ID: 933258693

View in Genome Browser
Species Human (GRCh38)
Location 2:80108193-80108215
Sequence TACCCAAGGCTGCTCCCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 139}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933258693_933258695 -10 Left 933258693 2:80108193-80108215 CCAGAGGGGAGCAGCCTTGGGTA 0: 1
1: 0
2: 0
3: 11
4: 139
Right 933258695 2:80108206-80108228 GCCTTGGGTAGCCTAGGCTTTGG 0: 1
1: 0
2: 2
3: 6
4: 134
933258693_933258698 -8 Left 933258693 2:80108193-80108215 CCAGAGGGGAGCAGCCTTGGGTA 0: 1
1: 0
2: 0
3: 11
4: 139
Right 933258698 2:80108208-80108230 CTTGGGTAGCCTAGGCTTTGGGG 0: 1
1: 0
2: 0
3: 17
4: 190
933258693_933258701 4 Left 933258693 2:80108193-80108215 CCAGAGGGGAGCAGCCTTGGGTA 0: 1
1: 0
2: 0
3: 11
4: 139
Right 933258701 2:80108220-80108242 AGGCTTTGGGGCCCTGAGGAAGG 0: 1
1: 0
2: 7
3: 37
4: 490
933258693_933258702 7 Left 933258693 2:80108193-80108215 CCAGAGGGGAGCAGCCTTGGGTA 0: 1
1: 0
2: 0
3: 11
4: 139
Right 933258702 2:80108223-80108245 CTTTGGGGCCCTGAGGAAGGTGG 0: 1
1: 0
2: 29
3: 1209
4: 36831
933258693_933258699 0 Left 933258693 2:80108193-80108215 CCAGAGGGGAGCAGCCTTGGGTA 0: 1
1: 0
2: 0
3: 11
4: 139
Right 933258699 2:80108216-80108238 GCCTAGGCTTTGGGGCCCTGAGG 0: 1
1: 0
2: 2
3: 26
4: 262
933258693_933258697 -9 Left 933258693 2:80108193-80108215 CCAGAGGGGAGCAGCCTTGGGTA 0: 1
1: 0
2: 0
3: 11
4: 139
Right 933258697 2:80108207-80108229 CCTTGGGTAGCCTAGGCTTTGGG 0: 1
1: 0
2: 0
3: 11
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933258693 Original CRISPR TACCCAAGGCTGCTCCCCTC TGG (reversed) Intronic
900133632 1:1103609-1103631 TACACAGGACTCCTCCCCTCTGG + Intronic
901238439 1:7679798-7679820 GACCCCAGGCTGGTCCCCTCTGG - Intronic
907179111 1:52553731-52553753 CTCCCAAGGCTGCTCCCCCTGGG + Intergenic
907248357 1:53122045-53122067 TTCCCAGGTCTGCTCCGCTCCGG - Intronic
907257250 1:53189100-53189122 TCCCCCTGGCTGCTCCTCTCAGG + Intergenic
908852317 1:68387935-68387957 CTCCCAAGGCTGCTCCTCTCCGG + Intergenic
909419760 1:75450680-75450702 TACCCCAGTCTGCTACCCTGAGG + Intronic
912391373 1:109305487-109305509 TCCCCCATGCTTCTCCCCTCTGG - Intronic
914260554 1:145995775-145995797 TACCCGAGGCAACGCCCCTCAGG + Intronic
916214597 1:162384377-162384399 TTCCCAAGGTTTCTCCCATCTGG + Intronic
918147132 1:181766717-181766739 TGCCTAAGGGTGCTCCCCTGAGG + Intronic
919829909 1:201532975-201532997 CATCCAAGCCTGTTCCCCTCAGG + Intergenic
1065988431 10:30981264-30981286 TACTCCAGGCTGCTCACCCCAGG + Intronic
1070745077 10:78928780-78928802 CACCCAAGGCTGGTCAACTCCGG + Intergenic
1070779023 10:79126897-79126919 GACCCAAGGCTTCTCCCCAGTGG + Intronic
1070902067 10:80038572-80038594 TAGCCAAGGCTTCTCCCCAATGG + Intergenic
1071298877 10:84241746-84241768 GTCCCATGGCTGCTCGCCTCTGG - Intergenic
1073907322 10:108297789-108297811 TACCTGAGGCTGCTCCTCTAAGG + Intergenic
1074439412 10:113461710-113461732 TAAACAAGGATGCTCACCTCAGG + Intergenic
1075950517 10:126473620-126473642 TCCCCCAGGCTGCCCACCTCTGG + Intronic
1077115113 11:880604-880626 TACCCACTGCTGCCACCCTCAGG + Intronic
1077468182 11:2743613-2743635 TGCGCAGGGCTGCTCTCCTCCGG - Intronic
1083609196 11:63997146-63997168 TACCTGCGGCTGCTCACCTCGGG + Exonic
1083951487 11:65959079-65959101 ATCCCAGGGCTGCTGCCCTCTGG + Intronic
1085227817 11:74938308-74938330 TTCCCAGGGCTGCCCCCATCTGG + Intronic
1088792802 11:113241082-113241104 TCCCCAAGGCTGCCGCCCTGGGG + Intronic
1091663812 12:2404030-2404052 TCCCCTAGGCTGGTCACCTCTGG + Intronic
1091835475 12:3582809-3582831 TTCCGAATTCTGCTCCCCTCAGG + Intronic
1092054017 12:5494050-5494072 TAAGCAAGGCAACTCCCCTCTGG - Intronic
1102112533 12:110375210-110375232 TACCCAGGGCTCCTGCCCTCTGG + Intronic
1102548438 12:113673640-113673662 AACCCAGTGCTGCTCCCCACTGG - Intergenic
1102680322 12:114686471-114686493 TCCCCCAGACTGCTCGCCTCCGG + Intergenic
1104313855 12:127679145-127679167 TGACCCAGGCTGCTGCCCTCTGG - Intergenic
1106214787 13:27686395-27686417 TACCCAAGGCTGCCCACCCTAGG + Intergenic
1106692944 13:32138565-32138587 TGCCCAGGCCTGCTCCTCTCTGG - Intronic
1110237466 13:73231715-73231737 TGCCCAAAGATGTTCCCCTCAGG - Intergenic
1119428443 14:74550810-74550832 GACCCAAGGAAGTTCCCCTCTGG - Intronic
1121431664 14:93892275-93892297 TCCCCATGGCTTCTCCCCTTGGG + Intergenic
1128105686 15:65043020-65043042 TACCCCAGGCTGGCCACCTCCGG - Intergenic
1128211663 15:65907719-65907741 TACCCTAGCCAGCTTCCCTCAGG - Intronic
1130156675 15:81356678-81356700 TAGCATAGGCTGCACCCCTCTGG + Intronic
1131067110 15:89441574-89441596 CACCCACAGGTGCTCCCCTCAGG - Intergenic
1131279003 15:91005906-91005928 TTCCCAAGGCTGCTGCCCTTGGG - Intronic
1132053080 15:98626528-98626550 GGCCCCAGGCTGCTCACCTCTGG + Intergenic
1132571432 16:646076-646098 TACGTAAGGCTGCTGCTCTCTGG - Intronic
1132650786 16:1020670-1020692 CCCCCAGGGCTGCTGCCCTCAGG - Intergenic
1132909206 16:2299684-2299706 TGCTCCTGGCTGCTCCCCTCCGG + Intronic
1135543710 16:23351856-23351878 TTCCCAAAGTTGCTCCCCCCTGG + Intronic
1137863296 16:51868389-51868411 TACCCAAGGCTGCTAAACCCTGG + Intergenic
1138757062 16:59500609-59500631 TATCTAAGCCTGCTCACCTCTGG - Intergenic
1140435633 16:74944636-74944658 TACCCGAGGCTGTACCACTCGGG + Intronic
1141106069 16:81234817-81234839 GACCCAAGACTGGTCCTCTCAGG + Intergenic
1143582750 17:7836100-7836122 TTCCCAAGGCTTCTCCCGCCCGG + Intergenic
1145288259 17:21522430-21522452 CACCCCGGGCTGCTCCCCTCTGG - Intergenic
1145733257 17:27209753-27209775 TACAAGAGGCTCCTCCCCTCAGG + Intergenic
1145769968 17:27485869-27485891 CACCCAGGGCTGCTCCCCCGAGG + Intronic
1147653937 17:42077915-42077937 TGCCCAGGGCGGCTCCCCACTGG + Intergenic
1152556963 17:81058165-81058187 CACCCCAGGCTGCACGCCTCAGG - Intronic
1152627774 17:81396182-81396204 TACCCACGGCCGCTGCCCTGAGG + Intronic
1152693729 17:81733673-81733695 CACCCAGCCCTGCTCCCCTCCGG - Intergenic
1152936351 17:83139747-83139769 TCCCCAAGGCTGTTCTCCTGAGG + Intergenic
1154279845 18:12992803-12992825 TAAATAAGGCAGCTCCCCTCAGG - Intronic
1154490137 18:14915493-14915515 GACCCATTGCTGTTCCCCTCAGG + Intergenic
1155323866 18:24646674-24646696 TTCCCATTGCTGCTCCTCTCCGG - Intergenic
1156499337 18:37547262-37547284 CACCCAAGGCTGCTCCAGCCTGG - Intronic
1156927317 18:42597234-42597256 TGCCCCAGCCTGCTCCCCTGAGG - Intergenic
1159826263 18:73214889-73214911 TAGACAAGGCTCCTCCCCTTTGG + Intronic
1160673306 19:376619-376641 TTCCCCAGGCTGCTGCCTTCAGG + Intergenic
1160890356 19:1374515-1374537 TTCCCAAGGCTGTCCTCCTCAGG + Intronic
1161579082 19:5070927-5070949 TCCCCAAGGCTGGTCCCACCAGG + Intronic
1163149375 19:15401942-15401964 CGCCCAAGGCTGCTCCTCACAGG + Intronic
1163168257 19:15512246-15512268 CACCCAAGGCTGCTAACCTAGGG + Intronic
1165824878 19:38700049-38700071 GACCCGTGGCTGCTCTCCTCAGG - Intronic
927256619 2:21045096-21045118 TCCCCAAGGCACCTCCACTCTGG + Intergenic
929012347 2:37457306-37457328 TACCCAAGGCTGAGCCCCAGAGG - Intergenic
929621375 2:43358364-43358386 TTCCCAAGGCTCTTCCTCTCTGG + Intronic
932515119 2:72338788-72338810 TACCCAAGGCTGCTACAGACAGG + Intronic
933258693 2:80108193-80108215 TACCCAAGGCTGCTCCCCTCTGG - Intronic
934616659 2:95775410-95775432 GCCCCAAGGCTGGTCCCCTTTGG - Intergenic
934644231 2:96049149-96049171 GCCCCAAGGCTGGTCCCCTTTGG + Intergenic
934837646 2:97605239-97605261 GCCCCAAGGCTGGTCCCCTTTGG + Intergenic
935614426 2:105061707-105061729 TCCCCAATGCTCCTCCCCCCAGG - Intronic
936820253 2:116511132-116511154 TGCCCTAGCCTGCTCCCCTGAGG - Intergenic
937229573 2:120389674-120389696 TTCCCAAGACTGCCTCCCTCAGG + Intergenic
939080818 2:137659659-137659681 TGCAGGAGGCTGCTCCCCTCAGG + Exonic
942297696 2:174533704-174533726 GAGCCGTGGCTGCTCCCCTCAGG - Intergenic
943613390 2:190062333-190062355 TACCCAAAGCTCCTCCACTCCGG - Exonic
1169124810 20:3119953-3119975 GAACCAGGGCTGCTCACCTCAGG + Intronic
1170706755 20:18750449-18750471 AACTCAAAGCTGCTCCCCTTAGG - Intronic
1171457201 20:25278776-25278798 TGGCCACGGCTCCTCCCCTCCGG + Intronic
1174165713 20:48582195-48582217 TGCCCAGGGCTGCTCCCCACAGG + Intergenic
1175446329 20:59022751-59022773 TTCCCAAGCCTGTTTCCCTCTGG - Intronic
1179490785 21:41740481-41740503 AACCCAAGGTGGCTCGCCTCAGG + Exonic
1179980731 21:44894464-44894486 CACCCTGGGCTGCTCCCCTGGGG - Intronic
1180008743 21:45035509-45035531 TACCCAAGGCAGCTCTTCCCTGG + Intergenic
1180735044 22:18010187-18010209 TACAAGAGGCTCCTCCCCTCAGG - Intronic
1183099499 22:35575189-35575211 TCCCCATCCCTGCTCCCCTCTGG - Intergenic
1184080345 22:42214923-42214945 TTGCCAAAGCTGCTCCCCTGGGG + Exonic
1184266438 22:43349401-43349423 TGCCCAAGCCTGCTTCTCTCAGG + Intergenic
1184848366 22:47102939-47102961 TACTCAGGGCTGGTTCCCTCAGG + Intronic
952886531 3:38015884-38015906 TGCAGCAGGCTGCTCCCCTCAGG + Intronic
953688655 3:45098429-45098451 TATCCCAGGCTCCTCCCCTGGGG - Intronic
957066628 3:75528168-75528190 CACCCTAGGCTGCTCACCGCAGG + Intergenic
957149168 3:76463107-76463129 TATCCAAGGCTGCTCCCGCTGGG + Intronic
965928996 3:174018675-174018697 TACACAAGGGTGCTGCCTTCAGG + Intronic
967133354 3:186492908-186492930 TGCCCACAGCTGCTGCCCTCGGG + Intergenic
967210273 3:187162270-187162292 CTCCCTCGGCTGCTCCCCTCTGG + Intronic
967382467 3:188874380-188874402 TAACCAAGGCTGCTACCCCTTGG + Exonic
967445031 3:189555671-189555693 TCCCTATGGCTCCTCCCCTCAGG + Intergenic
968612901 4:1565077-1565099 TTGCCAAGGCTGGGCCCCTCTGG + Intergenic
968931440 4:3581622-3581644 TCCCGAAGGCTGCTACCCTGTGG + Intronic
976381254 4:84401861-84401883 AACCCAAGGCAGCCCCCTTCAGG + Intergenic
979505088 4:121486022-121486044 TTCCCCAGGCTGCTCCCCTAAGG - Intergenic
981458149 4:144980089-144980111 TGGCCAAGGCAGCACCCCTCTGG + Intronic
983784426 4:171714933-171714955 TCCCTAAGGCTGCTGCCCTGGGG + Intergenic
984782225 4:183536328-183536350 TACCAATTGCTGCTTCCCTCAGG - Intergenic
985858502 5:2449869-2449891 AACCCAAGGCTGCAACCCTTAGG + Intergenic
986465298 5:8015105-8015127 TTCCCAGGGCTGCTTCCCTGAGG + Intergenic
988509713 5:31854943-31854965 TCCCGAAGGCTGCTCTCCGCCGG - Intronic
996418482 5:123236027-123236049 TACCCGAGGCTGCTGCCGTGTGG + Intergenic
996930260 5:128877641-128877663 TTCCCAAGGCTGCTCCCTTTAGG + Intronic
997353695 5:133248828-133248850 TCCCCAAGGTGGGTCCCCTCTGG + Intronic
998182341 5:139954265-139954287 GGCCCCAGGCTGCTCCTCTCTGG - Intronic
1002183471 5:177443128-177443150 TACCCAAGGCTTCTTTCCTTAGG - Intergenic
1003328341 6:5109593-5109615 ATCCCAGGGCTGCTCCCTTCCGG + Intronic
1006569149 6:34986316-34986338 TACCCCTGGCTTCTCCCCTAGGG + Intronic
1006824343 6:36923386-36923408 GACCAAAGGCTGGACCCCTCTGG - Exonic
1007719308 6:43875936-43875958 TGCCCAAGGCTGCTACCTTCAGG + Intergenic
1013368028 6:109449479-109449501 TACCTAAGGCAGCCCCGCTCAGG + Exonic
1024670026 7:51585807-51585829 TACCCAAGGCTGCGCCCTGGGGG - Intergenic
1028048105 7:86149347-86149369 TACCCAAGCATGCTTTCCTCAGG - Intergenic
1032253184 7:130275418-130275440 CACCCCAGGCTCCTCCCCTTGGG + Intronic
1033453891 7:141485121-141485143 TACCCAAGACTGCTCTCCTGTGG - Intergenic
1034413442 7:150953123-150953145 CACCCAGTGCTGCTCCCCGCCGG + Intronic
1035224444 7:157425630-157425652 TTCCCAGGGCTGCTCCTGTCTGG + Intergenic
1042862140 8:73325694-73325716 CACTCAAGGCTGATCCCCTAAGG + Intergenic
1045102882 8:98863056-98863078 AGCCCAAGCCTGCTGCCCTCTGG + Intronic
1045297375 8:100883831-100883853 TGCTCAAGGCTGCTCCACACCGG + Intergenic
1045501760 8:102749023-102749045 TGCCCAAACCTGCTTCCCTCTGG - Intergenic
1048888955 8:138931252-138931274 TTCCCACGGCTCCTGCCCTCTGG - Intergenic
1049619513 8:143591722-143591744 GACCGAAGGCTGCCTCCCTCTGG - Intronic
1057141087 9:92727206-92727228 TACTGAAGGATGCTGCCCTCGGG - Intronic
1059392336 9:114007130-114007152 TCCCCAAGGCTGCTCATCACCGG + Intronic
1060051604 9:120382388-120382410 TACCCAAGCCTCCTCCTCCCTGG - Intergenic
1061002584 9:127910651-127910673 TACCCAGGGCTGCTGCCTCCAGG - Intronic
1062199852 9:135296814-135296836 TGCCTCAGGCTGATCCCCTCAGG + Intergenic
1187588398 X:20689534-20689556 TGCCCAAGGCTCTTCCCTTCAGG + Intergenic
1193300357 X:79881604-79881626 TACCCACTGCTGCTTCCCTGGGG + Intergenic
1197285833 X:124593702-124593724 TGCCCCAGCCTGCTCCCCTGAGG - Intronic
1197346103 X:125326956-125326978 GAACCAAGGCTGCTACCCCCTGG - Intergenic
1199103858 X:143838294-143838316 TACCCACTGCAGGTCCCCTCTGG + Intergenic