Intergenic
1022451543 7:30520539-30520561 CTGAAACATCACTGTAAAATTGG - Intronic
1028097168 7:86775494-86775516 CTGATTCATTCCTTTCAAGTTGG + Intronic
1028655724 7:93204425-93204447 CTCAGTTAAAACTTTAAAGTAGG + Intronic
1028789818 7:94841414-94841436 CTGAGTCATCACATGACAGAAGG + Intergenic
1028864453 7:95691719-95691741 CTGAACCATCACTATAAAGTGGG - Intergenic
1031025724 7:116677546-116677568 CTGAGTCAACATTTTAAAATTGG - Intronic
1031279958 7:119786465-119786487 ATAAGTTTTCACTTTAAAGTGGG - Intergenic
1033460114 7:141539274-141539296 CTGAGCCATCTGTTTAAATTAGG - Intergenic
1033523365 7:142184793-142184815 CTGAGAAATCACTCGAAAGTTGG + Intronic
1035104414 7:156429959-156429981 CTGAGATTTCATTTTAAAGTAGG + Intergenic
1038134944 8:24775228-24775250 CAGAGTCATCCCTATGAAGTAGG - Intergenic
1039259518 8:35755671-35755693 CTGTTTCATCATTTTACAGTGGG - Intronic
1040790273 8:51220581-51220603 ATAATTCATCACTTTCAAGTTGG + Intergenic
1041116698 8:54546498-54546520 CTATGTCTTCATTTTAAAGTTGG + Intergenic
1041421988 8:57677377-57677399 CTCATTCATCACTGGAAAGTTGG + Intergenic
1041631135 8:60088494-60088516 CTCAGTTAACACTTTAAAGGAGG - Intergenic
1045652403 8:104353351-104353373 CTGAGTCAACACTTTGGTGTGGG - Intronic
1047073423 8:121373459-121373481 CTGTTTCTTCACTTTAAAATGGG + Intergenic
1048658195 8:136566911-136566933 CTAAGTCACCACTATAAAGTAGG + Intergenic
1049364538 8:142230724-142230746 CTGGGTCATCAGTTAAATGTTGG + Intronic
1050333227 9:4566223-4566245 CAGAGACATCACCTTAAACTTGG - Intronic
1050865342 9:10490099-10490121 CTCAGTAGTCAATTTAAAGTAGG + Intronic
1055587788 9:77773662-77773684 GTGAATCGTCACTTTAAAATGGG - Intronic
1055797114 9:79986622-79986644 CTGAGTCATCAGTTTTACCTGGG - Intergenic
1055837343 9:80458988-80459010 CTGAGTCATGAATTTATACTAGG + Intergenic
1056170047 9:83976422-83976444 TTGAGTCTTCATTTTACAGTGGG - Intronic
1057577899 9:96258376-96258398 CTAAGTCAACATTTTAAATTAGG - Intronic
1058212942 9:102195565-102195587 CTGTTTCCTCACTTTAAATTGGG + Intergenic
1058791424 9:108449651-108449673 ATGAGTCTTCACTTTAAATGAGG + Intergenic
1059604600 9:115820623-115820645 CTGAGACATCATCATAAAGTAGG - Intergenic
1187998261 X:24952786-24952808 ATCAGCCATCACTTAAAAGTTGG + Intronic
1190725182 X:53185387-53185409 CTGAATCATCACTTAGAAGAGGG + Intergenic
1194639517 X:96386593-96386615 CTGAGTCAGCACTTGAAACCAGG + Intergenic
1200462095 Y:3469283-3469305 TTGAGTCCTCTGTTTAAAGTTGG + Intergenic