ID: 933250542

View in Genome Browser
Species Human (GRCh38)
Location 2:80024381-80024403
Sequence CACTGCATTGAGTCTTGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 123}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933250537_933250542 23 Left 933250537 2:80024335-80024357 CCTCACTGAGAGTAGAGGATTAG 0: 1
1: 0
2: 2
3: 13
4: 110
Right 933250542 2:80024381-80024403 CACTGCATTGAGTCTTGAGGAGG 0: 1
1: 0
2: 0
3: 6
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933250542 Original CRISPR CACTGCATTGAGTCTTGAGG AGG Intronic
904997793 1:34644750-34644772 CACTGAAGTGCATCTTGAGGAGG + Intergenic
905826600 1:41030264-41030286 CACTGCATTGAGTTTTTAGAAGG - Intronic
913699208 1:121357799-121357821 CACTCAAGTGAGTGTTGAGGGGG + Intronic
914138337 1:144922246-144922268 CACTCAAGTGAGTGTTGAGGGGG - Intronic
916691694 1:167195885-167195907 AACTTCATTTAGTCTGGAGGTGG - Intergenic
920486619 1:206376511-206376533 CACTCAAGTGAGTGTTGAGGGGG + Intronic
922388715 1:225115265-225115287 CACAGCACTGAGTCTTGTGCAGG + Intronic
923959538 1:239061813-239061835 CACTGCATTGTGTCTAGGCGTGG + Intergenic
1066808325 10:39288204-39288226 AAGTGCATTGAGGCTTAAGGTGG - Intergenic
1069938570 10:71937313-71937335 GACTCCCTTCAGTCTTGAGGTGG - Intergenic
1071470045 10:85977666-85977688 CACTGCGTTGTGTCTGGAGAGGG - Intronic
1074126035 10:110529737-110529759 CACCTCATTGTGTTTTGAGGGGG + Intergenic
1074288011 10:112116486-112116508 CACTGCGCTGGGTCCTGAGGAGG + Intergenic
1074379470 10:112967192-112967214 CGCTGCATTTAGTCTTAAGTTGG - Intronic
1074647418 10:115474639-115474661 CACTGTCTTGAGTCTGGTGGTGG + Intronic
1075409525 10:122217070-122217092 CACTCGATGGAGTCCTGAGGTGG - Intronic
1076569800 10:131425190-131425212 CTCTGCATTCAGCCTTAAGGTGG + Intergenic
1076879275 10:133231902-133231924 CCCTGCATTGAGTGAAGAGGTGG - Intergenic
1077548824 11:3190242-3190264 CACTTCATCGGGTCTTGTGGGGG + Intergenic
1084489911 11:69472610-69472632 CACTGCATTGTGTGTGGAGCTGG - Intergenic
1086973734 11:93110205-93110227 CACTGCATTGATCCTTCATGGGG + Intergenic
1091825849 12:3512097-3512119 CACTGCAGTGAGTCACAAGGGGG - Intronic
1098883243 12:75937878-75937900 CACTGCATTTAGCCCAGAGGAGG + Intergenic
1106010220 13:25813607-25813629 CACTGAATGGAATCTTGTGGAGG + Intronic
1106360972 13:29030206-29030228 CATTTCCTTGAGTCTTGACGTGG - Intronic
1112029699 13:95445950-95445972 CAATTCATTGATTCTAGAGGAGG + Intronic
1112193381 13:97200121-97200143 CACAGCATGGAGGCTGGAGGTGG - Intergenic
1113159434 13:107363242-107363264 CACTGTGTTGATTCTTGATGAGG + Intronic
1113215228 13:108032275-108032297 CACTGCATTGAGTTTGCAGAAGG + Intergenic
1117337498 14:54767480-54767502 CACTTCCCTGTGTCTTGAGGTGG + Intronic
1118704621 14:68469251-68469273 CACTGCATTGTGTCTCCATGGGG - Intronic
1120485623 14:85110092-85110114 CACTGCATTGACTCTTCATAAGG + Intergenic
1120511409 14:85420516-85420538 AACTGCAGTCAGTCTGGAGGTGG - Intergenic
1120994070 14:90401986-90402008 GTCTGCACTGAGTCTTGAGGGGG + Intronic
1123708731 15:22970374-22970396 GATTGCATTGAGTCTTTAGAAGG - Intronic
1130873337 15:87990283-87990305 CACTGCTTCAAGTCTTGGGGTGG - Intronic
1136428434 16:30184005-30184027 CACGGAATTGAGTCTCGGGGAGG + Intronic
1136511365 16:30739804-30739826 CACTACTTGAAGTCTTGAGGGGG + Exonic
1136749955 16:32625720-32625742 CAAAGCATTGAGTTTAGAGGTGG + Intergenic
1137916792 16:52440288-52440310 CAGTGAACTGACTCTTGAGGGGG - Intronic
1139122067 16:64032583-64032605 CCCAGCACTGATTCTTGAGGAGG + Intergenic
1203052086 16_KI270728v1_random:884918-884940 CAAAGCATTGAGTTTAGAGGTGG + Intergenic
1142910224 17:3082956-3082978 CGCTGGATGGCGTCTTGAGGTGG + Intergenic
1144479186 17:15614901-15614923 TATTGGATTCAGTCTTGAGGAGG - Intronic
1144919116 17:18748831-18748853 TATTGGATTCAGTCTTGAGGAGG + Intronic
1146515434 17:33485623-33485645 CACTTCATTGAGTTTAGGGGAGG - Intronic
1153611549 18:6891097-6891119 CATTGCATTCAACCTTGAGGAGG + Intronic
1154014340 18:10603516-10603538 CACTGCATTGATTCTCCACGGGG + Intergenic
1155483195 18:26312022-26312044 CACTCCATAGAATCTTGAGTTGG + Intronic
1157712288 18:49858343-49858365 CACTGCAGTGATTCTTGGGGAGG + Intronic
1157777889 18:50410577-50410599 GACTGGATTCAGTTTTGAGGGGG + Intergenic
1160607019 18:80059030-80059052 CCTTGCAGGGAGTCTTGAGGTGG + Intronic
1161951251 19:7469343-7469365 CACTGTTTTGAGGGTTGAGGTGG - Intronic
1165735950 19:38175658-38175680 CTCAGCACTGAGTCCTGAGGAGG - Intronic
1167811505 19:51836300-51836322 CACTTCATTAAATCTTAAGGTGG + Intergenic
927895457 2:26778717-26778739 CACTGCACTCAGGCTTGTGGGGG - Exonic
928968772 2:37004626-37004648 CACAGAAATGAGTCTAGAGGAGG - Intronic
929418864 2:41770673-41770695 CACGGCATTCAGTCATGTGGGGG - Intergenic
931185882 2:59951012-59951034 ATCTGAATTGAGTTTTGAGGAGG - Intergenic
931959842 2:67470209-67470231 GACTGCATTGCCTCTGGAGGAGG - Intergenic
933197045 2:79403803-79403825 AACTTCATTGAGTGTTGATGGGG + Intronic
933250542 2:80024381-80024403 CACTGCATTGAGTCTTGAGGAGG + Intronic
935382266 2:102464870-102464892 CACACCCTTGAGTCTGGAGGAGG + Intergenic
938560784 2:132470347-132470369 CATTGCAACAAGTCTTGAGGAGG + Intronic
942505363 2:176637008-176637030 AAAGGCATTGAGTTTTGAGGTGG - Intergenic
943926615 2:193791636-193791658 CACTGCATTGGAGCTTGTGGCGG - Intergenic
948231985 2:236355498-236355520 CAGTGCCCTGAGTCTTGAGTGGG - Intronic
1171062949 20:21984079-21984101 GAGTGCACTGATTCTTGAGGGGG + Intergenic
1179978857 21:44886144-44886166 CTTTGCATGGAGACTTGAGGAGG - Exonic
1184400064 22:44268587-44268609 CACTGGACTGAGTCTTCTGGGGG - Intronic
949241512 3:1878181-1878203 CACTGTATTGATTTTTGAGAAGG - Intergenic
951593039 3:24287108-24287130 CACTGCATTGGGTCTGCAAGTGG - Intronic
951597983 3:24338722-24338744 CACTGCATGGAGTCATAGGGTGG - Intronic
952582295 3:34848673-34848695 GACTGCACTGATTCTTGAGTTGG - Intergenic
953452885 3:43018823-43018845 GACTGCACTGGGTCTTGGGGTGG - Intronic
954377989 3:50205056-50205078 GACTCCGTTGAGTCTTGTGGGGG - Intergenic
956472307 3:69580065-69580087 CTCAGAATTGTGTCTTGAGGTGG - Intergenic
957350496 3:79018170-79018192 ATCTGCAAAGAGTCTTGAGGAGG + Intronic
964596421 3:158437351-158437373 CACTGGGCTGAGTTTTGAGGAGG + Intronic
964764240 3:160163076-160163098 GACTGCAGTGAGTCTTAAGAAGG + Intergenic
966997329 3:185295952-185295974 CACTGCAGTCAGTCAAGAGGAGG - Intronic
967118333 3:186361677-186361699 CACAGCTTTGAGGCTTGAGGGGG + Intronic
971573110 4:28238920-28238942 CCCAGCACTGAGTTTTGAGGAGG - Intergenic
972335629 4:38105123-38105145 CACCTCATCCAGTCTTGAGGTGG - Intronic
975930478 4:79515774-79515796 CAGTGCATTGAATCTAGTGGTGG + Intergenic
976816098 4:89149444-89149466 CACTGAATTTATTCTGGAGGAGG + Intergenic
978343384 4:107740348-107740370 CACAGCATTCAGTTTTGATGAGG - Intergenic
983731393 4:170998181-170998203 CACTACATTGTGTGTTGAGCAGG - Intergenic
989990867 5:50764207-50764229 CACTGAATTCAGTCTACAGGGGG - Intronic
990120270 5:52442655-52442677 AACTGCTTTGAGGCTTGAGGAGG + Intergenic
990687537 5:58322991-58323013 AACTGCTTTGAGTCTTTGGGAGG + Intergenic
991456309 5:66808054-66808076 CTCTGCAGACAGTCTTGAGGTGG + Intronic
993934153 5:93980450-93980472 AACTACATTGAGTCCTCAGGAGG - Intronic
999380985 5:151121319-151121341 CCCTGCCTTGTGGCTTGAGGAGG + Intronic
1003775233 6:9353040-9353062 CACTTCCTTGAGGCTTGATGTGG + Intergenic
1004493497 6:16140884-16140906 GCCTGCATGGAGTCTGGAGGAGG + Intronic
1012874577 6:104711581-104711603 CACTGCATTTAGTCTGGTAGAGG + Intergenic
1013496249 6:110700494-110700516 AACAGCATTGAGTCATGAGCGGG - Intronic
1015780205 6:136857733-136857755 CACATCATGGAGTTTTGAGGAGG + Intronic
1017036145 6:150269150-150269172 CACTGGATGGAGTCTTGTGGGGG + Intergenic
1017221074 6:151966839-151966861 CTGGGCATTGAGGCTTGAGGAGG - Intronic
1024230312 7:47358696-47358718 CACTGCATTGTGGCTTGACATGG - Intronic
1025523407 7:61771575-61771597 GAGTGCATTGAGGCTTGTGGTGG - Intergenic
1025859211 7:65310743-65310765 CACAGCATTCAGTTTTGATGAGG - Intergenic
1025992186 7:66504579-66504601 CACAGCATTGAGTTGTGAAGAGG + Intergenic
1029954380 7:104622162-104622184 CACTGCAGTGAGTCATGATTAGG - Intronic
1031403236 7:121351257-121351279 CTCATCATTGAGTCTTGAAGAGG + Exonic
1032201165 7:129824113-129824135 CACTGTATTGAACCATGAGGTGG + Intergenic
1037280151 8:17231899-17231921 TACTGCATTGAGTCTTAAAAGGG - Intronic
1037497876 8:19458064-19458086 AGCAGCCTTGAGTCTTGAGGAGG - Intronic
1037564303 8:20104635-20104657 CACTGCAAAGATTCCTGAGGAGG - Intergenic
1038004113 8:23415773-23415795 GGCTGCATGGAGTCTGGAGGGGG + Intronic
1038114470 8:24537878-24537900 CACTGCATTGTATCTTAAGAAGG + Intergenic
1046962466 8:120125419-120125441 AACTGCATTGCGTCTGCAGGTGG - Intronic
1047720270 8:127632586-127632608 CACTACATTGAGTCTTCACCTGG + Intergenic
1048189711 8:132276706-132276728 CATGGCATTCAGTCTTGGGGTGG - Intronic
1053098238 9:35347796-35347818 CTCTGCCTTCAGTCTTCAGGAGG + Intronic
1056208812 9:84345371-84345393 AACTAGATTGAGTCTTGAGTTGG - Intergenic
1057118627 9:92550061-92550083 CCCTGCATTCAGTCTAGAAGTGG + Intronic
1057887142 9:98838466-98838488 CACTGCACTGAGTCTGTCGGAGG + Intronic
1060162988 9:121383775-121383797 CAATTCATTAAGTCTTGAGTGGG - Intergenic
1187686339 X:21819345-21819367 CACTGCATTGGGTCACTAGGAGG + Intergenic
1190453014 X:50599472-50599494 CACTGCATTGAGTCATAATAAGG + Intronic
1191197617 X:57741406-57741428 CACTGGAATTAGTCTTGAGCTGG + Intergenic
1196131655 X:112163744-112163766 ACCTGCATAGAGTTTTGAGGAGG + Intergenic
1196537771 X:116867936-116867958 CACTGCATGGAGCCTTGCTGTGG - Intergenic
1198278676 X:135121097-135121119 CACTGCATTGAGCTTTGGGAGGG - Intergenic
1198292285 X:135251419-135251441 CACTGCATTGAGCTTTGGGAGGG + Intronic
1198500295 X:137237863-137237885 CACTTCATTAAGGCTTGAAGAGG + Intergenic
1198758400 X:140004897-140004919 CACTACAGTGAGGCTTCAGGAGG - Intergenic