ID: 933258594

View in Genome Browser
Species Human (GRCh38)
Location 2:80107628-80107650
Sequence CGGAGTGTGGTGCCCAACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 70}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933258591_933258594 -2 Left 933258591 2:80107607-80107629 CCGAACAGAGCTCAGGACTCACG 0: 1
1: 0
2: 1
3: 4
4: 111
Right 933258594 2:80107628-80107650 CGGAGTGTGGTGCCCAACAAAGG 0: 1
1: 0
2: 0
3: 2
4: 70
933258589_933258594 16 Left 933258589 2:80107589-80107611 CCTCATTCTTCTTGGATGCCGAA 0: 1
1: 8
2: 95
3: 350
4: 758
Right 933258594 2:80107628-80107650 CGGAGTGTGGTGCCCAACAAAGG 0: 1
1: 0
2: 0
3: 2
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933258594 Original CRISPR CGGAGTGTGGTGCCCAACAA AGG Intronic
902637131 1:17741905-17741927 TGGGGTGTGGAGCCCAAGAAGGG + Intergenic
905507717 1:38493364-38493386 TGGATTGTAGTGCCCAATAATGG + Intergenic
911462696 1:98210947-98210969 CGGAGTTTGCTGCCTAACCATGG + Intergenic
915386205 1:155495229-155495251 CGGTGTGTGTTACCTAACAATGG + Intronic
921468512 1:215520787-215520809 CTGGGTGAGGTGCCCATCAATGG + Intergenic
922953537 1:229579507-229579529 TGGCGTGTGGTTCCCAGCAAGGG - Intergenic
1078714706 11:13828908-13828930 CAGAGTGTGAAGCCCAACAAAGG - Intergenic
1084044950 11:66563098-66563120 CGCCGTATGGTGCCCTACAAGGG + Exonic
1089695775 11:120215578-120215600 AGGAGAGTGTTGCCCACCAAGGG - Intronic
1097503758 12:60438687-60438709 AGGAGAGTGGTCCCCAGCAAGGG - Intergenic
1098973349 12:76878478-76878500 CGGAGTGTGGTGAGCACCGAGGG - Intronic
1104041516 12:125134168-125134190 TGGAGTGAGGTGCCCAGGAAGGG - Intronic
1121317727 14:92972038-92972060 TGGAGTGAGGGGACCAACAAGGG - Intronic
1122303645 14:100747518-100747540 CGGAGAGTGGTTCTCCACAAAGG - Intergenic
1124800112 15:32824267-32824289 TGGAGCGTGGAGCCCAACACTGG + Intronic
1135869124 16:26133000-26133022 TGGAGGCTGGTGTCCAACAAGGG - Intronic
1141984415 16:87570740-87570762 CGGAGCTTGGTGCCAAACACTGG + Intergenic
1142154170 16:88525732-88525754 CGCTCTGTGGTGCCCAACACTGG - Intronic
1145275215 17:21425034-21425056 CTGAGTGTGCAGCCCAAAAAGGG + Intergenic
1150888857 17:69121414-69121436 TGGGGTGAGGTGCCCCACAATGG + Intronic
1152616033 17:81338305-81338327 GGGAGTGTGGAGCCCAGCATCGG - Intergenic
1156324048 18:36057164-36057186 TGGAGTGTGGTGGCCAATCAAGG - Intronic
1157013581 18:43682046-43682068 CTGCGTGTGGTGCCCACCTAAGG - Intergenic
1158810203 18:61024017-61024039 AGGAGTGTGCTGTCCAAAAATGG - Intergenic
1163790730 19:19304814-19304836 GGGAGTGTGTAGCCCAACGAGGG + Intronic
1166643957 19:44517361-44517383 CAGAGTGTGGTCCACAACACTGG + Intronic
1167637881 19:50666164-50666186 CGGGGGCTGGTGGCCAACAAGGG - Intronic
925020910 2:567143-567165 TGGAGTGTGGTGACCAGCCAAGG - Intergenic
925020918 2:567181-567203 TGGAGTGTGGTGACCAGCCAGGG - Intergenic
925020927 2:567219-567241 TGGAGTGTGGTGACCAGCCAAGG - Intergenic
926134861 2:10329488-10329510 CAGAGTGTGGTGGCCTACAGAGG + Intronic
932572402 2:72945029-72945051 CGGACAGTGGTGTACAACAAGGG - Exonic
933258594 2:80107628-80107650 CGGAGTGTGGTGCCCAACAAAGG + Intronic
936379636 2:111973053-111973075 TGGAGTGTGTGGCCCAAAAATGG - Intronic
937263869 2:120603915-120603937 CAGTGTTTGGTGCCTAACAAAGG - Intergenic
938946590 2:136217846-136217868 GGGAGTGAGGTGCCCAGAAAGGG - Intergenic
943404292 2:187460886-187460908 TGGTGTGTTGTACCCAACAAAGG - Intergenic
1171204762 20:23270211-23270233 CGGGGGATGGTGCCCCACAAAGG + Intergenic
1175726013 20:61318960-61318982 CAGTGTGTGGTGCCCCACCATGG - Intronic
1176376662 21:6090098-6090120 CGGAGTGTGGCGGGCAACATAGG + Intergenic
1179746813 21:43448146-43448168 CGGAGTGTGGCGGGCAACATAGG - Intergenic
1183367096 22:37412633-37412655 GGGTCTGTGGTGCCCAACAGAGG - Intronic
952938496 3:38421250-38421272 CGGCAAGTGGTGCCCAACACGGG + Intronic
953123232 3:40066189-40066211 GGGAGGGTGGTGCACAGCAAAGG - Intronic
953918728 3:46937369-46937391 AGGAGTGTGGTGCCCACTCAGGG - Intronic
959584319 3:108012017-108012039 GGGAGTGTGGGGGCCAGCAAGGG - Intergenic
966331602 3:178821030-178821052 CTAAGTGTGCTGCCCAACAGTGG - Intronic
969284586 4:6194945-6194967 TGGGCGGTGGTGCCCAACAAAGG + Intronic
983953486 4:173670364-173670386 CTATGTGTGGTGCCCAAAAATGG + Intergenic
985824577 5:2182711-2182733 TGGTGTGTGGTGCCCATCCATGG + Intergenic
987675281 5:21065086-21065108 TGGACTGTCCTGCCCAACAAGGG + Intergenic
990057825 5:51607013-51607035 AGGAGTATGGTCCCCAAAAAAGG - Intergenic
992481619 5:77157353-77157375 CGGAGTGTGGGGACCCAGAAGGG + Intergenic
1001435924 5:171699100-171699122 GGGAGTGAGGTTCCCATCAATGG + Intergenic
1002373950 5:178775149-178775171 TGGAGTGGGGTGCCCAGGAAGGG + Intergenic
1003072491 6:2956200-2956222 TGGAGTCTGGTGGCAAACAAGGG + Intronic
1003268801 6:4589485-4589507 CAGAGTCTGGTGTGCAACAAGGG + Intergenic
1010048094 6:71470731-71470753 CGTAGTGTGGCGCCCAACCATGG + Intergenic
1013933383 6:115563657-115563679 AGGAGTGTGGTGTCCATTAAAGG + Intergenic
1019725051 7:2597265-2597287 TGGAGTGTGGGGCCCAATACAGG + Intronic
1030735612 7:113044269-113044291 CAGAGTGTGGTGCCCTTCATGGG + Intergenic
1034079818 7:148266240-148266262 CGGGGTGGGGGGCCCAAAAAAGG + Intronic
1034502840 7:151462066-151462088 CAGAAGGTGGTGCCCTACAAAGG + Intergenic
1035986929 8:4444402-4444424 CTGAATGTGGTGCTCAAAAATGG + Intronic
1036491488 8:9230244-9230266 CGGGTAGTGGTGCCCAACAGAGG - Intergenic
1038999497 8:32963883-32963905 TTGAGTGAGGTTCCCAACAATGG + Intergenic
1040863017 8:52020424-52020446 CTGAGTGTGGTGTCCAAGATGGG - Intergenic
1042493200 8:69426060-69426082 CAGAGTGTGATGCCCTACTAAGG + Intergenic
1044115104 8:88326648-88326670 CAGTGTTTGGTGCCTAACAAAGG - Intronic
1052400770 9:27997490-27997512 AGGAGTCTGAGGCCCAACAAGGG - Intronic
1053093600 9:35303958-35303980 TGGAGTGTGGTGGCCATCAGAGG + Intronic
1057824389 9:98360912-98360934 CTCAGTGTGGAGCCCAACAGTGG - Intronic
1196687839 X:118527776-118527798 AGGAGTGTGTGGCCCAAGAAAGG - Intronic