ID: 933254848

View in Genome Browser
Species Human (GRCh38)
Location 2:80069221-80069243
Sequence GCCCTAATGCTTGTGCACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 66}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933254841_933254848 26 Left 933254841 2:80069172-80069194 CCTTTTTCCACCTTTATGTTCTG 0: 1
1: 0
2: 8
3: 83
4: 618
Right 933254848 2:80069221-80069243 GCCCTAATGCTTGTGCACACTGG 0: 1
1: 0
2: 0
3: 3
4: 66
933254847_933254848 -4 Left 933254847 2:80069202-80069224 CCTCAGCATATTGGAAGCTGCCC 0: 1
1: 0
2: 2
3: 25
4: 251
Right 933254848 2:80069221-80069243 GCCCTAATGCTTGTGCACACTGG 0: 1
1: 0
2: 0
3: 3
4: 66
933254840_933254848 27 Left 933254840 2:80069171-80069193 CCCTTTTTCCACCTTTATGTTCT 0: 1
1: 2
2: 20
3: 170
4: 1069
Right 933254848 2:80069221-80069243 GCCCTAATGCTTGTGCACACTGG 0: 1
1: 0
2: 0
3: 3
4: 66
933254846_933254848 -3 Left 933254846 2:80069201-80069223 CCCTCAGCATATTGGAAGCTGCC 0: 1
1: 2
2: 0
3: 15
4: 281
Right 933254848 2:80069221-80069243 GCCCTAATGCTTGTGCACACTGG 0: 1
1: 0
2: 0
3: 3
4: 66
933254843_933254848 19 Left 933254843 2:80069179-80069201 CCACCTTTATGTTCTGTATGGAC 0: 1
1: 0
2: 4
3: 18
4: 167
Right 933254848 2:80069221-80069243 GCCCTAATGCTTGTGCACACTGG 0: 1
1: 0
2: 0
3: 3
4: 66
933254844_933254848 16 Left 933254844 2:80069182-80069204 CCTTTATGTTCTGTATGGACCCT 0: 1
1: 0
2: 2
3: 24
4: 242
Right 933254848 2:80069221-80069243 GCCCTAATGCTTGTGCACACTGG 0: 1
1: 0
2: 0
3: 3
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933254848 Original CRISPR GCCCTAATGCTTGTGCACAC TGG Intronic
900980496 1:6043507-6043529 GCCCCAATTCTGGTGCCCACAGG + Intronic
919865095 1:201775470-201775492 GTCCTACTGCATGTGCACAAAGG + Intronic
924455090 1:244212924-244212946 GCCCTCATGCTTCTGCACCCTGG + Intergenic
1070600332 10:77861840-77861862 GCCCAAAGGCTTGAGCATACAGG + Intronic
1071564821 10:86666267-86666289 GCCCACATTCTTGTGCACGCGGG + Exonic
1090957519 11:131526595-131526617 GCTCTAATCCTTGTGTGCACAGG + Intronic
1091846368 12:3659072-3659094 GCTCTAATGCTTGTCCACTTAGG + Intronic
1091873165 12:3912035-3912057 GCCCTCAAGCTTCTGCACATGGG - Intergenic
1093608007 12:21118087-21118109 GTCCTAATGGTAGTGGACACAGG - Intronic
1103009942 12:117450316-117450338 GCCCTGAAGCCTGTGCACAGAGG + Intronic
1105918387 13:24938730-24938752 CCCATGATGCTTGTGCACAGTGG + Intergenic
1110832604 13:80048354-80048376 GCCATTATGCTTGTGGATACAGG + Intergenic
1114102264 14:19390364-19390386 GCGCTGATGCTTGTGCATGCCGG + Intergenic
1115948762 14:38695283-38695305 GTCCTAATGGTGGTGGACACAGG + Intergenic
1117738829 14:58794513-58794535 TCCCTAATGCCAGTGCACAATGG + Intergenic
1129198791 15:73986427-73986449 GCCCTGATGCTTCTGTACCCTGG - Intronic
1132826496 16:1907991-1908013 GCCCTAAGCCTTGCACACACGGG - Intergenic
1136613894 16:31383751-31383773 GCCCTAATGGCTGGGCACAGTGG + Intergenic
1146934866 17:36807135-36807157 GACCTAATAATTGTCCACACTGG + Intergenic
1156240655 18:35250773-35250795 GTCCTAATTCTGGTGAACACAGG + Intronic
1159867541 18:73724079-73724101 GCACACATGCTTGTGCACAGAGG + Intergenic
1160406709 18:78651496-78651518 GTCCTCAGGGTTGTGCACACAGG - Intergenic
1160406734 18:78651610-78651632 GTCCTCAGGGTTGTGCACACAGG - Intergenic
1164831413 19:31324110-31324132 GCCCTCAAGGCTGTGCACACTGG + Intronic
1166360273 19:42250243-42250265 GACCCAATGCTTGTTCCCACAGG + Intronic
927037420 2:19193542-19193564 GCGCTAATGCTTGCTAACACGGG + Intergenic
929790645 2:45020160-45020182 GCCTTAATTCTTTTGCACATGGG - Intergenic
931193650 2:60029075-60029097 TCCCAAATGCCTGTGCAGACAGG + Intergenic
933254848 2:80069221-80069243 GCCCTAATGCTTGTGCACACTGG + Intronic
933699566 2:85244835-85244857 GCACTACAGCTTTTGCACACTGG + Intronic
937242331 2:120470379-120470401 GCCCTGAGGGCTGTGCACACGGG + Intergenic
937872645 2:126797235-126797257 ACCCGGATGCATGTGCACACTGG + Intergenic
938262099 2:129903604-129903626 GCCCTAATTCTTCTGCATCCTGG + Intergenic
939194293 2:138953637-138953659 GACCTCAAGCTTATGCACACAGG + Intergenic
940503681 2:154526817-154526839 GCCCTAGTGCTGGTGGCCACAGG - Intergenic
1175682065 20:60996108-60996130 TCCCAACTCCTTGTGCACACAGG - Intergenic
1178005429 21:28214367-28214389 GCCCTATTGTTTGTGTACATGGG - Intergenic
1183002192 22:34869938-34869960 GCCCTCTTACTTCTGCACACAGG - Intergenic
1183219151 22:36501144-36501166 CCCCTAATGCTTCTGGACATAGG + Intronic
1184146441 22:42614455-42614477 GCCCAAATGCCAGTCCACACAGG + Intronic
1184988973 22:48154726-48154748 ACCCAACTGCTTCTGCACACTGG + Intergenic
958095396 3:88937856-88937878 CCCCTGATTCTTGTCCACACTGG - Intergenic
959752607 3:109855958-109855980 GTCTTAATGCTTGTGCTCTCTGG + Intergenic
964065857 3:152578052-152578074 GCCTTTATGCATGTACACACAGG - Intergenic
966339405 3:178908570-178908592 GACCTACTGCGTGTGCAGACCGG - Intergenic
966405567 3:179593822-179593844 GCCCTAAGGCTTCTTCAGACTGG - Exonic
968827290 4:2908434-2908456 GCCCTGCTGCTTGTGCACTTGGG - Intronic
972169830 4:36332500-36332522 GCCCTAAAGCTGGTCCACAATGG + Intronic
988015861 5:25558857-25558879 GACCAAATGCTGGTGAACACCGG - Intergenic
988959829 5:36358707-36358729 GCACTAATGCCCTTGCACACTGG - Intergenic
1000281802 5:159788877-159788899 GCCCTCTTGGATGTGCACACTGG - Intergenic
1003674141 6:8187743-8187765 GCTCTAATACATGTGCAGACAGG + Intergenic
1014398727 6:120960257-120960279 CACCTAATGCATGTGGACACTGG - Intergenic
1031078237 7:117233099-117233121 GCCTTAATGCTTGTCCTCAGGGG - Intergenic
1035479884 7:159173194-159173216 GACATAATGCTATTGCACACTGG - Intergenic
1035570788 8:671087-671109 GCTCTAATGTCTGTGCTCACTGG + Intronic
1035570854 8:671377-671399 GCTCTAATGTCTGTGCTCACTGG + Intronic
1035570866 8:671435-671457 GCTCTAATGTCTGTGCTCACTGG + Intronic
1035570920 8:671667-671689 GCCCTAATGTCTGTGCTCACTGG + Intronic
1035570957 8:671840-671862 GCTCTAATGTCTGTGCTCACTGG + Intronic
1041773633 8:61499553-61499575 ACCCCAATGCTCCTGCACACTGG + Exonic
1041830549 8:62148123-62148145 TCCCTAGTACTTGTGCACCCAGG + Intergenic
1042089771 8:65145999-65146021 GCCCTTATGCTTTGACACACAGG - Intergenic
1042294526 8:67204941-67204963 GACATACTGCTTTTGCACACAGG + Intronic
1044886355 8:96782307-96782329 GACTTACTGCTTGTGCACTCAGG + Intronic
1048887341 8:138918783-138918805 TCCCTAAAGCTTGTGCACTCAGG - Intergenic
1059512977 9:114866278-114866300 GCCCTAATGCAAGTGCAGCCTGG - Intergenic
1059989834 9:119854490-119854512 GACCTAATTCTTGGGCATACTGG - Intergenic
1061055426 9:128219966-128219988 GCCCTCCTGCTGGTGCACCCAGG + Exonic
1196706727 X:118723579-118723601 GCCCTAGGGCATGTGCAGACAGG + Intergenic