ID: 933254342

View in Genome Browser
Species Human (GRCh38)
Location 2:80063574-80063596
Sequence CCTGATTAACAGTATTTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 83}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933254338_933254342 10 Left 933254338 2:80063541-80063563 CCCTTCACGTAACTGTCTACAGT 0: 1
1: 0
2: 1
3: 8
4: 78
Right 933254342 2:80063574-80063596 CCTGATTAACAGTATTTGCCTGG 0: 1
1: 0
2: 1
3: 6
4: 83
933254337_933254342 22 Left 933254337 2:80063529-80063551 CCTGTTTAAGCACCCTTCACGTA 0: 1
1: 0
2: 0
3: 1
4: 32
Right 933254342 2:80063574-80063596 CCTGATTAACAGTATTTGCCTGG 0: 1
1: 0
2: 1
3: 6
4: 83
933254339_933254342 9 Left 933254339 2:80063542-80063564 CCTTCACGTAACTGTCTACAGTT 0: 1
1: 0
2: 0
3: 1
4: 72
Right 933254342 2:80063574-80063596 CCTGATTAACAGTATTTGCCTGG 0: 1
1: 0
2: 1
3: 6
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933254342 Original CRISPR CCTGATTAACAGTATTTGCC TGG Intronic
905005027 1:34702723-34702745 ACTGATTAAAAGAATATGCCCGG - Intergenic
907752005 1:57271691-57271713 CCTGATTATCTGTGTTTGGCTGG + Intronic
909273647 1:73656666-73656688 TCTGATTATCATTATTTACCAGG - Intergenic
910948975 1:92624459-92624481 CCTGATTAATAGGATTTTCTAGG - Intronic
912090080 1:106061738-106061760 GCTGATTTACAGTCTTTGCCTGG + Intergenic
922018351 1:221676086-221676108 CATGATAAACAGTGTTTTCCTGG + Intergenic
1062898692 10:1125382-1125404 CCTGACTAACAAAATTAGCCAGG - Intronic
1067993102 10:51238283-51238305 CCTATTTAAAAGTATTGGCCCGG + Intronic
1073375293 10:103029166-103029188 CTTTATTAAAAGTATTGGCCAGG + Intronic
1074622530 10:115140149-115140171 CCTGCTTAATAGTATCTGCTTGG + Intronic
1079746916 11:24144451-24144473 ACTGATTAACAGTATTTGGCAGG + Intergenic
1084539781 11:69778681-69778703 TCTGATTAACAGTAAATGCTGGG + Intergenic
1092063627 12:5571270-5571292 CATGATTAGCAGCATTTGACAGG - Intronic
1094197715 12:27766892-27766914 CTGGATTAACAGTATTTTTCAGG + Intronic
1094389913 12:29938126-29938148 CCTGGTTCACAGTAGTTGCTCGG - Intergenic
1097443124 12:59635312-59635334 CCTTATTAACATTGATTGCCTGG + Intronic
1097942421 12:65325992-65326014 ACTGATTAACTGTATTTGAATGG - Intronic
1098391585 12:69975304-69975326 GCTGATGACCAGAATTTGCCAGG + Intergenic
1107407546 13:40128845-40128867 TCTGAATGACAGTGTTTGCCTGG + Intergenic
1109774673 13:67024675-67024697 CCTGCTAAGTAGTATTTGCCAGG - Intronic
1111080286 13:83297303-83297325 CCTGACTGACAGTATTAGACAGG - Intergenic
1111240507 13:85467237-85467259 CCTGAATAAGAGTTTTTACCAGG - Intergenic
1115355121 14:32438872-32438894 CCTGATTAACAGTCTTCTCAGGG + Intronic
1118736876 14:68707218-68707240 CCTGAGTAACAGTCTTTGGAAGG - Intronic
1119322722 14:73741129-73741151 TCTGAGTTACACTATTTGCCAGG - Intronic
1123423652 15:20151186-20151208 CCTGATCAACAGAATTCACCCGG - Intergenic
1123532874 15:21157707-21157729 CCTGATCAACAGAATTCACCCGG - Intergenic
1132879263 16:2154356-2154378 CATGAAAAACAGTATTTGACTGG + Intergenic
1139117298 16:63971962-63971984 CCAGATCATCAGTATTTGCTTGG - Intergenic
1139841394 16:69883734-69883756 TCTGTTTAACAGTTTTTGCAGGG - Intronic
1141360595 16:83391935-83391957 CCTGATAAACAGTCTTTGGGTGG - Intronic
1143249043 17:5509073-5509095 CCTGCTTAACAGCAGTTGCTAGG + Intronic
1143620321 17:8076692-8076714 CCAGATCAACAGCATTGGCCGGG - Exonic
1151541951 17:74769163-74769185 CTTGATTAACATGATTTTCCTGG + Exonic
1153040037 18:803823-803845 ACTGATTATCAGTTTTTGCCTGG - Intronic
1153250754 18:3119185-3119207 TCTGAAGAACAGTATTTGCCAGG + Intronic
1157934577 18:51858913-51858935 GCTGATTATCAGTATATGCATGG + Intergenic
1161688429 19:5716064-5716086 CCTGATTAAAGGTAATGGCCTGG + Intronic
1165156621 19:33792671-33792693 CCTGATTCACAGAATGCGCCTGG - Intergenic
1165428235 19:35757189-35757211 CCTTCTTGACAGCATTTGCCAGG - Intronic
1165492456 19:36132466-36132488 CCTGATAAAAATTATTTGCTTGG - Intergenic
925786189 2:7433136-7433158 CCTGATTCACAGCATCTGTCTGG + Intergenic
926505993 2:13716725-13716747 TCTGATTAACAACATTTGACTGG - Intergenic
933254342 2:80063574-80063596 CCTGATTAACAGTATTTGCCTGG + Intronic
941163358 2:162059763-162059785 CCCCATTCCCAGTATTTGCCAGG + Intronic
941204293 2:162552451-162552473 AATCACTAACAGTATTTGCCAGG + Intronic
945744096 2:213699505-213699527 CCATATTATTAGTATTTGCCAGG - Intronic
948796410 2:240404615-240404637 CGTCATTTACAGTATGTGCCTGG - Intergenic
1169423222 20:5475837-5475859 CCTGATGATCAGTTTCTGCCTGG + Intergenic
1180015441 21:45079709-45079731 CCTGACTAACAGTATTTAATGGG + Intronic
949564591 3:5233054-5233076 TCTGATGAACAGAATTTGGCAGG + Intergenic
963882904 3:150547858-150547880 CCTTTTAAACAGTCTTTGCCTGG - Intronic
970023031 4:11590290-11590312 CCTGAATAATAGTATCTCCCAGG - Intergenic
981258633 4:142692818-142692840 TCTTATTACCAGAATTTGCCAGG - Intronic
982238038 4:153270445-153270467 TCTGATTTGCAGTATATGCCTGG + Exonic
982674041 4:158355330-158355352 CCTGTTTAGCACTTTTTGCCAGG + Intronic
987214310 5:15717153-15717175 TCTATTTAAAAGTATTTGCCGGG + Intronic
987938702 5:24503845-24503867 TCTGATTAACAATATATTCCTGG + Intronic
990787184 5:59434779-59434801 CCTGATTAGCAGTTATTGTCTGG - Intronic
991369963 5:65908273-65908295 CCTGATTAACAGAGTTTTCATGG - Intergenic
995549819 5:113269631-113269653 ACTCATTAACAGTATTAACCAGG - Intronic
1001126735 5:169026131-169026153 CCTGCTGAACAGTCTCTGCCAGG - Intronic
1005051026 6:21683934-21683956 CCTGATTTTCAGTACTGGCCTGG + Intergenic
1005413360 6:25574452-25574474 CCTGATGCACAGTATGTGCTTGG + Intronic
1006562940 6:34929380-34929402 CCTGTTTAGCAGTATCTGCCTGG + Intronic
1011144593 6:84199067-84199089 TCTGATTAACAGTATTTTATAGG - Intronic
1015036165 6:128657220-128657242 CCTAATTAGCATTATTTTCCTGG + Intergenic
1015115700 6:129647153-129647175 AATGATTAACAGTATTGGCAAGG - Intronic
1015574521 6:134657081-134657103 CCTGATTAACAGTCTTGGCTGGG - Intergenic
1018935691 6:168272553-168272575 CCTGATTGACAGGAAGTGCCGGG + Intergenic
1020928367 7:14360696-14360718 CCTGTTTAATAATATTTGCTTGG + Intronic
1022344961 7:29505614-29505636 CCTGATTACAGGTGTTTGCCAGG - Intronic
1029991532 7:104966918-104966940 AGTGATTAAGAGTATTTACCTGG + Intergenic
1030857604 7:114580705-114580727 CCTGGTTATCTGTATTTGGCAGG + Intronic
1033200547 7:139364631-139364653 CTTTCTTAACAGTATTTTCCTGG - Intronic
1038731668 8:30133539-30133561 CCTGAATAGGAGAATTTGCCTGG + Intronic
1040350147 8:46557799-46557821 CTTGATTAATAGTCTTTGCTGGG - Intergenic
1042356174 8:67830525-67830547 CCTGATTTACAGTATTTTCATGG - Intergenic
1042438404 8:68795256-68795278 CCCGATTAAAAGTCTTTGTCTGG + Intronic
1042519330 8:69694520-69694542 CCTGCTCAACAGTATGTGGCTGG - Intronic
1043302844 8:78755585-78755607 TCTGATTTACAATTTTTGCCAGG - Intronic
1044645338 8:94436520-94436542 CCAGATTTCCAGTTTTTGCCTGG - Exonic
1048160559 8:132017070-132017092 TCTGCTTAACAGTATTTACAGGG + Intergenic
1050161201 9:2719973-2719995 CCTGATTAACATTTATTTCCAGG - Intronic
1050326535 9:4503249-4503271 TTTGATTAACAGTGGTTGCCTGG - Intronic
1052670814 9:31554559-31554581 CCTGAGCAACAGTCTTTGCTGGG + Intergenic
1060455878 9:123796066-123796088 CCTGTTGAAAAGTATTTTCCTGG - Intronic
1061589812 9:131591124-131591146 TCTGAGTAACAGAACTTGCCGGG + Intronic
1187478557 X:19633897-19633919 TGAGATTAACATTATTTGCCTGG - Intronic
1187962255 X:24577849-24577871 TCTGAGCAACTGTATTTGCCTGG - Intronic
1195957503 X:110347579-110347601 CCTTATTATCTGTATTTGGCAGG + Intronic