ID: 933245678

View in Genome Browser
Species Human (GRCh38)
Location 2:79972081-79972103
Sequence GGGGCCAACCAGACTCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 231}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933245672_933245678 29 Left 933245672 2:79972029-79972051 CCAAAGTGGCACAGCATCACTTC 0: 1
1: 2
2: 5
3: 35
4: 184
Right 933245678 2:79972081-79972103 GGGGCCAACCAGACTCAGAGAGG 0: 1
1: 0
2: 1
3: 13
4: 231
933245671_933245678 30 Left 933245671 2:79972028-79972050 CCCAAAGTGGCACAGCATCACTT 0: 1
1: 2
2: 5
3: 38
4: 177
Right 933245678 2:79972081-79972103 GGGGCCAACCAGACTCAGAGAGG 0: 1
1: 0
2: 1
3: 13
4: 231
933245674_933245678 7 Left 933245674 2:79972051-79972073 CCAAATCATTCTTTGGTTGCAGC 0: 1
1: 0
2: 0
3: 13
4: 134
Right 933245678 2:79972081-79972103 GGGGCCAACCAGACTCAGAGAGG 0: 1
1: 0
2: 1
3: 13
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933245678 Original CRISPR GGGGCCAACCAGACTCAGAG AGG Intronic
901736513 1:11316006-11316028 GGGAAGAAACAGACTCAGAGGGG - Intergenic
903275201 1:22217131-22217153 GGCTCCACCCACACTCAGAGGGG + Intergenic
903421476 1:23220423-23220445 GGGGCCCACGGGGCTCAGAGTGG + Intergenic
904336156 1:29799706-29799728 GGTGCCCACCAGATTAAGAGTGG - Intergenic
904789542 1:33008664-33008686 TGAGGAAACCAGACTCAGAGAGG - Intronic
904975414 1:34452413-34452435 GGGGCCAAGCCGACCCTGAGAGG + Intergenic
905031687 1:34888302-34888324 TGGGCAAACAAGACCCAGAGAGG + Intronic
905647065 1:39632455-39632477 GGAGCAAATCAGGCTCAGAGAGG + Intronic
905974601 1:42165366-42165388 AGGGACAACGAGACTCAGAGAGG - Intergenic
906948339 1:50314780-50314802 GGAGGCAAGGAGACTCAGAGAGG - Intergenic
916635285 1:166661725-166661747 GTGGCCAACCACACTGAGGGTGG - Intergenic
917834695 1:178932068-178932090 GGGGCCAAACTGACCCTGAGAGG - Intergenic
919318275 1:196001865-196001887 GGGCCCAACCAGATTGAGAGTGG - Intergenic
919974509 1:202602063-202602085 GGGCACAAGCAGAATCAGAGGGG + Intronic
920872385 1:209805464-209805486 TGTGCCAAACAGACTCAGGGAGG + Intronic
920969074 1:210726991-210727013 AGGGTCAGCCAGACTGAGAGTGG - Intronic
923559597 1:235028482-235028504 GAGGAAAACCAGGCTCAGAGAGG + Intergenic
1064469257 10:15618604-15618626 GGTGCCCACCAGATTCAGGGTGG - Intronic
1067006309 10:42666908-42666930 GAGGCCCATCAGACTAAGAGCGG + Intergenic
1068151254 10:53135252-53135274 GCAGCCAAACAGATTCAGAGTGG - Intergenic
1071882573 10:89915518-89915540 GGGGACAATGAGACACAGAGAGG + Intergenic
1071915589 10:90291490-90291512 GTGGGAAACAAGACTCAGAGAGG + Intergenic
1072764604 10:98085202-98085224 GGGGAAAATGAGACTCAGAGAGG + Intergenic
1072779204 10:98233897-98233919 GGGGGCAACTATAATCAGAGAGG - Intronic
1074104007 10:110375504-110375526 GAGGAAAACAAGACTCAGAGAGG + Intergenic
1074531147 10:114299724-114299746 GTGCCCACCCAGACTGAGAGCGG - Intronic
1075441138 10:122480227-122480249 GGGGCCAGCCACACTAAGAAAGG - Intronic
1075589404 10:123680419-123680441 GGGGGCACCAAGGCTCAGAGAGG + Intronic
1076660099 10:132050188-132050210 GAGGCAAACCCGGCTCAGAGAGG - Intergenic
1077356402 11:2120922-2120944 GGAGCCAGCCAGCCTGAGAGTGG + Intergenic
1078921842 11:15837913-15837935 GGGGACACTGAGACTCAGAGAGG - Intergenic
1079183991 11:18220433-18220455 AGGGCAAACCAGGCACAGAGTGG + Intronic
1082136758 11:48557941-48557963 GAAGCCAATCAGACTCACAGCGG - Intergenic
1082809772 11:57472617-57472639 GGGTCCATCGAGGCTCAGAGTGG - Intronic
1083436722 11:62648088-62648110 GGGTCCATGCAGCCTCAGAGAGG + Exonic
1084667463 11:70584129-70584151 GGGGCCAACCAAGGGCAGAGTGG - Intronic
1085756805 11:79208634-79208656 GGGGCCACAGAGCCTCAGAGAGG - Intronic
1089291142 11:117438620-117438642 TGGGAAACCCAGACTCAGAGAGG + Intronic
1089705022 11:120271690-120271712 GGGGCCTCCCAGGGTCAGAGGGG - Intronic
1092140966 12:6183151-6183173 GGGGCCACCCAGCCACAAAGAGG + Intergenic
1092287547 12:7137469-7137491 GGGGCCAACCAGTCCCAGGATGG - Intronic
1093847180 12:23987323-23987345 GGAGCCAGCCATACACAGAGTGG + Intergenic
1096229363 12:49888753-49888775 GAGGCCCGCCAGACCCAGAGGGG - Intronic
1096601082 12:52730086-52730108 GGGGCCTTACAGCCTCAGAGAGG + Intergenic
1096977067 12:55705524-55705546 AGGGCCACCCAGATTGAGAGGGG - Intronic
1097147410 12:56951291-56951313 GTGGGAACCCAGACTCAGAGAGG + Intergenic
1097437512 12:59569772-59569794 GTGCCCAACCAGACTAAGGGTGG + Intergenic
1101521075 12:105482932-105482954 GGTGGGAAACAGACTCAGAGAGG + Intergenic
1103898575 12:124291198-124291220 GGAGCCATGGAGACTCAGAGAGG - Intronic
1104003525 12:124875656-124875678 GGGGCACCCAAGACTCAGAGGGG - Intronic
1104322880 12:127768549-127768571 AGTGCTAACCAGATTCAGAGGGG + Intergenic
1104682565 12:130761627-130761649 AGGCCCAACCAGGCTCAGGGAGG - Intergenic
1106296206 13:28416164-28416186 GAGGAAACCCAGACTCAGAGAGG + Intronic
1107784159 13:43937665-43937687 GGGGCCACTGAGGCTCAGAGAGG + Intergenic
1109521201 13:63512302-63512324 AGGGCAAGCCAGGCTCAGAGGGG - Intergenic
1110810691 13:79808084-79808106 TGGGACAACCAGAAGCAGAGAGG + Intergenic
1112242221 13:97693698-97693720 GGGGCCAAGCTGACTCAGTCTGG + Intergenic
1113970062 13:114181836-114181858 GGGGCCACTCAGGCTCTGAGGGG - Intergenic
1114038505 14:18653152-18653174 GTGACCACCCAGACTGAGAGTGG + Intergenic
1117491318 14:56250718-56250740 GGGCCCATCCAGATTGAGAGTGG + Intronic
1118010695 14:61607868-61607890 GTGACCATCCAGACTCACAGTGG + Intronic
1119380833 14:74227284-74227306 GGGGCAAACAAGACTTAGAAAGG - Intergenic
1121569945 14:94940090-94940112 GGGCTCAACCAGACTCACTGCGG - Intergenic
1121569954 14:94940142-94940164 GGGCTCAACCAGACTCACTGCGG - Intergenic
1121569989 14:94940346-94940368 GGGCTCAACCAGACTCACTGCGG - Intergenic
1122378391 14:101284765-101284787 GGGCCCACCCAGACTGAGGGTGG - Intergenic
1124136172 15:27038107-27038129 GTGGCCAACCGGACTGAGATGGG - Intronic
1126113364 15:45187952-45187974 GGGGCCAGCCAGACTGAGCGAGG + Intronic
1128541244 15:68535109-68535131 GGTGCCTAGGAGACTCAGAGAGG - Intergenic
1129067029 15:72913993-72914015 GGTGCCCACCAGACTAAGGGTGG + Intergenic
1129386002 15:75196367-75196389 GGGGCAAATGAGACGCAGAGAGG - Intronic
1129390960 15:75220758-75220780 GGGGCCAAGGAGAGTCACAGGGG - Intergenic
1129473352 15:75767113-75767135 GGGGCCAAGGAGAGTCACAGGGG + Intergenic
1129726708 15:77905106-77905128 GGTGCCAGCCAGAGGCAGAGTGG + Intergenic
1129731585 15:77935512-77935534 GGGGCCAAGGAGAGTCACAGGGG + Intergenic
1130486516 15:84401357-84401379 GGTGCCAGCCAGAGGCAGAGTGG - Intergenic
1131055444 15:89371906-89371928 GGGGGCAGCCAAAGTCAGAGCGG - Intergenic
1133998678 16:10766229-10766251 GGGGCCATCGAGGCTGAGAGCGG - Intronic
1136003656 16:27314122-27314144 GGGACCACCCCGACTCCGAGCGG + Intronic
1136013785 16:27382234-27382256 TAGGCCAACCTGACTCAGGGGGG + Intergenic
1136254473 16:29029077-29029099 GGGGCAACTGAGACTCAGAGAGG - Intergenic
1136746536 16:32596405-32596427 GGGGCCAGCCACCCTCATAGAGG + Intergenic
1139116728 16:63963333-63963355 GTGCCCAACCAGACTGAGAGTGG - Intergenic
1139970540 16:70771397-70771419 GGGGCCAACAAGACCCACAAGGG - Intronic
1140116140 16:72043220-72043242 GGTGCCAGCCAGATGCAGAGAGG - Intergenic
1141267641 16:82511377-82511399 GGGCCCACCCAGATTAAGAGTGG - Intergenic
1141275743 16:82586533-82586555 GTGCCCACCCAGACTGAGAGTGG - Intergenic
1141876080 16:86825416-86825438 GGGGACATTGAGACTCAGAGAGG - Intergenic
1142142038 16:88476786-88476808 GGGGCCAACCTGAGCCAGGGAGG + Intronic
1142216472 16:88832348-88832370 GGTGTCAGCAAGACTCAGAGAGG + Intronic
1203048665 16_KI270728v1_random:855609-855631 GGGGCCAGCCACCCTCATAGAGG + Intergenic
1142866171 17:2792758-2792780 GGGGGAAACCAGCCTCAGGGTGG + Intronic
1144060905 17:11582929-11582951 GGGGACAACCAGCTGCAGAGAGG - Intergenic
1145118320 17:20232401-20232423 GGTGCCCACCAGACTCACGGAGG - Exonic
1146506034 17:33406091-33406113 GGGGCACACCAGAGCCAGAGTGG - Intronic
1149663198 17:58347054-58347076 GGGGGGAACCAGGCACAGAGAGG - Intronic
1150529172 17:65958955-65958977 GGGGACAACCAGCTGCAGAGGGG + Intronic
1151152686 17:72101405-72101427 GGGGCCACCCAGGGTCAGAAAGG - Intergenic
1151549525 17:74814145-74814167 GGAGCCAAGCAGACTGAGAGTGG + Intronic
1151604924 17:75130133-75130155 GGGGACCACTGGACTCAGAGGGG + Exonic
1155368056 18:25068778-25068800 GGAGCCAGCCAGACTCATAATGG - Intronic
1156298756 18:35817593-35817615 GGGGACAACCAGCTGCAGAGAGG - Intergenic
1156458323 18:37307132-37307154 GGGGACAACCAGGCTGGGAGTGG - Intronic
1156475357 18:37402458-37402480 GGGTCCACCCAGGCTCAAAGGGG - Intronic
1160126666 18:76180089-76180111 GGGCCCACCCAGATTGAGAGTGG + Intergenic
1160969281 19:1760272-1760294 TAGGCCCACCAGACTCAGCGGGG - Intronic
1161167834 19:2797877-2797899 GAGGCAACCAAGACTCAGAGAGG + Intronic
1161205998 19:3041835-3041857 GGGGGCAGCCAGGCCCAGAGAGG + Intronic
1161401838 19:4069286-4069308 GGTGAGAACCTGACTCAGAGGGG + Intergenic
1161717140 19:5882452-5882474 TGGGCCCCCCAGACGCAGAGGGG + Intronic
1162389137 19:10378567-10378589 GTGGAAAACGAGACTCAGAGAGG - Intronic
1164560661 19:29289861-29289883 GGGGAAAATGAGACTCAGAGGGG - Intergenic
1164915858 19:32051947-32051969 GGGGCCACTAAGGCTCAGAGAGG - Intergenic
1164931380 19:32178715-32178737 GTGTCCAGCCAAACTCAGAGTGG + Intergenic
1165786998 19:38467579-38467601 GAGGCCAGGCAGAGTCAGAGAGG - Intronic
1165845042 19:38812753-38812775 GGGGCCCCCCAGGATCAGAGTGG + Intronic
1166781961 19:45347688-45347710 GGGGCCTGCCAGGCTCATAGCGG - Intronic
925915353 2:8600593-8600615 GGGTCCAGCCTGCCTCAGAGGGG - Intergenic
926383072 2:12310396-12310418 AGGGTCAATCAAACTCAGAGAGG - Intergenic
926399769 2:12485514-12485536 CTGGCCAACCAGATTCAGAGGGG - Intergenic
927438395 2:23090152-23090174 GTGCCCAACCAGACTGAGGGTGG - Intergenic
929447089 2:42010271-42010293 GGGGAAACCAAGACTCAGAGAGG + Intergenic
930269909 2:49243936-49243958 GAAGCCCACCAGACTAAGAGTGG + Intergenic
931177499 2:59868684-59868706 GGGGCCATGGAGACCCAGAGTGG + Intergenic
932607579 2:73175516-73175538 GGGTCCTTCCGGACTCAGAGCGG - Intergenic
933245678 2:79972081-79972103 GGGGCCAACCAGACTCAGAGAGG + Intronic
936141942 2:109948181-109948203 GGGGCCATCCTCACTCAGTGAGG + Intergenic
936989416 2:118346697-118346719 GGAGCCAACTGCACTCAGAGTGG - Intergenic
938662806 2:133504846-133504868 GGGGGAAAAAAGACTCAGAGGGG - Intronic
945448037 2:209961180-209961202 GGGGACAGCAAGAGTCAGAGAGG + Intronic
946570136 2:221015404-221015426 TGGGACATCCAGACTCAGACAGG - Intergenic
1169960999 20:11159954-11159976 GGGGCAAAACAAACTCAGACAGG + Intergenic
1170342452 20:15344614-15344636 TGTGCTAACCAGACTCACAGAGG + Intronic
1171086868 20:22245627-22245649 GAGGTAAAACAGACTCAGAGAGG + Intergenic
1172836958 20:37879229-37879251 GGGGCTGAGCCGACTCAGAGTGG - Intergenic
1173434169 20:43017502-43017524 GGGGACAAACAGATGCAGAGGGG - Intronic
1173925595 20:46778884-46778906 GGGGCTAATGAGACTCAGACTGG + Intergenic
1174099381 20:48115571-48115593 AGGTCCAAGCAGAGTCAGAGAGG - Intergenic
1174361966 20:50034615-50034637 CGGACCAACCAGACCCACAGAGG - Intergenic
1176241126 20:64076456-64076478 GGGGCCAAGCAGACCCAGGAGGG - Intronic
1179067536 21:38040074-38040096 GGTCCCACCCAGACTCAAAGGGG - Intronic
1182032002 22:27166617-27166639 GGGTCAAGCAAGACTCAGAGAGG + Intergenic
1182570083 22:31230473-31230495 GGGGCCATCAAGACTAATAGGGG - Intronic
1183300090 22:37054612-37054634 GGGGGCATGCAGACACAGAGGGG - Intronic
1183590227 22:38775660-38775682 GGGCCCAGCCAGAGTCAGTGTGG - Intronic
1184423973 22:44398247-44398269 GGTGCCCACCAGATTAAGAGTGG + Intergenic
1184774087 22:46614906-46614928 GGGGGAAACCAGACGCACAGGGG - Intronic
950652611 3:14416635-14416657 GGGACCAAGCAGGCACAGAGTGG - Intronic
951182250 3:19672142-19672164 GGGGACAACCAGCTGCAGAGAGG - Intergenic
951526395 3:23657041-23657063 GTGGCCAAGCTGACTCAGTGAGG + Intergenic
952594057 3:34993199-34993221 AGTGCCAACCAGACTCTTAGGGG + Intergenic
953484186 3:43279331-43279353 GGTTTCACCCAGACTCAGAGGGG + Intergenic
953603178 3:44387650-44387672 AGGGCCAGCCAGGCACAGAGTGG - Intronic
956086680 3:65618817-65618839 AGGGTCAACGAGATTCAGAGAGG + Intronic
957306222 3:78461684-78461706 GTGGCTCACCAGCCTCAGAGGGG + Intergenic
959387695 3:105732728-105732750 GGGGGCTGACAGACTCAGAGGGG - Intronic
959775107 3:110150195-110150217 GTGCCCACCCAGACTGAGAGCGG - Intergenic
960011122 3:112835439-112835461 TGGGCCAACCAGCTGCAGAGAGG - Intronic
961493633 3:127274827-127274849 GGGGCCAACCAGTTGCAGAGAGG + Intergenic
969428103 4:7137739-7137761 GGGGCCACCCTGCCTCAGTGAGG + Intergenic
969448787 4:7260901-7260923 GGGGACACCGAGGCTCAGAGAGG + Intronic
969569460 4:8000117-8000139 GGAGACACCAAGACTCAGAGAGG - Intronic
969600812 4:8175166-8175188 GGGGACACCCAGGCTCAGAGAGG + Intergenic
969630468 4:8332967-8332989 GGGGCCTTCCAGACGCAGTGAGG - Intergenic
974521489 4:62986909-62986931 AGGGCAAACCAGGCACAGAGTGG + Intergenic
975254323 4:72216055-72216077 TGGGACAACCTGACTAAGAGAGG - Intergenic
979297753 4:119052459-119052481 GGGGCCAGACAGGCCCAGAGAGG - Intronic
981427146 4:144616580-144616602 AGGGCCAACCAGCCCCGGAGGGG + Intergenic
984400701 4:179260511-179260533 GTGCCCAACCAGATTGAGAGTGG - Intergenic
984696793 4:182787270-182787292 TGGACAAAACAGACTCAGAGGGG + Intronic
985310540 4:188593056-188593078 GGGCCCAATTAGGCTCAGAGAGG - Intergenic
990594625 5:57300463-57300485 GTGGCCACCCAGACTGAGAGTGG - Intergenic
991252800 5:64582476-64582498 GAGGACAAGCAGAGTCAGAGGGG - Intronic
992693081 5:79259102-79259124 TGGGACAACCAGCTTCAGAGAGG - Intronic
996620969 5:125502196-125502218 GGGACCAACCAGCCTAAGGGAGG - Intergenic
999319067 5:150602054-150602076 TGGGCCATCCAGACTCATCGGGG + Intronic
999799383 5:155019393-155019415 GGGGACAACCAGCTGCAGAGCGG - Intergenic
1000351569 5:160356782-160356804 GGGGCCAAGCAGAGTCTGAAGGG - Intronic
1001762060 5:174215609-174215631 GGGGTCAACCAGAATCAAACAGG - Intronic
1002092909 5:176815261-176815283 GGGCCCAACCACGCTCAGACAGG + Intronic
1002102278 5:176863496-176863518 GGGGCCAGCCAGACTCAGCTGGG + Intronic
1002318422 5:178360599-178360621 GGGGACACCGAGGCTCAGAGAGG - Intronic
1002445712 5:179288640-179288662 TGGGCCAACCACCCACAGAGGGG - Intronic
1002865162 6:1115352-1115374 AGGGCCAACCACACTGAAAGAGG - Intergenic
1003268019 6:4583607-4583629 GGGAACCACCACACTCAGAGTGG + Intergenic
1006335635 6:33419067-33419089 GGGGCCAATGAGAGGCAGAGAGG + Intergenic
1007380471 6:41487280-41487302 GGGGAAAACGAGATTCAGAGGGG + Intergenic
1007507381 6:42346432-42346454 GGAGCCAACCAGAGCCAGAGAGG + Intronic
1007649996 6:43413332-43413354 GGGGACAACCAGGAGCAGAGAGG + Intergenic
1008496939 6:52143689-52143711 GTGGCCATCCAGACCCTGAGTGG + Intergenic
1008627703 6:53334318-53334340 GAGACCAACCAGAGCCAGAGAGG + Intronic
1012068595 6:94581445-94581467 AGGCCAAACCAGACTCAGACTGG + Intergenic
1012101013 6:95085103-95085125 AGGGCAAGCCAGACCCAGAGCGG - Intergenic
1016435761 6:144035513-144035535 GTGCCCAACCAGACTGAGGGTGG + Intronic
1017168308 6:151431161-151431183 GGGGACACACAGGCTCAGAGAGG + Intronic
1017761187 6:157570855-157570877 GGGGCTGCCCAGACTCAGAAGGG - Intronic
1018447048 6:163867506-163867528 GGGCCCACCCAGATTCAGACGGG - Intergenic
1019510324 7:1414429-1414451 GAGGCTAACAAGGCTCAGAGAGG - Intergenic
1019910819 7:4099727-4099749 AGGGCCAAGCAGGCACAGAGTGG + Intronic
1020124666 7:5526792-5526814 GGTGCCAACCAGCCCCAGTGAGG + Intergenic
1021147400 7:17106165-17106187 GTGGCCACCCACACTGAGAGTGG + Intergenic
1023105837 7:36762559-36762581 GGGGCTCAGCAGATTCAGAGAGG - Intergenic
1025197719 7:56945456-56945478 GGGGCCAACCACCCTCATGGCGG + Intergenic
1026867105 7:73830693-73830715 GGGGGCAACCAGACCCAGCCAGG - Exonic
1026876917 7:73884713-73884735 GGGTACAGCCAGACTCAAAGAGG - Intergenic
1026924138 7:74177905-74177927 GGGGAAAACGAGGCTCAGAGAGG - Intronic
1028379909 7:90188449-90188471 GGGGCCAGCCACACCCAGATGGG - Intronic
1029271703 7:99380882-99380904 GGGGCCAACCAGAGCCTGGGTGG + Intronic
1029605033 7:101593503-101593525 AGGGAAAACCAGACACAGAGAGG + Intergenic
1029612686 7:101635754-101635776 GGGGACACGCAGACCCAGAGAGG - Intergenic
1030078454 7:105757089-105757111 GGGGCCAAAAAGACATAGAGGGG + Intronic
1031952957 7:127911013-127911035 GGGGCCAACCATATTTAGAGAGG - Intronic
1032067669 7:128783689-128783711 GGGGCCAAACTGACCAAGAGTGG + Intergenic
1032839124 7:135700241-135700263 TGGACCAAGCAGGCTCAGAGAGG - Intronic
1035160321 7:156945140-156945162 GGGGGGACCCTGACTCAGAGGGG - Intergenic
1035377796 7:158416904-158416926 AGGGCAATCCAGACTCAGAAAGG + Intronic
1036652016 8:10650379-10650401 GGGGCCAACAAGACACAGAGCGG + Intronic
1036915418 8:12799574-12799596 TGGGACAACCAGCCGCAGAGAGG - Intergenic
1039078199 8:33711285-33711307 GGGTGAAACCAGACTTAGAGTGG + Intergenic
1042410646 8:68461565-68461587 GGAGCCCATCAGACTAAGAGCGG + Intronic
1043021240 8:75002662-75002684 GAGGCCAAGAGGACTCAGAGGGG + Intronic
1044150374 8:88769566-88769588 GTGCCCAACCAGATTAAGAGTGG - Intergenic
1045808492 8:106193702-106193724 AGGGCCAGCCAGAGTCATAGAGG - Intergenic
1046775506 8:118159417-118159439 AGGGCAAACCAGACAAAGAGTGG - Intergenic
1050569013 9:6918174-6918196 GGGGACTACCAGAATGAGAGAGG - Intronic
1050759667 9:9052080-9052102 GGAGCCACACAGACTCAGTGTGG + Intronic
1050933811 9:11366973-11366995 GGTGCCAACCAAAAGCAGAGTGG - Intergenic
1053307268 9:36993804-36993826 GGGGCCAACCAGTAAAAGAGTGG - Intronic
1056607501 9:88098660-88098682 GGGCACCACCAGTCTCAGAGGGG - Intergenic
1057276929 9:93680992-93681014 GGGGCCGGCCAGACTGAGGGTGG - Intergenic
1058818773 9:108709923-108709945 TGGCACAACTAGACTCAGAGAGG + Intergenic
1059798959 9:117730451-117730473 GGGGCCATGCAGTCACAGAGTGG - Intergenic
1060821336 9:126663092-126663114 GAGGTCAACAAGGCTCAGAGAGG - Intronic
1062128231 9:134877963-134877985 GGTGCCCACCAGACTGAGGGTGG - Intergenic
1185868346 X:3642424-3642446 GGGGACACACAGACACAGAGAGG + Intronic
1188986332 X:36771738-36771760 GGGGGCAGCCAGACTTAGAGAGG - Intergenic
1190114088 X:47614376-47614398 GGAGCCACCCAGACCAAGAGTGG + Intronic
1190322391 X:49186655-49186677 GTGGCCAACTGGACTGAGAGGGG + Intergenic
1192087131 X:68111519-68111541 ATGACCAAACAGACTCAGAGAGG + Intronic
1193610722 X:83628915-83628937 GGAGCCCATCAGACTAAGAGTGG - Intergenic
1196019876 X:110980271-110980293 GGTTCCACCCACACTCAGAGGGG + Intronic
1199614812 X:149647974-149647996 CGGGACAACCAGCTTCAGAGAGG + Intergenic
1199875036 X:151922214-151922236 GGGGACAGCCAGACTCTGTGGGG - Intronic
1199894341 X:152116985-152117007 GGGGACAGCCAGACTCTGTGGGG + Intergenic
1202369050 Y:24185208-24185230 GGTGCCAGCCAGAGGCAGAGTGG - Intergenic
1202501735 Y:25484909-25484931 GGTGCCAGCCAGAGGCAGAGTGG + Intergenic