ID: 933261083

View in Genome Browser
Species Human (GRCh38)
Location 2:80132141-80132163
Sequence TCCACAAACATCACAATAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 3, 3: 6, 4: 136}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933261083_933261084 20 Left 933261083 2:80132141-80132163 CCTGCTATTGTGATGTTTGTGGA 0: 1
1: 0
2: 3
3: 6
4: 136
Right 933261084 2:80132184-80132206 TACTGTTAGCTAGAGCACTTTGG 0: 1
1: 0
2: 1
3: 15
4: 93
933261083_933261085 23 Left 933261083 2:80132141-80132163 CCTGCTATTGTGATGTTTGTGGA 0: 1
1: 0
2: 3
3: 6
4: 136
Right 933261085 2:80132187-80132209 TGTTAGCTAGAGCACTTTGGAGG 0: 1
1: 0
2: 2
3: 7
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933261083 Original CRISPR TCCACAAACATCACAATAGC AGG (reversed) Intronic
903099236 1:21013818-21013840 TCCACAAAGATTAGAACAGCTGG + Intronic
903401967 1:23060254-23060276 TCTACAAGCACCACTATAGCAGG - Intronic
903532936 1:24045824-24045846 TCTACAAAAATAAAAATAGCTGG - Intergenic
904129706 1:28266720-28266742 TCCACAAACAGTAAATTAGCTGG - Intronic
911249651 1:95560161-95560183 TTCACAACCTTCACAACAGCTGG + Intergenic
912666596 1:111586415-111586437 TCCACAAAAAACACAAAAACTGG + Intronic
914349352 1:146826907-146826929 TCCACAAACAGCACAGGAGGTGG - Intergenic
914872178 1:151484330-151484352 TCCACAAGCATCATAATTGTTGG + Intergenic
915725639 1:158015120-158015142 ACCCCAGACATCACAACAGCTGG + Intronic
920012271 1:202877414-202877436 TCCACAAAAAACAAAATAGCTGG - Intergenic
921710365 1:218367482-218367504 TTCAAAAACATCAGAATACCAGG - Intronic
924412212 1:243818705-243818727 TCCATAAAAATCACAATGACAGG + Intronic
1062940819 10:1419620-1419642 CCCACAAACATCTCTATATCAGG - Intronic
1063651557 10:7942877-7942899 TACACAAAAATCACATTTGCAGG + Intronic
1064215032 10:13393200-13393222 TCAACAAAGATCACACAAGCTGG + Intergenic
1066102547 10:32130693-32130715 TCCACAAACAACATAAAAACAGG - Intergenic
1066262215 10:33739944-33739966 CCTACAAACATCAGTATAGCTGG + Intergenic
1066418301 10:35241274-35241296 TCTACAAAAAACACATTAGCTGG + Intergenic
1066420226 10:35258557-35258579 TCCACAAATATCAGAATCACTGG - Intronic
1070270574 10:74950743-74950765 TCCACAAACTTCACAACTGATGG - Intronic
1071324432 10:84498265-84498287 TTCACAAACAGCATAACAGCAGG + Intronic
1071349854 10:84729237-84729259 TCCACGAACATCATAATGACAGG + Intergenic
1074596046 10:114868087-114868109 TCTACAAAAATAAAAATAGCTGG - Intronic
1077538938 11:3137645-3137667 TCTACAAACATAAAAACAGCCGG + Intronic
1079545629 11:21628969-21628991 TCCACCAAGATCACCATATCAGG - Intergenic
1086407078 11:86507604-86507626 TCCATAGACATCTCTATAGCAGG + Intronic
1088185395 11:107161786-107161808 AACACAAACAACTCAATAGCAGG + Intergenic
1091553329 12:1553446-1553468 TTCACAAACATCACAGCAACTGG - Intronic
1092708673 12:11310854-11310876 TACACACACATCACAAGAGATGG - Intergenic
1092712867 12:11356016-11356038 TACACACACATCACAAGAGATGG - Intronic
1092716663 12:11395992-11396014 TACACACACATCACAAGAGATGG - Intronic
1098397102 12:70030879-70030901 CCCACAGAGATCTCAATAGCTGG - Intergenic
1099796482 12:87407505-87407527 TGCAAAAACTACACAATAGCTGG + Intergenic
1106628101 13:31441710-31441732 TCCACACAAATCACCATAGGTGG - Intergenic
1107291884 13:38863992-38864014 TCTACCAAAATTACAATAGCTGG - Intronic
1108737074 13:53295358-53295380 TCCAAGAACATCACAAGAGGAGG - Intergenic
1112368545 13:98775152-98775174 TCCACAAACCTTTCAGTAGCAGG - Intergenic
1115447197 14:33504749-33504771 TCTCAAAACATCACCATAGCAGG - Intronic
1117099145 14:52327970-52327992 TACACAAACATCACAGTAAAAGG - Exonic
1117155807 14:52939477-52939499 TCTACAAACACTAAAATAGCTGG + Intronic
1117490053 14:56237647-56237669 TCCCCAAGCATCATAATTGCTGG + Intronic
1117840471 14:59855762-59855784 TCCTCTAACACCACATTAGCTGG + Intronic
1119514611 14:75238327-75238349 TACACGATAATCACAATAGCAGG - Intergenic
1123699231 15:22902350-22902372 ACCACATACATCACAGCAGCAGG - Intronic
1124460363 15:29884787-29884809 GCCACAAACACCACAGGAGCAGG + Intronic
1125130240 15:36276038-36276060 TCCCCAAACCACACAATTGCAGG - Intergenic
1132627254 16:897381-897403 TCCTCAAACACCACGTTAGCCGG - Intronic
1134233537 16:12448030-12448052 TCCACAATCAGCACAATCCCGGG - Intronic
1136603517 16:31314502-31314524 TCAACAAACCTGACAAAAGCAGG - Intronic
1139500328 16:67358516-67358538 TCCACAAAAAATAAAATAGCTGG - Intronic
1139984683 16:70888647-70888669 TCCACAAACAGCACAGGAGGTGG + Intronic
1143449291 17:7026370-7026392 TCCTCAAACCACACAGTAGCAGG - Intronic
1146197639 17:30826720-30826742 TTGAAAAAAATCACAATAGCTGG + Intergenic
1153965827 18:10181484-10181506 CCCACAAAAATCACAGTAGTTGG - Intergenic
1159779135 18:72641256-72641278 TCCACAAACTTCCCAATGCCAGG - Intergenic
1165224039 19:34341627-34341649 TCCAAAAACATCTTCATAGCTGG + Exonic
1168520145 19:57043620-57043642 TCCCCAAACATCTCTATGGCAGG + Intergenic
926710575 2:15876295-15876317 TACAAAAAAATCAAAATAGCTGG - Intergenic
926820504 2:16846981-16847003 TCCCCAAAGATCACCATAGTTGG + Intergenic
929401427 2:41586380-41586402 TCGACAAACATGACAAAAACAGG + Intergenic
931363574 2:61599386-61599408 TCCTCAACCTTCAGAATAGCTGG - Intergenic
933261083 2:80132141-80132163 TCCACAAACATCACAATAGCAGG - Intronic
939167905 2:138659048-138659070 TCCAAATACATCACTAAAGCAGG - Intergenic
939172800 2:138715451-138715473 ATAACAAACATCACAATAGCAGG + Intronic
946756112 2:222949335-222949357 TAAAAAAAAATCACAATAGCAGG - Intergenic
947770557 2:232666994-232667016 TTCACAATGGTCACAATAGCGGG - Intronic
1170282326 20:14664140-14664162 TTTACAAAAATCACAATAGATGG + Intronic
1170982820 20:21230690-21230712 ACCACTAACACCACAATGGCCGG - Intronic
1172748849 20:37235330-37235352 TGCACAAAAAGCACAATGGCAGG - Intronic
1174526386 20:51175301-51175323 CCCACAAACACCACAATCACCGG - Intergenic
1178537942 21:33425659-33425681 TCCACAAACATCACTATGGCTGG + Intronic
1179020028 21:37631549-37631571 TCTAGAAAGTTCACAATAGCAGG + Intronic
1179815353 21:43902671-43902693 TCTCCAAATATCACATTAGCAGG + Intronic
1182226687 22:28804209-28804231 TCCATAAACATAAAAATGGCTGG - Intergenic
1182387928 22:29962507-29962529 CCCACAAAAATAAAAATAGCCGG + Intronic
1183195788 22:36352552-36352574 GTCACAAACATCACACCAGCTGG + Intronic
1183687351 22:39368734-39368756 TCCAAAAACAGAACAATATCAGG - Intronic
1183689491 22:39380549-39380571 TCCACAAAAACCAAATTAGCCGG - Intronic
1184881921 22:47311742-47311764 TCTACAAAAAATACAATAGCTGG - Intergenic
950692297 3:14669536-14669558 TCAACTAACATCACAATCTCAGG - Intronic
951789216 3:26461044-26461066 ACCACGAACATTAAAATAGCAGG + Intergenic
952154488 3:30628029-30628051 TCCACAAACATTAGACTATCTGG - Intronic
952447742 3:33399008-33399030 TGCACAAACATTACAATACGTGG + Intronic
955356325 3:58236108-58236130 TCCACCAACATCCCCAGAGCAGG - Intergenic
955635849 3:61028764-61028786 TCAACAACCATCACAGTAGTAGG - Intronic
960265578 3:115617323-115617345 TCAAAAACCATAACAATAGCTGG - Intergenic
962357452 3:134707026-134707048 TCCAAAAAAGTCACAATAACAGG + Intronic
964218548 3:154317964-154317986 TAAACAAACACCAAAATAGCTGG + Intronic
964378189 3:156070155-156070177 TCCACTAAAGTGACAATAGCTGG - Intronic
968297642 3:197589721-197589743 TCTACAAAAAACAAAATAGCTGG + Intergenic
969949548 4:10820383-10820405 TCCACAAACTTGCCAATAGTGGG + Intergenic
970694978 4:18666635-18666657 TCCACAGACATCGCAACTGCTGG - Intergenic
973264154 4:48194268-48194290 TCCACTAACATCAGATAAGCAGG - Intronic
977241223 4:94572236-94572258 TCCACTCATATCACACTAGCTGG - Intronic
977743094 4:100510906-100510928 TCAACAAACATAACAATGACTGG + Intronic
978580859 4:110229803-110229825 TCCAAAAACTTCACAATATCAGG - Intergenic
980067128 4:128201943-128201965 TTCTCAAAGATCACAATATCTGG - Intronic
983328380 4:166289946-166289968 TCCTCAAACATGACAATCTCTGG + Intergenic
983392153 4:167145918-167145940 TCAACTAGCATCACAATGGCAGG + Intronic
985034971 4:185829384-185829406 TACACCAAGATCTCAATAGCTGG - Intronic
986973686 5:13369831-13369853 TCCAGAAGTATCACAATACCTGG + Intergenic
988131524 5:27112888-27112910 TCAACAAACATGACAAAAACAGG + Intronic
988303854 5:29469100-29469122 TACATAAAAATCAAAATAGCTGG + Intergenic
989630986 5:43482820-43482842 TCCACAAACATATAATTAGCTGG + Intronic
989787146 5:45345563-45345585 TCCACAAAGATCTCTATGGCAGG + Intronic
992348944 5:75909913-75909935 TCCACAGACACAATAATAGCCGG + Intergenic
995491778 5:112700758-112700780 TCCACAAGCATCACAAAACCTGG + Intergenic
998148657 5:139744863-139744885 TGCAGAGAAATCACAATAGCAGG - Intergenic
1000029558 5:157390208-157390230 GCCACATACATCTCAACAGCTGG + Intronic
1007033804 6:38654211-38654233 TCCACAAACTTAACAACAGGAGG - Intergenic
1015898162 6:138036707-138036729 TCCACAGAAATCATAAAAGCAGG + Intergenic
1015960676 6:138645826-138645848 TCCACAAACATCACCAGAGCAGG + Intronic
1020693260 7:11385391-11385413 TACACAAACATCATAATACATGG - Intronic
1024531397 7:50396153-50396175 TCAACAGAGATCACAATAGATGG - Intronic
1025121145 7:56304858-56304880 TACACCAACGCCACAATAGCCGG + Intergenic
1026072139 7:67131315-67131337 TACACAAAAATGACAATAGAGGG - Intronic
1026318793 7:69251025-69251047 TACCAAAACATCACATTAGCAGG + Intergenic
1027654324 7:80911236-80911258 TCCACAAAGATCACAATGAAAGG - Intronic
1028057094 7:86259210-86259232 AACCCAAACAACACAATAGCAGG + Intergenic
1028972404 7:96873907-96873929 TACATCATCATCACAATAGCAGG + Intergenic
1031382315 7:121102355-121102377 TCCCCAAACATCATACTAGCTGG - Intronic
1031720383 7:125168061-125168083 TTCATAAACTTCACAATATCTGG + Intergenic
1034357314 7:150461816-150461838 TCCAAAAACAACACAATGACAGG - Intronic
1036531838 8:9597610-9597632 CCCACAAATATTTCAATAGCAGG + Intronic
1037422131 8:18713999-18714021 TCAACAAACCTGACAAAAGCAGG + Intronic
1038885199 8:31655665-31655687 TTCAAAAACATCACAACTGCTGG + Intronic
1046635937 8:116675964-116675986 TCCAAAAACATCAAAATATGAGG + Intronic
1046991112 8:120455542-120455564 TCAGCAAAGATCACTATAGCAGG + Exonic
1047109413 8:121772297-121772319 TCCACAAAAATAATAAAAGCAGG - Intergenic
1047168396 8:122466042-122466064 TCAACAAACACCAAAACAGCTGG - Intergenic
1048147026 8:131855170-131855192 GCCACACCCTTCACAATAGCAGG - Intergenic
1048932601 8:139326860-139326882 GTCACAATCATCACAATAACTGG + Intergenic
1054584028 9:66946421-66946443 TCAACAAACCTGACAAAAGCAGG - Intergenic
1055176392 9:73323161-73323183 TTCACAAAGATCAAAAAAGCTGG - Intergenic
1057323063 9:94031848-94031870 TCCACATACATAACTATCGCAGG - Intronic
1057958112 9:99427991-99428013 TCCACAAACACCAAGATAGAAGG - Intergenic
1186757196 X:12684515-12684537 CCCACAAGCATCACAATAGCTGG - Intronic
1187174773 X:16886485-16886507 ACCAGAAACATCACAAAATCTGG + Intergenic
1190151271 X:47951656-47951678 TCCACTAACAACAAATTAGCAGG + Intronic
1191887268 X:65901535-65901557 TCCACATCCATCACAGTAGTAGG - Intergenic
1194528535 X:95012499-95012521 TGCACATACATCTCAACAGCTGG - Intergenic
1195172456 X:102282182-102282204 CCCACAAACCTCACCATGGCAGG - Intergenic
1195186408 X:102404913-102404935 CCCACAAACCTCACCATGGCAGG + Intronic
1196928091 X:120654011-120654033 ACCACAAACATCACAAAATCAGG - Intergenic
1197511323 X:127372250-127372272 CCCACAGCCATCACCATAGCTGG + Intergenic
1198427900 X:136538180-136538202 GCCTTAAACATCACACTAGCAGG + Intronic