ID: 933249070

View in Genome Browser
Species Human (GRCh38)
Location 2:80008286-80008308
Sequence GAGCACAGTGGGGTGACTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 258}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933249070_933249077 -8 Left 933249070 2:80008286-80008308 CCCGCAGTCACCCCACTGTGCTC 0: 1
1: 0
2: 1
3: 18
4: 258
Right 933249077 2:80008301-80008323 CTGTGCTCTTAAGGAGGATTTGG 0: 1
1: 0
2: 1
3: 9
4: 138
933249070_933249079 -4 Left 933249070 2:80008286-80008308 CCCGCAGTCACCCCACTGTGCTC 0: 1
1: 0
2: 1
3: 18
4: 258
Right 933249079 2:80008305-80008327 GCTCTTAAGGAGGATTTGGGAGG 0: 1
1: 0
2: 0
3: 12
4: 176
933249070_933249082 20 Left 933249070 2:80008286-80008308 CCCGCAGTCACCCCACTGTGCTC 0: 1
1: 0
2: 1
3: 18
4: 258
Right 933249082 2:80008329-80008351 AGAACTGAACCCCTGTGGTGAGG 0: 1
1: 0
2: 1
3: 17
4: 206
933249070_933249078 -7 Left 933249070 2:80008286-80008308 CCCGCAGTCACCCCACTGTGCTC 0: 1
1: 0
2: 1
3: 18
4: 258
Right 933249078 2:80008302-80008324 TGTGCTCTTAAGGAGGATTTGGG 0: 1
1: 0
2: 0
3: 20
4: 164
933249070_933249080 -3 Left 933249070 2:80008286-80008308 CCCGCAGTCACCCCACTGTGCTC 0: 1
1: 0
2: 1
3: 18
4: 258
Right 933249080 2:80008306-80008328 CTCTTAAGGAGGATTTGGGAGGG 0: 1
1: 0
2: 2
3: 12
4: 163
933249070_933249081 15 Left 933249070 2:80008286-80008308 CCCGCAGTCACCCCACTGTGCTC 0: 1
1: 0
2: 1
3: 18
4: 258
Right 933249081 2:80008324-80008346 GAGGGAGAACTGAACCCCTGTGG 0: 1
1: 0
2: 2
3: 17
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933249070 Original CRISPR GAGCACAGTGGGGTGACTGC GGG (reversed) Intronic
900935762 1:5765486-5765508 GAGCAAAGTGGGCTCACTACTGG + Intergenic
902559545 1:17268557-17268579 GAGTACAGTGGCGTGACCTCGGG + Intronic
903032039 1:20470739-20470761 GGACACAAGGGGGTGACTGCAGG - Intergenic
903381288 1:22898683-22898705 GAGACCAGTGGGGTGGCTGTTGG + Intronic
904307273 1:29598389-29598411 GAACTCAGTGGTGGGACTGCTGG - Intergenic
904373734 1:30066558-30066580 GAGTACAGTGGGGAGCCTGGGGG - Intergenic
904681503 1:32232629-32232651 GAGAACAGTGAGGCGGCTGCCGG + Intergenic
907274907 1:53311594-53311616 GAGCACACTGGGGAGGCTGGGGG - Intronic
909463228 1:75943241-75943263 GTGCACAGTGGCTTCACTGCTGG - Intergenic
911556551 1:99352351-99352373 GAGAACAGTGCGCTCACTGCAGG + Intergenic
912382691 1:109255813-109255835 GAGAGCAGTGGGTTGACTGTTGG + Intronic
915543257 1:156582048-156582070 GAGCACTGAGAGGCGACTGCTGG + Exonic
916796892 1:168175859-168175881 TAGCACAATAGGGTGACTACAGG + Intergenic
917499307 1:175571678-175571700 GAGGTTAGTGGGGTGACAGCAGG - Intronic
917567628 1:176229510-176229532 GAGCACAGAGGGTATACTGCAGG + Intergenic
919610596 1:199741381-199741403 GGGCTCAGTTGGGAGACTGCTGG - Intergenic
920044528 1:203124815-203124837 GCCCACAGTGGGGAGGCTGCAGG + Intronic
920068051 1:203282973-203282995 GAGAGCAGAGGGGTGACTGACGG + Intergenic
920626889 1:207611367-207611389 GAGCACAGAGTCGTGAGTGCGGG - Intronic
923870744 1:237991703-237991725 GATCACTGGGGGGTGACTGAGGG - Intergenic
924777431 1:247119724-247119746 GAGTCCAGTGGGGTCCCTGCTGG - Intergenic
924787096 1:247209166-247209188 GGGCACAGTGTGGTGGCTCCTGG - Intergenic
1063837425 10:10031180-10031202 GAGTACAGAGGGGTGCCTACAGG - Intergenic
1065442444 10:25766727-25766749 GGGCACAGTGGGGTGGCTTGGGG - Intergenic
1067069659 10:43122342-43122364 GACCACAGGAGGGTAACTGCTGG - Intronic
1067079844 10:43206663-43206685 GAGCACAGTGGTCTGACTTACGG + Intronic
1067245264 10:44536287-44536309 CAGCCCAGAGGGGAGACTGCAGG - Intergenic
1067730256 10:48805489-48805511 GAGCACAATGGGGAGAGAGCTGG - Intronic
1068743423 10:60501196-60501218 GAGGACAGTGGGCTGAGAGCAGG + Intronic
1069610955 10:69772232-69772254 CAGCACAGTGGGGAGATTGGTGG + Intergenic
1072728235 10:97827940-97827962 GAAATCAGTGGGATGACTGCAGG - Intergenic
1073231169 10:101971497-101971519 GAGAGCAGTGGTGTGATTGCGGG - Intronic
1073380958 10:103077790-103077812 GAGCTCAGAGAGGTGATTGCAGG - Exonic
1074137090 10:110637234-110637256 GAGGCCAGTGGTGTGACTGTAGG - Intergenic
1075468753 10:122672246-122672268 GGTCACAGTGGGGCCACTGCAGG - Intergenic
1076807399 10:132865951-132865973 GTGCACAGTGGAGGGACTGCGGG - Intronic
1077187864 11:1243491-1243513 GCGCACCGTGTGGGGACTGCTGG - Exonic
1077188285 11:1245162-1245184 GCGCACCGTGTGGGGACTGCTGG - Exonic
1077188820 11:1247262-1247284 GCGCACCGTGTGGGGACTGCTGG - Exonic
1077189239 11:1248933-1248955 GCGCACCGTGTGGGGACTGCTGG - Exonic
1077474037 11:2778085-2778107 GACCACAGGGAGGTGCCTGCTGG - Intronic
1077556098 11:3226876-3226898 CAGCACAGTGGGGTGGCTAGCGG + Intergenic
1078317644 11:10305996-10306018 GAGCCCGGTGGGGTAGCTGCTGG - Exonic
1081133085 11:39404377-39404399 GAGCATAGAGGGGTGACTTGTGG - Intergenic
1082014842 11:47477307-47477329 GAGCACGCTGAGGGGACTGCTGG + Exonic
1083748911 11:64750579-64750601 GATCACTGTGGGGTGGCAGCAGG + Exonic
1083952875 11:65966505-65966527 GAGCACAGTGGGGCCCCGGCTGG + Exonic
1084506915 11:69574252-69574274 GAGCACCATGGGGAGAATGCAGG + Intergenic
1084780122 11:71402543-71402565 GGGGACAGTGGGGAGACAGCAGG + Intergenic
1085543178 11:77291454-77291476 TAGCATAGTAGGGTGACTACAGG + Intronic
1087591595 11:100196035-100196057 GAGCCAAGTGGGGTGACTCAAGG + Intronic
1087915114 11:103800860-103800882 GAGTACAGTGGGCTGACAACAGG + Intergenic
1088588328 11:111379384-111379406 GCGCACAGTGGGGTGACAGGCGG - Exonic
1091622219 12:2097796-2097818 GGGCAGAGCGGGGTGGCTGCTGG + Intronic
1092045382 12:5428819-5428841 GAGCTCAGTGGACTGAATGCTGG - Intergenic
1092547928 12:9467802-9467824 GAGCAGACTGGGCTCACTGCAGG - Intergenic
1093118153 12:15236051-15236073 GAGCACAGTTATGTGACAGCTGG - Intronic
1094505058 12:31054564-31054586 GAGCAGACTGGGCTCACTGCAGG + Intergenic
1096741611 12:53697547-53697569 GAGCACAGTGGGGTGGTGGGGGG + Intergenic
1097411399 12:59257660-59257682 AATCACAGTGGGGTTACTGTGGG - Intergenic
1101745537 12:107538709-107538731 GAGGACAGCGGGGTGGCTGATGG - Intronic
1101816620 12:108150777-108150799 AAGCCCAGTGGGGTTGCTGCTGG + Intronic
1102677025 12:114665896-114665918 GAGCGCAGTCCGGGGACTGCAGG - Intergenic
1105425783 13:20293641-20293663 GAGAACAGATGAGTGACTGCGGG - Intergenic
1106571333 13:30930727-30930749 CAGCACAGTGAGGTGGGTGCTGG + Intergenic
1107194374 13:37630886-37630908 CAGCACAGTGAGTTGTCTGCTGG + Intergenic
1108071671 13:46635193-46635215 GAGCACGGCGGTGTGAGTGCTGG - Intronic
1112333931 13:98498710-98498732 GTGTACAGTGGGGAGACGGCAGG - Intronic
1113069390 13:106405790-106405812 GTGCACAGTGGGATCACTTCAGG - Intergenic
1115390461 14:32849038-32849060 TAGCACAGCAGGGTGACTACAGG - Intergenic
1121780231 14:96617562-96617584 GAGACCACTGGGGTGACTGTGGG + Intergenic
1122738530 14:103857438-103857460 GAGCAGAGTTGGGGCACTGCCGG - Intergenic
1122886402 14:104712331-104712353 GTGCACAGTGGGGTGCCGGGGGG + Intronic
1123403908 15:20009514-20009536 GAGACCAGGGTGGTGACTGCAGG + Intergenic
1123513248 15:21016160-21016182 GAGACCAGGGTGGTGACTGCAGG + Intergenic
1124146716 15:27134551-27134573 GAGCCCAGTGTGGTGACCACAGG - Intronic
1126635080 15:50771974-50771996 GAGCACAGTGGTGTGATCTCAGG - Intergenic
1127503675 15:59578118-59578140 GGCCACAGTGGGGACACTGCAGG - Intergenic
1128106606 15:65050008-65050030 GAGCACAGTGAGGGGGCTCCCGG + Exonic
1128703626 15:69822223-69822245 CAGCAGAGCGGGGTGCCTGCAGG + Intergenic
1129541613 15:76354105-76354127 CAGCACTGTGGGGTGGCGGCCGG + Exonic
1129776636 15:78241229-78241251 GAGCACACTGTGGTGGCTGCCGG - Intronic
1131261893 15:90891914-90891936 GAGCACACTGAGATGACTACGGG - Intronic
1132290934 15:100703515-100703537 GGGCCCAGTGGGGAGTCTGCTGG + Intergenic
1132392242 15:101447474-101447496 GAGCAGAATGGGGAGGCTGCTGG - Intronic
1133709351 16:8386268-8386290 GATCCCTGTGGGGAGACTGCAGG - Intergenic
1135256302 16:20944340-20944362 GAGCACTGTGGCCTTACTGCCGG - Intronic
1136028276 16:27484106-27484128 GAGCACACTGAGGTGTCTGATGG - Intronic
1138982537 16:62287479-62287501 AAGCACAATGATGTGACTGCTGG + Intergenic
1139670712 16:68491079-68491101 GAGCACTGTGAGGTGACGGTGGG + Intergenic
1139954830 16:70688130-70688152 GCTCACAGGGGGGTTACTGCTGG + Intronic
1141126539 16:81404585-81404607 GAGGACAGTTAGGAGACTGCTGG - Intergenic
1141384108 16:83603637-83603659 GAGAGCAGTGGGGCAACTGCAGG - Intronic
1141611313 16:85182562-85182584 GCGCCCAGGGGTGTGACTGCTGG + Intronic
1144727127 17:17507550-17507572 GCCCACAGTGGGGTCGCTGCTGG - Intronic
1144802455 17:17939322-17939344 AAGTACAGTGAGGTGACTGTGGG - Intronic
1148468585 17:47879299-47879321 GAGCACAGGAAGCTGACTGCTGG + Intergenic
1150227984 17:63534097-63534119 CACCACAGTGAGGGGACTGCAGG - Exonic
1151473560 17:74332575-74332597 GAGCAGAGGGGGGTGGCAGCAGG - Intronic
1151794041 17:76330517-76330539 GAGGACAATGGGGTGTTTGCTGG + Intronic
1152108311 17:78343119-78343141 GAGCACAGTGGGGTGGGGGAGGG + Intergenic
1152657594 17:81527243-81527265 GAGGACAGGGGAGTGACTCCAGG + Intergenic
1152900820 17:82940087-82940109 GAGCAGAGTGGGGAAAGTGCAGG + Intronic
1154426227 18:14274205-14274227 GGGCACAGTGGTGTGAGGGCTGG - Intergenic
1155309030 18:24506360-24506382 GAGCACATCGGGGTGACTGATGG + Intergenic
1155579983 18:27293133-27293155 GGGCAAAATGGGGTGAATGCAGG - Intergenic
1157590991 18:48836395-48836417 GAGGACAGTGGGGTCACCACTGG + Intronic
1158603100 18:58871553-58871575 GAGCACAGTTGGTGGACTGAGGG + Intronic
1158995504 18:62914535-62914557 GGGTACAGTGGGAGGACTGCTGG - Intronic
1160844221 19:1159533-1159555 GGGGACAGTGGGGGGACAGCAGG + Intronic
1160917320 19:1503457-1503479 GAGGGCAGTGGGGTGCCGGCAGG + Intergenic
1161211067 19:3065985-3066007 GAGCACGGTGAGGTGAGGGCTGG + Intergenic
1161249363 19:3271842-3271864 GAGCTCAGTGGGGAGACTTTGGG + Intronic
1161268046 19:3374192-3374214 GAGCACAGGGAGGTGAGTGAGGG + Intronic
1161404328 19:4083182-4083204 GAGCGCCGTGGGGAGGCTGCAGG + Intergenic
1161994628 19:7704575-7704597 GGGCACAGGGGGGTGTCTTCTGG + Intergenic
1164485811 19:28654884-28654906 GGGCACAGTGGAATGACGGCAGG - Intergenic
1164947864 19:32311437-32311459 CTGCACAGTGGGTTGACTGTTGG - Intergenic
1165095144 19:33406102-33406124 AAGCACAGTGGGGTGAGGCCCGG + Intronic
1165319529 19:35076769-35076791 GCCCACAGTGTGGTGGCTGCAGG - Intergenic
1167015174 19:46836659-46836681 GAGCAGAGTGTGGGGGCTGCTGG - Intergenic
1167314176 19:48754306-48754328 CAGCACAGCAGGATGACTGCGGG + Intronic
1167437920 19:49490579-49490601 GAGCAGAGCGTGGGGACTGCAGG + Intronic
1167808193 19:51804764-51804786 GAACAAAGGGGGGTGAATGCAGG + Intronic
1167825780 19:51971793-51971815 GAACACAGTGGGGTGAACACAGG - Intronic
1167948012 19:53004807-53004829 GAGAACAGTGTCGTGGCTGCTGG + Intergenic
1168498918 19:56877040-56877062 GAGGACAGAGGAGTGACTGTTGG - Intergenic
1168699456 19:58428025-58428047 CAGCACAGTGAGGTGTCTGGGGG - Intergenic
925157407 2:1658416-1658438 TTGCACTGTGGGGGGACTGCTGG - Intronic
926076832 2:9949711-9949733 GGGCACAGAGGAGGGACTGCTGG + Intergenic
926113015 2:10194711-10194733 GGGCTCAGTGGGGTTCCTGCTGG + Intronic
927787349 2:25982748-25982770 GGGCTCGGTGGGGTGACGGCGGG - Intronic
927907926 2:26875339-26875361 GAGCACAGTGGTGGGAGTGCAGG + Intronic
928265708 2:29809818-29809840 GAGCACAGGGAAGTGGCTGCTGG + Intronic
928627872 2:33159342-33159364 GAGCTCAGTGAAGTGGCTGCTGG - Intronic
928633221 2:33215649-33215671 GAGCAGAGTGTGGTGACAGAAGG - Intronic
928773657 2:34732724-34732746 GAGCACAGTGGGCACCCTGCTGG + Intergenic
930938885 2:56989421-56989443 TAGCACAGTAGGGTGACTATAGG - Intergenic
933249070 2:80008286-80008308 GAGCACAGTGGGGTGACTGCGGG - Intronic
935637965 2:105264630-105264652 GAGCACAGGCAGGTGGCTGCGGG - Exonic
937307478 2:120881372-120881394 GAGGACAGTGGGGAGAGGGCAGG + Intronic
937307575 2:120881657-120881679 GAGGACAGTGTGGGGACGGCAGG + Intronic
937307590 2:120881698-120881720 GAGGACAGTGGGGAGAGGGCAGG + Intronic
937329310 2:121015924-121015946 GAGCACAGTGGGGAGAGCGGAGG + Intergenic
937815204 2:126243683-126243705 CAGCACAGTAGGATGGCTGCTGG - Intergenic
939676271 2:145076251-145076273 CAGCACAGCAGGGAGACTGCAGG + Intergenic
941292802 2:163697438-163697460 GACCACTGTGGTGTGACTCCGGG - Intronic
942123499 2:172801569-172801591 GAGGGCAGTGTGGTGAGTGCTGG - Intronic
942458438 2:176153011-176153033 GAGCCCAGCGAGGTGACAGCAGG - Exonic
943958897 2:194233295-194233317 GAGCACAGTGTGGAGAGTGAAGG + Intergenic
947210289 2:227702265-227702287 GATCACAGTGGGGTAAATCCAGG + Exonic
947499052 2:230659080-230659102 GAGCACCGGGGGATGACTGAGGG - Intergenic
948502430 2:238405311-238405333 AAGCTCAGTGGGGCGGCTGCAGG - Intergenic
1168832736 20:855673-855695 GACCCCAGAGGGGTGAGTGCCGG - Intronic
1169177161 20:3527503-3527525 GAAGACAGTGGGGTGACTCAAGG + Intronic
1169211034 20:3766532-3766554 GGGCAAAGTGGGGAGAATGCTGG - Intronic
1170579389 20:17686441-17686463 GAGCATGGTGGTGTCACTGCTGG + Intergenic
1170773920 20:19358794-19358816 GAACACAGATTGGTGACTGCCGG - Intronic
1174842607 20:53914407-53914429 GAGCACACTGGGATGCCTGGTGG + Intergenic
1175899769 20:62355365-62355387 CAGTCCAGTGGGGTGACTGTAGG - Intronic
1175968695 20:62673127-62673149 GAGCTCACTGCTGTGACTGCTGG + Intronic
1177507734 21:22040199-22040221 AAGCACAGTGGGGTGCATGCTGG + Intergenic
1178855982 21:36250818-36250840 GAGCACAGTGGGGGTCTTGCAGG - Intronic
1179120920 21:38544895-38544917 GAGCACAGTGAGCTGACTGTGGG - Intronic
1181463832 22:23100296-23100318 AAGCACAATGGGGACACTGCTGG - Intronic
1181972495 22:26702575-26702597 GAGCACAGAGGGGTTTGTGCAGG - Intergenic
1183218634 22:36497516-36497538 GAGCACAGAGGGGTGAGGGGCGG - Intronic
1184818023 22:46886805-46886827 CAGCACAGTGGAGTGGCTACAGG - Intronic
949495012 3:4622978-4623000 GGACACAGTGGGGTTTCTGCTGG + Intronic
949724195 3:7024532-7024554 GGGCACAGAGAGGTAACTGCTGG + Intronic
949899218 3:8795891-8795913 CAGCAGAGTGGGGTGACTGCAGG + Intronic
951549369 3:23861689-23861711 GAGCACACTGGGATGCCAGCAGG + Intronic
952410875 3:33048707-33048729 GAACACAGTGGGGTGGGTGTGGG + Intronic
952749845 3:36816266-36816288 GAGCACAGTGGAGAAACTGAGGG + Intergenic
953666790 3:44931252-44931274 GAGCACATGGGGGTGCCTGCTGG + Intronic
953773036 3:45793270-45793292 GAGAACAGTTGTGTGACTGGTGG - Intronic
953846002 3:46426922-46426944 GAACAAAGTGGGGTGAAAGCGGG - Intergenic
953970997 3:47346685-47346707 GACCACAGAGGTGTGACTGTGGG + Exonic
954402092 3:50324267-50324289 GACCACAGTGGGCAGGCTGCAGG + Intronic
955405404 3:58622741-58622763 GGGCCCAGTGGGGAGGCTGCTGG + Intronic
957049320 3:75399053-75399075 TTGCACAGTGTGGGGACTGCTGG - Intergenic
959078713 3:101778506-101778528 GAGCACAGTGGGGTTAACACAGG - Intergenic
962093741 3:132271950-132271972 GAGCACAAAAGGGTGACTACAGG - Intronic
965406505 3:168275884-168275906 GAGCACAGAGGGGTGCCACCGGG - Intergenic
968520382 4:1032371-1032393 GAGCACAGTAGGTTGGTTGCCGG + Intergenic
968639266 4:1703288-1703310 GTGCACAATGGTGTTACTGCTGG - Intronic
969822271 4:9729948-9729970 TAGCACAGTGTGGGGAATGCTGG + Intergenic
972566065 4:40270292-40270314 GAGCTTACTGGGGTGACTGCCGG + Intergenic
976598136 4:86913568-86913590 GAGAACAGAGTGGTGGCTGCTGG - Intronic
981063794 4:140459854-140459876 GAGTGCAGTTGCGTGACTGCAGG + Intronic
983587814 4:169375040-169375062 GCGCACAGTGTGAGGACTGCAGG - Intergenic
984190060 4:176594473-176594495 CAACACACTGGTGTGACTGCAGG + Intergenic
985521644 5:376505-376527 GAGAACCGTGGGGTGAACGCGGG + Intronic
985929539 5:3046408-3046430 GAAAACAGTGGTGTGACTGATGG - Intergenic
992110407 5:73487391-73487413 GATCAAAGTGTGCTGACTGCAGG - Intergenic
992738326 5:79746055-79746077 GAGCACAGAGGTGTCTCTGCTGG - Intronic
993527125 5:88978843-88978865 TAGCACAATAGGGTGACTACAGG + Intergenic
993767546 5:91879702-91879724 GAGTGCAGTGGTGTGACTCCTGG + Intergenic
994073590 5:95627845-95627867 GAGCACAGTGGGGAGACCACAGG + Intergenic
1000026395 5:157362736-157362758 GAGCTAGGAGGGGTGACTGCAGG + Intronic
1001709652 5:173768046-173768068 ATGCACAGTGGGGTGAATGCAGG - Intergenic
1001745068 5:174086201-174086223 GAACAGATTGGGGTGATTGCTGG + Intronic
1001930027 5:175666229-175666251 GAACACAGTCTGGGGACTGCAGG - Intronic
1001933216 5:175687516-175687538 GAACATTGTGGGGTGGCTGCTGG - Intergenic
1001934305 5:175693701-175693723 GAGCACAGAGCTGTGACTTCAGG - Intergenic
1003150377 6:3542948-3542970 GAGCACAGTGGATGGAATGCTGG + Intergenic
1003167688 6:3695627-3695649 GAGCACAGTAGGGTGACTATAGG - Intergenic
1005565083 6:27083581-27083603 GACCACAGTGAGGAGACTGCTGG - Intergenic
1007224155 6:40301217-40301239 GAGGACAGTGGGGTGAGGGATGG + Intergenic
1007842139 6:44725322-44725344 TAGGGAAGTGGGGTGACTGCAGG - Intergenic
1014451893 6:121591644-121591666 GAGTGCAGTGGTGTGACTGTGGG + Intergenic
1014926288 6:127274883-127274905 GAGTCCAGTGGTATGACTGCAGG - Intronic
1016341137 6:143062250-143062272 GTGCACAGTTTGGAGACTGCTGG - Intronic
1016440030 6:144073885-144073907 GAACACACTGAGGTGCCTGCAGG + Intergenic
1017715768 6:157211995-157212017 GAGCACAGTTGGGAGCCTACAGG - Intergenic
1017889819 6:158628887-158628909 GAGCACTGTGGGGTGGCTGAGGG + Intronic
1018203365 6:161415060-161415082 GAGCTCTGTGGCCTGACTGCAGG + Intronic
1020001341 7:4757859-4757881 AAGTACCGAGGGGTGACTGCTGG + Intronic
1021451584 7:20787159-20787181 GAGGACAGTGCGGAGACTGGAGG + Intergenic
1021611357 7:22460790-22460812 GGGCACAGGAGGGTCACTGCAGG - Intronic
1021929010 7:25561336-25561358 GGACTCAGTGGGCTGACTGCAGG - Intergenic
1022649614 7:32262492-32262514 GACCTCACAGGGGTGACTGCAGG + Intronic
1024009084 7:45252542-45252564 CAGCACTGTGGGGTGACTGGTGG + Intergenic
1024242669 7:47447639-47447661 GAGAACTGTAGGGTCACTGCAGG - Intronic
1025061495 7:55812420-55812442 GAGGAAAGTGGGGAGACTGAGGG + Intronic
1026824482 7:73572930-73572952 GAGGACAGTGGTGTCACTGGAGG + Exonic
1027222598 7:76223664-76223686 AAGCCCAGTGTGGTGACAGCAGG - Intronic
1030079664 7:105766628-105766650 GAGCACAGTGGGGTGGTCCCTGG - Intronic
1030326717 7:108227519-108227541 TTGCACAGTAGGGTGACTGTGGG - Intronic
1032440302 7:131937630-131937652 TACCACAGTGGGGAGACAGCAGG + Intergenic
1033540244 7:142349652-142349674 CAGCACTGTGGAGTAACTGCTGG - Intergenic
1033543748 7:142381249-142381271 CAGCACTGTGGAGTCACTGCTGG - Intergenic
1035633624 8:1127261-1127283 GGGCTCATTGGGGTGACTCCAGG + Intergenic
1037785140 8:21898367-21898389 GAGCACAGTGGAGTTACCTCTGG - Intergenic
1038054431 8:23844904-23844926 GGGCACAGTGGTCTGTCTGCAGG + Exonic
1039546242 8:38413464-38413486 GAGCTGAGTGGGGTGAAGGCAGG + Exonic
1040102531 8:43518344-43518366 GAGCACAGGGGTGTGAGGGCTGG - Intergenic
1040333255 8:46403137-46403159 GGGAAAAGTGGTGTGACTGCTGG + Intergenic
1040855365 8:51943338-51943360 GAGCAGGGTGGAATGACTGCAGG - Intergenic
1041309790 8:56504229-56504251 GAGCACAGTGGGTTGGTTGTGGG - Intergenic
1044105004 8:88193526-88193548 TAGCACACTAGGGTGACTACAGG + Intronic
1047525939 8:125634092-125634114 GAGCACAGTGAGGGGAGGGCGGG - Intergenic
1048308711 8:133301548-133301570 GAGCAGAGAGTGGTGACTTCTGG - Intronic
1048444790 8:134485262-134485284 GTGCACAGTGGCCTGGCTGCTGG - Intronic
1048543588 8:135365320-135365342 GAACACAGTGAGGAGACTACTGG + Intergenic
1049357466 8:142195896-142195918 GAGCACAGAGGTGTGACTCCTGG - Intergenic
1049363743 8:142226580-142226602 GAGCAGAGTGGGTTGCCTGAGGG - Intronic
1049718822 8:144106267-144106289 AAGGACAGTGGGGTGGCTGTGGG - Intronic
1049746582 8:144265697-144265719 GAGCACAGCTGGGAGCCTGCCGG + Intronic
1055925694 9:81507747-81507769 GAGTACAGGGGCGTGACGGCGGG + Intergenic
1056200615 9:84272352-84272374 GAGCACCGTGCGGTCACTGATGG - Intergenic
1056724764 9:89104961-89104983 GAGCACAGTCAGGTGAATGCAGG + Intronic
1056751359 9:89353748-89353770 CAAGAAAGTGGGGTGACTGCAGG - Intronic
1057676313 9:97138731-97138753 GAGCACAGGGGTGTGATGGCTGG + Intergenic
1058317548 9:103587017-103587039 GAGCACAGTGGGCCGAGTACAGG + Intergenic
1059456652 9:114404008-114404030 GAGGACAGTGGTGTGGATGCTGG - Exonic
1059541473 9:115134677-115134699 AAGCACACTGGGGTGGCTGGTGG - Intergenic
1059887078 9:118758167-118758189 GAGCACACTGGAGTGGGTGCTGG + Intergenic
1060452518 9:123756536-123756558 GGGCACAGGAGGATGACTGCTGG - Intronic
1061110169 9:128563765-128563787 GAGTACAGTAGTGTGACTACGGG + Intronic
1062004986 9:134234574-134234596 GAGGACAGGGAGGTGACTCCAGG - Intergenic
1062017200 9:134296890-134296912 GAGCTCAGTGGGGGGACTGTGGG - Intergenic
1062641022 9:137518514-137518536 GAGCAGAGTGGAGTGAGTGACGG - Intronic
1186164049 X:6807745-6807767 GAGCACAGTCTAGTGACAGCCGG - Intergenic
1189940730 X:46117888-46117910 GAGCACAGAGGGGTTGGTGCAGG - Intergenic
1189957803 X:46293930-46293952 GAGTACAGTGGGCTGAATGGTGG + Intergenic
1190326201 X:49208538-49208560 GGGCACACTGGGCTGACTGGAGG + Exonic
1190512160 X:51184763-51184785 GTGGACAGTGGGGTGAGTGGAGG + Intergenic
1190619156 X:52267792-52267814 TAGCACAGTAGGGTGACTAATGG + Intergenic
1190637022 X:52445343-52445365 TAGCACAGTAGGGTGACTAATGG - Intergenic
1191029925 X:55958874-55958896 GAGCACATGTGTGTGACTGCAGG - Intergenic
1192316329 X:70054623-70054645 CAGCACAGTGGGGACTCTGCTGG - Intergenic
1192634397 X:72804131-72804153 GAGAACAGTCGGAAGACTGCTGG - Intronic
1192647313 X:72916670-72916692 GAGAACAGTCGGAAGACTGCTGG + Intronic
1194639795 X:96390390-96390412 CAGCACAGTAGGGTGACAACAGG - Intergenic
1196440357 X:115714298-115714320 GAACACTGTGGGGTGAGTGTGGG - Intergenic
1202380895 Y:24276125-24276147 GGCCACAGTGGGGTGAGAGCTGG + Intergenic
1202489889 Y:25394000-25394022 GGCCACAGTGGGGTGAGAGCTGG - Intergenic