ID: 933261085

View in Genome Browser
Species Human (GRCh38)
Location 2:80132187-80132209
Sequence TGTTAGCTAGAGCACTTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 104}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933261083_933261085 23 Left 933261083 2:80132141-80132163 CCTGCTATTGTGATGTTTGTGGA 0: 1
1: 0
2: 3
3: 6
4: 136
Right 933261085 2:80132187-80132209 TGTTAGCTAGAGCACTTTGGAGG 0: 1
1: 0
2: 2
3: 7
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933261085 Original CRISPR TGTTAGCTAGAGCACTTTGG AGG Intronic
907303093 1:53500411-53500433 TGTTCTCTAGAGCACTTGTGTGG - Intergenic
911297008 1:96130036-96130058 TATTAGCTAGATCACGGTGGTGG - Intergenic
918931932 1:190865170-190865192 TGTAAGCTAAAGCACTTTTGTGG - Intergenic
918962862 1:191303051-191303073 TGTCAGCAAAAGCACTCTGGTGG + Intergenic
919077495 1:192831034-192831056 TGGAAGGTAGAGCACATTGGAGG + Intergenic
922474558 1:225898338-225898360 TGTTAACGAGAGCACTGTAGGGG + Intronic
1065654582 10:27934951-27934973 TGTTAGGGAGAACACTTGGGAGG - Intronic
1071570240 10:86692692-86692714 TGTCAGCTGGAGCCCTTTGCAGG - Intronic
1081345980 11:41986820-41986842 TGTTTTCTAGAGTACTTTGAGGG + Intergenic
1085150391 11:74248097-74248119 TGTTAGCTAGATAACAGTGGAGG + Intronic
1087112627 11:94487597-94487619 TGTCTGTTACAGCACTTTGGAGG - Intronic
1088125184 11:106415774-106415796 TGTGAGCAGGAGCACTGTGGGGG + Intergenic
1092513610 12:9184632-9184654 TGTCAGCCAAAGCACTTTGCAGG - Intronic
1095835804 12:46637752-46637774 TGTTAGCCAGAGAACACTGGTGG - Intergenic
1097582977 12:61481158-61481180 TGTTGGCTAGAGAACACTGGTGG - Intergenic
1098215866 12:68217726-68217748 TTTTAGCTAGAACACTTTATAGG - Intronic
1098216696 12:68228035-68228057 TGTTATTTAGGACACTTTGGGGG - Intergenic
1102227675 12:111240429-111240451 TGTTAGCTTGAGTGCTGTGGGGG - Intronic
1102376407 12:112425108-112425130 TGTAATCTCCAGCACTTTGGAGG - Intronic
1105410764 13:20169413-20169435 TGTTAGATAAAACCCTTTGGAGG + Intergenic
1112958731 13:105094384-105094406 TGTTAGATAGGGAACATTGGAGG - Intergenic
1117249265 14:53919104-53919126 TTTTAGTTAGAGTAATTTGGTGG - Intergenic
1120459922 14:84781682-84781704 TCTTGGCTAAAGCACTTTTGAGG - Intergenic
1121358461 14:93233913-93233935 TGTTTGGAAGAGCAGTTTGGCGG - Intergenic
1122735681 14:103839368-103839390 TGTTAACCCCAGCACTTTGGGGG + Intronic
1124056833 15:26248631-26248653 TTCTAGCTAGAGCAATTAGGTGG - Intergenic
1125270746 15:37936075-37936097 TGTTAGATTGAGCACTTTGGAGG + Intronic
1126825936 15:52547994-52548016 TGATAACTAAAGCAGTTTGGTGG - Exonic
1128851566 15:70963007-70963029 TGTTAATTCCAGCACTTTGGGGG + Intronic
1129556900 15:76519794-76519816 ATTTAGCTAGAGGAGTTTGGGGG - Intronic
1134382134 16:13737695-13737717 TGTTAGCAAGAGCAGTTTCATGG - Intergenic
1138360328 16:56422810-56422832 TGTTATTTTGGGCACTTTGGAGG - Intronic
1140037595 16:71383059-71383081 TGATAGCCAGAGGAATTTGGAGG - Intronic
1143360862 17:6369626-6369648 TGATTGATAGATCACTTTGGGGG - Intergenic
1143825498 17:9603035-9603057 TGTTACATGGAGCTCTTTGGAGG - Intronic
1145897628 17:28469642-28469664 TGATATCTAGGGCACTTTGCAGG + Intronic
1147026306 17:37587684-37587706 CGTTACCAAGAGCAGTTTGGGGG - Intronic
1148616057 17:48999878-48999900 TGTGAGCTGGGGCTCTTTGGAGG + Intronic
1148645353 17:49217112-49217134 TGTGCGCTAGAACACTGTGGCGG - Intronic
1149195990 17:54121938-54121960 TATTAGGTAGAGTACTTTGAGGG - Intergenic
1149340794 17:55684150-55684172 CATTAGCTGGAGCAATTTGGAGG - Intergenic
1151005313 17:70429392-70429414 TGTTAGCTATAGGATTTTTGTGG - Intergenic
1155844960 18:30694863-30694885 TGTGAGCCAAAGCACTTTGTAGG + Intergenic
1159654436 18:71014909-71014931 AGGTAGCAAGAGAACTTTGGAGG - Intergenic
926214761 2:10898088-10898110 TGTGAGACAGAGCTCTTTGGGGG - Intergenic
931938359 2:67223574-67223596 TGTCAGTTAGGGCACTTTAGGGG - Intergenic
933261085 2:80132187-80132209 TGTTAGCTAGAGCACTTTGGAGG + Intronic
936233357 2:110723771-110723793 TGTTACCAATAGAACTTTGGAGG - Intergenic
938890765 2:135702949-135702971 TGTTAGAGACAGCACTTTAGTGG - Intronic
940185430 2:150979677-150979699 TGTTAACCAAAGCACTTTTGGGG - Intergenic
940255321 2:151722469-151722491 TGATAGCAAGAGCTCTTTGTGGG + Intronic
946167876 2:217876401-217876423 TGTTAGCCAGAGCACTGAGCCGG + Intronic
947120868 2:226813387-226813409 TGTTAGATAGATCACTCTTGTGG + Intergenic
947609239 2:231513096-231513118 TGTTTGCAATAGCACTTTTGAGG + Intergenic
947795308 2:232890613-232890635 TTTTACCTTGAGCAGTTTGGGGG - Intronic
948162752 2:235838340-235838362 TTTTAGCAAAATCACTTTGGAGG - Intronic
1170709930 20:18781478-18781500 TGTCAGCTAGTGATCTTTGGTGG + Intergenic
1172875204 20:38160011-38160033 TGTTAGCAAGAGAACTTTGGGGG + Intronic
1172964272 20:38822934-38822956 TGTTAGCAATACCACTTTCGTGG + Intronic
1173689742 20:44951176-44951198 TGTGAGCTAGAGTTTTTTGGGGG + Intronic
1177106235 21:16958818-16958840 AGCTAGCTAGAGCATTTTGAAGG - Intergenic
1184874339 22:47263653-47263675 GGTTAGCCAGGGGACTTTGGTGG + Intergenic
949980050 3:9496775-9496797 TTTTAGAAAGAGCACTCTGGTGG - Intergenic
952841171 3:37646749-37646771 TGTTTGCCAGAGGACTTAGGAGG + Intronic
955072786 3:55585629-55585651 TGTTAGAGAGAGCTCTTTGGGGG + Intronic
959193655 3:103148671-103148693 TGTTGAGTAGAGCACATTGGGGG - Intergenic
959540427 3:107531300-107531322 TGGAACCTAGAGCTCTTTGGTGG - Intronic
961154961 3:124671785-124671807 TTATAGCTGGAGCCCTTTGGGGG - Intronic
961432002 3:126890084-126890106 AGTGAGCTGGAGCACCTTGGGGG - Intronic
963396084 3:144736197-144736219 TGTTGCTTAGAGAACTTTGGTGG + Intergenic
973533721 4:51859538-51859560 TCTTACCTAGAGTAGTTTGGGGG + Intronic
984830773 4:183970692-183970714 TGCTGGCTGCAGCACTTTGGTGG - Intronic
985027962 4:185758244-185758266 TCCTGGCTAGAGCAATTTGGTGG - Intronic
988128391 5:27073080-27073102 TGTTAGCTAGAGACCTTGGTGGG - Intronic
988315422 5:29620475-29620497 TTTTATATAGAGAACTTTGGTGG + Intergenic
988499543 5:31772994-31773016 TGTGAGACAGAGGACTTTGGAGG + Intronic
988868375 5:35360617-35360639 TGTTTGATAGTTCACTTTGGAGG - Intergenic
994430978 5:99660990-99661012 TGTTAGCTTGAGCGCTTGGATGG + Intergenic
996801924 5:127413753-127413775 AGGAAGCTAGAGCACTTTGGAGG - Intronic
997205041 5:132043279-132043301 TGTTAGCCAGAGAACACTGGTGG + Intergenic
999676769 5:154012029-154012051 TTTTAGAAAGATCACTTTGGTGG + Intronic
1001225051 5:169936994-169937016 TGGTAGCTTGAACACTGTGGAGG + Intronic
1006565009 6:34948605-34948627 AGGAAGCTAGAGCACTTTGAGGG - Intronic
1007192195 6:40028939-40028961 AGTTAGAAAAAGCACTTTGGGGG + Intergenic
1008385704 6:50887483-50887505 TGAGAGCTAGATCACTCTGGAGG - Intergenic
1008539385 6:52533711-52533733 TACTAGCTAAAGGACTTTGGGGG - Intronic
1010255241 6:73749895-73749917 TTTTAGGAAGATCACTTTGGTGG + Intronic
1012616369 6:101283797-101283819 TGTCAGCTAGAGAACACTGGTGG - Intergenic
1015415954 6:132948911-132948933 TGTTACCTAAAGCCCTTGGGAGG + Intergenic
1019097156 6:169591597-169591619 TTTTAGCTATAGCTTTTTGGGGG + Intronic
1021312216 7:19108925-19108947 TGATACCAAGAGCAGTTTGGTGG - Intronic
1021921893 7:25494179-25494201 TGTGTGCTAGAGCACTCTGCAGG + Intergenic
1022807653 7:33838790-33838812 TGTCTGCTAGAGCTCTTTTGTGG + Intergenic
1028208307 7:88042299-88042321 TGTTAGCTAGAGCATCTTGTAGG + Intronic
1028639925 7:93030261-93030283 TGTCAGCTAAAGCACTTTGTAGG - Intergenic
1030827900 7:114184437-114184459 TTTTAGCTATAGGACATTGGGGG + Intronic
1034928443 7:155141634-155141656 TGTTAGCAATAGCACTTTGAAGG + Intergenic
1041679385 8:60572774-60572796 TATAAGCTAAAGCTCTTTGGGGG - Intronic
1044125796 8:88457049-88457071 TGTTGGCTAGAGAGCTTGGGTGG - Intergenic
1044303019 8:90607330-90607352 TGTAAGCATGAGCAATTTGGAGG - Intergenic
1050471643 9:5998049-5998071 TTTTGGCTAGAGCAATTTGGTGG + Intronic
1054890876 9:70250432-70250454 GGTTAGCTAGAGTTCTTTGTTGG - Intergenic
1055122414 9:72677097-72677119 TGTTAGCCAGGGCACTCTAGGGG + Intronic
1055208578 9:73762564-73762586 TGTTAGCTGGAGAACACTGGCGG - Intergenic
1055549339 9:77416462-77416484 TGGTATCAAGAGAACTTTGGTGG + Exonic
1189455451 X:41184103-41184125 TGTTAGATATAGCACTTGTGAGG - Exonic
1189745718 X:44166974-44166996 TTTTAGAAAGAGCACTGTGGTGG - Intronic
1194985118 X:100481774-100481796 TGTTAGATATATGACTTTGGAGG - Intergenic
1196637277 X:118017077-118017099 TGCTAGAAAGATCACTTTGGTGG - Intronic
1197077066 X:122364815-122364837 TGTCAGCTAGAGGACATTTGTGG + Intergenic
1197141566 X:123122523-123122545 TGTCAGCCAAAGCACTTTGTAGG - Intergenic
1197578952 X:128257621-128257643 TGTTGGCTAGAGTATTTTGTAGG - Intergenic
1198648474 X:138836009-138836031 TGTAAGCTAGAAGACATTGGGGG - Intronic
1201327986 Y:12786308-12786330 TGTTAGGTATAGAACTTGGGAGG - Exonic