ID: 933264466

View in Genome Browser
Species Human (GRCh38)
Location 2:80167578-80167600
Sequence TGTCCTTGAATGTGGACCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 151}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933264466 Original CRISPR TGTCCTTGAATGTGGACCTG AGG Intronic
901794437 1:11672264-11672286 TGTCCATGACAGTGCACCTGGGG - Intronic
902841830 1:19079383-19079405 AGTCCTGGAAGGTGGACCCGTGG + Intronic
905477826 1:38241421-38241443 TTTCCCTGAATTTGGACTTGGGG - Intergenic
905724677 1:40240819-40240841 TTGACTTGAATGTGCACCTGAGG + Exonic
906901757 1:49843571-49843593 TGTCCTTAAATGTGGAAAAGAGG - Intronic
909789856 1:79662285-79662307 TGTCCTAGACTGTGAACTTGTGG + Intergenic
912486091 1:110029664-110029686 TGTCCTGGGTTGTGGCCCTGAGG + Intergenic
918149095 1:181782829-181782851 TGGCCTTGAATTTGTACCTCTGG + Intronic
919684068 1:200465401-200465423 TGTAATTGACTGTGGACGTGTGG - Intergenic
919815573 1:201436481-201436503 TGTCCTTGAATGGGTTCCAGAGG - Intergenic
920524923 1:206659463-206659485 TGTCCTGGCATGAGGAGCTGTGG + Intronic
921714501 1:218404017-218404039 TGTCTTTGAATATGCAACTGAGG - Intronic
922130619 1:222773610-222773632 TGTCCTAGAATATGGACTTTGGG + Intergenic
923458338 1:234185703-234185725 AGTCCTCAAATGTGGACCTAAGG + Intronic
1065825820 10:29570161-29570183 AGTCCTGGAATTTGGAACTGTGG + Intronic
1072642046 10:97219029-97219051 TCTGCTTGTAAGTGGACCTGTGG - Intronic
1074309938 10:112313485-112313507 TGTCTCTGCCTGTGGACCTGGGG - Intergenic
1075892835 10:125969448-125969470 TGTCTATGAATGTGTATCTGTGG + Intronic
1076892041 10:133289681-133289703 TGTCCGTGAATGCGGGGCTGAGG - Intronic
1080901511 11:36497039-36497061 TGTTCTTAAATGTGTACTTGAGG - Intronic
1081573926 11:44307953-44307975 TGTGCCTGCATGTGGAGCTGTGG + Intronic
1082759678 11:57115232-57115254 TGGACTTGAATGTGGTCCAGTGG + Intergenic
1083844181 11:65321440-65321462 TGTCCCTGCACGTGGACCTGGGG + Exonic
1084176657 11:67425830-67425852 TCTCGTTGAATGTGGCCCTCTGG - Intergenic
1084480939 11:69419796-69419818 TGTCCGTGACTGTGGAGCGGAGG - Intergenic
1085184329 11:74562541-74562563 TGCCCTTGCTTGTGGACCTCTGG + Intronic
1088000772 11:104877487-104877509 TGTTATTGAAAGTGGACCTCTGG - Intergenic
1088535051 11:110851473-110851495 TGTCCTTGAATCTGTACCAAAGG - Intergenic
1089698727 11:120231397-120231419 AGCCCTTGGATGTGGCCCTGTGG - Intergenic
1090033916 11:123231589-123231611 AGATCTTGAATGTGGACCTACGG + Intergenic
1090094916 11:123733158-123733180 TAACCTTGAATGTGGATGTGAGG - Intronic
1091637317 12:2207097-2207119 GCTCCTCGAATGTGGTCCTGGGG - Intronic
1091918435 12:4285838-4285860 TGTCCTTGAGAGTGGTCCTGGGG + Intronic
1092950447 12:13498625-13498647 TGTCCCTGACTGTGCAACTGTGG - Intergenic
1095958185 12:47818594-47818616 TGGACTTGCATCTGGACCTGTGG - Intronic
1096441369 12:51646079-51646101 TGTTCCTGAATGTGTTCCTGGGG - Intronic
1100389412 12:94135077-94135099 TGTCATTGTATGTGGGGCTGTGG + Intergenic
1101453886 12:104809262-104809284 TGGCCTAGACCGTGGACCTGGGG - Intronic
1101965602 12:109279920-109279942 TGTCTTTGAAAGGGAACCTGTGG - Exonic
1102562056 12:113769393-113769415 TGTCCTTGCAGCTGGCCCTGGGG - Intergenic
1109469273 13:62783710-62783732 TTTCCCTGTATTTGGACCTGGGG + Intergenic
1111740438 13:92198025-92198047 TGTGCCTGACTCTGGACCTGAGG + Intronic
1113469730 13:110535837-110535859 TCTCCTTGAAGGTGAACCAGAGG + Intronic
1113910545 13:113839285-113839307 CGTCCTTCAGTGTAGACCTGTGG - Intronic
1113910560 13:113839359-113839381 CGTCCTTGAGTGCAGACCTGTGG - Intronic
1113910575 13:113839433-113839455 CGTCCTTGAGTGCAGACCTGTGG - Intronic
1115746982 14:36448132-36448154 TGTACTTGAATGAGGACATAGGG + Intergenic
1119495030 14:75070701-75070723 AGTCCTTGAAGGGGCACCTGAGG + Exonic
1120848197 14:89144846-89144868 TGACCTACAATGTGGACCTAGGG + Intronic
1121513409 14:94531664-94531686 TTTCCGTGAATTTGAACCTGGGG - Intergenic
1124595123 15:31085959-31085981 TGTCCTGGAAGGAAGACCTGTGG + Intronic
1124895040 15:33768489-33768511 TGTTCCTGAGTGTGGACCAGAGG + Intronic
1125578645 15:40770935-40770957 TCTCCTTCAAAGTGGACCTGGGG + Exonic
1126053374 15:44707534-44707556 TGGCCTGGAATGTGGGCCTCAGG + Intronic
1130679928 15:85987833-85987855 TAACCTGGAATGTGGACTTGAGG - Intergenic
1131592798 15:93767970-93767992 TGTCCATGCATGTGGATCTTTGG + Intergenic
1131956324 15:97740097-97740119 TGTCCTTCAATGTGGATCGATGG + Intergenic
1132355544 15:101168747-101168769 TGTCACTGAATGTGGGGCTGGGG + Intergenic
1132951829 16:2567211-2567233 TGACCTTGAAGGTGAACCTCGGG + Intronic
1132962521 16:2632959-2632981 TGACCTTGAAGGTGAACCTCGGG - Intergenic
1133712952 16:8419222-8419244 TGAGTTTGAATGAGGACCTGTGG - Intergenic
1134315622 16:13116301-13116323 TGTCCATGAATGAGAACCTGGGG - Intronic
1137475393 16:48803737-48803759 TGGGCTTGAATGTGCAGCTGTGG - Intergenic
1140931409 16:79631406-79631428 TGTCCTTGAGTGGAGACCTTGGG - Intergenic
1141660713 16:85439733-85439755 TGTGCATGCATGTGGATCTGTGG - Intergenic
1141966529 16:87448907-87448929 TATCCTTGAATTTGGAGCTGTGG + Intronic
1142310296 16:89308416-89308438 TTGCCTTGACCGTGGACCTGGGG - Intronic
1144710504 17:17398661-17398683 TGTCCCTCCATGTGGTCCTGGGG + Intergenic
1146399176 17:32489910-32489932 AGTGCTGGAATGGGGACCTGGGG + Exonic
1147652235 17:42069247-42069269 TGTCCATCAATGTGGAGCTGGGG + Intergenic
1147724033 17:42555386-42555408 TGGCCTTTAATATGGACTTGAGG - Intergenic
1149757707 17:59201321-59201343 TTGCCTAGAATGTGGACATGAGG - Intronic
1149772725 17:59333350-59333372 TGTCATTGAATGCTAACCTGCGG - Intronic
1155675895 18:28428346-28428368 TGTGCTTGAATGTGTTTCTGAGG + Intergenic
1156605933 18:38667305-38667327 TGTTCTTGAATGTGTGCTTGAGG + Intergenic
1157992313 18:52511535-52511557 TATTTTTGAATGAGGACCTGGGG + Intronic
1159245797 18:65803077-65803099 TGGCTTTGAATGTTGACGTGAGG - Intronic
1159795445 18:72837742-72837764 TGTCCTTGAATGAGAGCTTGGGG + Intronic
1161564155 19:4990421-4990443 TGTACTGGAATGAGGGCCTGGGG + Intronic
1162564988 19:11441050-11441072 TGTCCTTGAAAGAGGAACAGTGG - Intronic
1166221259 19:41366152-41366174 TGTCCTTTAAGCTGGAGCTGGGG + Intronic
1166432166 19:42737117-42737139 GGTCCTGGACTGTGGAACTGGGG - Intronic
1166435283 19:42762310-42762332 GGTCCTGGACTGTGGAGCTGGGG - Intronic
1166452548 19:42914513-42914535 GGTCCTGGACTGTGGAGCTGGGG - Intronic
1166464828 19:43023079-43023101 GGTCCTGGACTGTGGAACTGGGG - Intronic
1166482107 19:43183177-43183199 TGTCCTGGACTGTGGAACTGGGG - Intronic
1166484588 19:43202295-43202317 GGTCCTGGACTGTGGAACTGGGG - Intronic
1166491710 19:43266176-43266198 GGTCCTGGACTGTGGAACTGGGG - Intronic
1167530106 19:50010414-50010436 GATCCTTGGATGTTGACCTGTGG + Intronic
929263662 2:39894641-39894663 TGTCTTTTAATGTAAACCTGTGG + Intergenic
929537603 2:42793130-42793152 TCACCTTGAATCGGGACCTGCGG - Intergenic
929772623 2:44905205-44905227 TGTCCTTGAAAGGAGACCTTAGG + Intergenic
931235650 2:60410616-60410638 TGTCCTTGAAGGTGAGCCTCGGG - Intergenic
931873591 2:66487640-66487662 TGTCCTTCTAAGAGGACCTGTGG + Intronic
933264466 2:80167578-80167600 TGTCCTTGAATGTGGACCTGAGG + Intronic
933548052 2:83740072-83740094 TGACCTTGGATTTGGACCTTTGG - Intergenic
943519577 2:188931617-188931639 TGGCCTTAAATGTGGACTGGTGG - Intergenic
943612266 2:190047098-190047120 TGTCCTTGTATGTCTCCCTGAGG - Intronic
946776278 2:223144901-223144923 TGTCCATGACTGTGGTCCTATGG - Intronic
947348316 2:229217048-229217070 CAGCCTTGAATGTGGACCTCTGG - Intronic
948124717 2:235556258-235556280 TGTTCTTGGACCTGGACCTGGGG - Intronic
948423807 2:237875872-237875894 TGTCCCTGGAGGTGCACCTGGGG - Intronic
948919220 2:241053468-241053490 TGTCTGTGAATGTGGACCTTGGG + Intronic
1169509217 20:6245555-6245577 GGTCCTTGAGTGGGGCCCTGAGG - Intergenic
1169842945 20:9960024-9960046 GGGCCTTGAATGAGCACCTGTGG - Intergenic
1170272836 20:14547765-14547787 TCTCCTCGATTGTGTACCTGAGG + Intronic
1173588917 20:44209431-44209453 TTTCTTTGAATGGGGATCTGGGG - Intronic
1175774606 20:61645098-61645120 TGTGCTTGAATTTGGAGATGGGG - Intronic
1176519634 21:7814903-7814925 TGTCCTCGAGTGTGGTCCTGGGG - Intergenic
1178653662 21:34444916-34444938 TGTCCTCGAGTGTGGTCCTGGGG - Intergenic
1180858777 22:19064822-19064844 AGTCCTGGATTGGGGACCTGAGG - Intronic
1181666615 22:24402632-24402654 TCTGCCTGAAGGTGGACCTGGGG + Intronic
1181977943 22:26745105-26745127 CGTCATTGAATGTGGAGTTGGGG + Intergenic
1182896180 22:33861192-33861214 TTTCCTTTAATGTGGAGCTTTGG - Intronic
1183665831 22:39245162-39245184 AGTCCATGAATCTGGCCCTGGGG + Intergenic
1184364115 22:44038478-44038500 TGTACTTAAAACTGGACCTGGGG + Intronic
1185166176 22:49263641-49263663 CGTCCTTGACTGTTGCCCTGGGG - Intergenic
954871373 3:53769807-53769829 TCTCCTTGGAGGTGGACTTGAGG - Intronic
957224750 3:77429180-77429202 TACTCTTGAATGTGGACTTGTGG + Intronic
957292075 3:78290829-78290851 TGTCCGTGAATATGGACAAGTGG + Intergenic
959346565 3:105202445-105202467 TGTCCTTTAATTTCAACCTGCGG + Intergenic
960051324 3:113241771-113241793 TGGCCTTCAATGCGGCCCTGGGG - Intronic
969868416 4:10090359-10090381 TTTCCTTGAGTGTGGCCCTTGGG - Intronic
970153408 4:13115929-13115951 TGTTCTGGAATATGAACCTGTGG - Intergenic
970732648 4:19125164-19125186 TGGCCATGAATCTGGAACTGAGG + Intergenic
971260522 4:25052742-25052764 TGTCCTCCTATGAGGACCTGAGG - Intergenic
971481802 4:27121506-27121528 TGCTCTTAAATGTGGACATGGGG - Intergenic
972421889 4:38895324-38895346 TGGCTTTGAAGGAGGACCTGAGG - Intronic
985027117 4:185748925-185748947 TATTCTTGGATGAGGACCTGGGG + Intronic
988678455 5:33458854-33458876 TGAGCTTGAAGGGGGACCTGTGG + Intronic
989197652 5:38731528-38731550 TGTCCCTGAGTGTTGACTTGGGG - Intergenic
992511008 5:77434960-77434982 TGTCCTTGAATGTAAGGCTGAGG - Intronic
995295576 5:110517189-110517211 TGTCTTTGTATTTAGACCTGTGG + Intronic
1000209752 5:159098275-159098297 TGCCCTTGGAGGTTGACCTGAGG - Intronic
1001576355 5:172766700-172766722 TGTCCTTGACTTTGCCCCTGTGG - Intergenic
1002655803 5:180745697-180745719 GGTCCCTGAGTGTAGACCTGTGG - Intergenic
1004490314 6:16109222-16109244 TGTCCAGGAATTTGGACTTGGGG + Intergenic
1005037450 6:21569856-21569878 GGTCCTGGAATGAGGACCTTGGG + Intergenic
1009865264 6:69390124-69390146 TTTCCTTTAATGTGTATCTGAGG - Intergenic
1013541150 6:111110598-111110620 GGTCATTAAATGTGGTCCTGGGG + Intronic
1018786595 6:167113236-167113258 TGTATCTGAATGTGCACCTGAGG - Intergenic
1018931058 6:168240637-168240659 TGTGCTTGAATGTGACCCTGTGG - Intergenic
1022574879 7:31487823-31487845 TGACCTTGAATGTGAAGCTGAGG - Intergenic
1024287759 7:47774032-47774054 TGTCCATCAATGTGGAAATGAGG + Intronic
1033527901 7:142234646-142234668 TGTGCTTGCATTTGCACCTGTGG - Intergenic
1034243745 7:149628691-149628713 AGTACTTGAAACTGGACCTGGGG + Intergenic
1035617548 8:1013335-1013357 TGTCCTTTAATCTGTGCCTGTGG - Intergenic
1043360492 8:79466310-79466332 TTTCCTTGTGTGTGGGCCTGTGG - Intergenic
1043989041 8:86729982-86730004 TTCCCTGGAATGTGTACCTGTGG + Intronic
1052171607 9:25404548-25404570 TGTGCTTAAATGTGGATGTGAGG + Intergenic
1055835965 9:80442308-80442330 TTTACTTAAATGTGGACCTAAGG - Intergenic
1056275684 9:84992042-84992064 GGTGCTGGAATGTGGACCAGTGG + Intronic
1058173431 9:101710463-101710485 TACCCTTGAATATGGACTTGGGG - Intronic
1059555517 9:115276616-115276638 TGGCCTGGAATGGGGACCTCAGG + Intronic
1061048225 9:128178888-128178910 TGTGCCTGTGTGTGGACCTGTGG + Exonic
1062013332 9:134278422-134278444 TTTCCTTGCTTGTGGGCCTGTGG - Intergenic
1185587766 X:1253188-1253210 TGTCCTGGTCTGTGAACCTGGGG - Intergenic
1185587878 X:1253942-1253964 TGTCCTGGTCTGTGAACCTGGGG - Intergenic
1188083155 X:25870363-25870385 TGTATTTGTATGTGGAACTGAGG - Intergenic
1195485163 X:105396388-105396410 TCTCCTTGAGTCTGGACCTTGGG + Intronic
1197099604 X:122636910-122636932 GGGCCTGGAATGTGGACCTCAGG + Intergenic
1197300496 X:124774307-124774329 TGAACTTGAATGTGTATCTGAGG + Intronic
1198007158 X:132506856-132506878 TATTCTTGAATGTGCACCTCGGG - Intergenic
1199512408 X:148637307-148637329 TCTACTTTAATCTGGACCTGGGG - Intronic