ID: 933264575

View in Genome Browser
Species Human (GRCh38)
Location 2:80168508-80168530
Sequence GAAGGTGATCAGAAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1053
Summary {0: 1, 1: 0, 2: 6, 3: 86, 4: 960}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933264575 Original CRISPR GAAGGTGATCAGAAGGAGGA GGG (reversed) Intronic
900892348 1:5458547-5458569 GAAGGAGAAAAGAAGGAGAAAGG - Intergenic
901155223 1:7132270-7132292 GAAGGAGAAGGGAAGGAGGAAGG - Intronic
901760439 1:11467732-11467754 AAAGGTGAACAGATGCAGGAAGG + Intergenic
901911474 1:12462239-12462261 GAAGGTGATGGGGAGAAGGAGGG + Intronic
902050381 1:13559772-13559794 GCAGGTGATCAGAATGAGTCAGG - Intergenic
902052200 1:13572840-13572862 GCAGGTGATCAGAATGAGTCAGG - Intergenic
902139706 1:14342673-14342695 GAAGGTGAGGAGAAAGAGGTTGG + Intergenic
902684676 1:18068220-18068242 GAAGTTGAGAAGGAGGAGGAAGG + Intergenic
902684680 1:18068242-18068264 GAAGTTGAGAAGGAGGAGGAAGG + Intergenic
902905985 1:19557799-19557821 GAAGGGGAACAGAAGGGGAAGGG - Intergenic
903566994 1:24275047-24275069 GAAGGTGAGCCGAAGCAGGGTGG - Intergenic
903721498 1:25408881-25408903 GGAGATGGTGAGAAGGAGGAGGG + Intronic
904874324 1:33642488-33642510 GCAAGTGCTCAGAAGGAGGCAGG + Intronic
904887420 1:33751328-33751350 GAGGGTTTCCAGAAGGAGGAAGG + Intronic
904948233 1:34214819-34214841 GAGGGTGAGGAGAAGGAGCAGGG + Intronic
905237817 1:36562181-36562203 GAGGAAGAGCAGAAGGAGGAAGG - Intergenic
905310688 1:37046903-37046925 GTGGGGGGTCAGAAGGAGGAGGG + Intergenic
906192104 1:43905241-43905263 GAAGAGGAACAGGAGGAGGAGGG - Intronic
906192113 1:43905280-43905302 GAAGAGGAGCAGAAGGAGGCAGG - Intronic
906192134 1:43905352-43905374 GAAGAGGAACAGAAGGAGGAGGG - Intronic
906192145 1:43905391-43905413 GAAGAGGAGCAGAAGGGGGAGGG - Intronic
906192313 1:43906003-43906025 GAAGAGGAACAGAAGGAGGAGGG - Intronic
906192456 1:43906509-43906531 GAAGAGGAGCAGGAGGAGGAGGG - Intronic
906192485 1:43906638-43906660 GAAGAGGAGCAGGAGGAGGAGGG - Intronic
906212076 1:44017558-44017580 GATGGTGACCGGCAGGAGGATGG + Intronic
906579634 1:46925692-46925714 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
906604089 1:47153196-47153218 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
906746525 1:48225929-48225951 GAAGGTGGTGAGAAGGAGAAGGG - Intronic
906794968 1:48689480-48689502 GAAGAAGGACAGAAGGAGGAAGG - Intronic
907325745 1:53637770-53637792 GCAGGTGCTCACAAGGGGGATGG - Intronic
907567003 1:55444654-55444676 GCAGGAGATCAGAGGGAGGAGGG + Intergenic
907839820 1:58145932-58145954 GAGGCTGAGGAGAAGGAGGAGGG - Intronic
908584706 1:65555007-65555029 GAGGGTGAGCTGAAGCAGGATGG - Intronic
908592788 1:65651826-65651848 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
908807041 1:67942594-67942616 TAAAGTCATCAGAATGAGGATGG - Intergenic
908897662 1:68918680-68918702 GAAGGTGAAGAGGAGGAAGAGGG + Intergenic
909014374 1:70367220-70367242 GCAGGTGATCAGAATGAGTCAGG + Intronic
909483079 1:76146501-76146523 GAGGGAGAAAAGAAGGAGGAGGG - Intronic
910278635 1:85474416-85474438 GGATGAGATCAGAATGAGGATGG - Intronic
910511708 1:88014078-88014100 GAAAGAGATGAAAAGGAGGAAGG + Intergenic
910597252 1:88992979-88993001 GAAGGGGACAAGATGGAGGATGG + Intergenic
910827916 1:91428731-91428753 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
910855323 1:91689145-91689167 GAGGGTGAGAAGAAGGGGGAAGG - Intronic
911445387 1:97985638-97985660 AACGGTGAGCAGAAGGAAGATGG - Intergenic
911530626 1:99039398-99039420 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
911532322 1:99058889-99058911 GGAGGTGATGAAAAAGAGGAAGG + Intergenic
911586112 1:99692791-99692813 GAAGGTGAACAGAAGGCAGAAGG - Intronic
911864753 1:103003813-103003835 GAAGGTGAGCAGGTGCAGGAGGG - Intronic
912498413 1:110106191-110106213 GCTGGTGATCTGCAGGAGGAGGG + Intergenic
912516643 1:110220478-110220500 GAGGGTGAGCAGAGGGAGGGAGG - Intronic
912681936 1:111734310-111734332 AAAGGTGGTCAGAGGGAAGAGGG - Intronic
912894948 1:113576453-113576475 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
913102815 1:115584819-115584841 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
913148655 1:116017788-116017810 GAAGGGGACCAGGAAGAGGAAGG + Intronic
913223401 1:116677636-116677658 GACGGGCAGCAGAAGGAGGAAGG - Intergenic
913382149 1:118224170-118224192 CAAGGAGATAAGAATGAGGATGG + Intergenic
914338455 1:146738285-146738307 GAAGGAGAGCAGAATCAGGAAGG - Intergenic
915061443 1:153188947-153188969 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
915342998 1:155186380-155186402 GAAGGAGAGCAGAGGGAGGAGGG - Intronic
915556140 1:156661820-156661842 GAAGGAGATCAGAATGTGTATGG + Intergenic
915895250 1:159807007-159807029 GAAGGGGATCTGAGGAAGGAAGG - Intronic
916347310 1:163808162-163808184 GAATGAGATCACTAGGAGGAAGG + Intergenic
916631182 1:166614071-166614093 GGAGGTGGTCAGAAGGGGAATGG + Intergenic
916696004 1:167237074-167237096 GAAGCTGACAATAAGGAGGAAGG + Intronic
916731678 1:167572196-167572218 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
916881625 1:169024553-169024575 GAAGGAGAAGAGGAGGAGGAAGG + Intergenic
916881630 1:169024575-169024597 GAAGGAGAAGAGGAGGAGGAAGG + Intergenic
916881638 1:169024610-169024632 GAAGGAGAAGAGGAGGAGGAAGG + Intergenic
917124715 1:171676909-171676931 GAAGGTGATGGAAAGGGGGAAGG + Intergenic
917232906 1:172857142-172857164 GAAGGTGATAGGGAGAAGGAGGG + Intergenic
917628912 1:176874015-176874037 GGAGGTGATTAGCAGGTGGAGGG - Intronic
917882716 1:179354328-179354350 TAAGGGGATCAGAAGTAGGAAGG + Exonic
917926696 1:179795058-179795080 CAAGGTGGTAAGAAGGGGGATGG + Intronic
918163278 1:181920580-181920602 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
918593892 1:186270303-186270325 GAAGGAGAGAAGAAAGAGGAAGG + Intergenic
918656804 1:187037003-187037025 AAAGGTTATGAGAAGGGGGATGG + Intergenic
920578896 1:207086045-207086067 GAAGGGGAGCAGAGGGAGGCAGG + Intronic
920985508 1:210885255-210885277 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
921631261 1:217437077-217437099 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
921962153 1:221047279-221047301 GAGGGTGAACAGAAGTAGGGTGG + Intergenic
921991126 1:221369072-221369094 GAAGGTGAAGAGAAAGAGAATGG - Intergenic
922066129 1:222145642-222145664 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
922082161 1:222308040-222308062 GATGGTGAGGAGGAGGAGGAAGG - Intergenic
922694412 1:227721173-227721195 GCAGGTGATCAGAATGAGTCAGG + Intergenic
922715928 1:227872034-227872056 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
922969936 1:229727754-229727776 CCAGGTGACCAGACGGAGGAGGG + Intergenic
923005106 1:230043190-230043212 GAAAGAGATCAGAAGTGGGAGGG - Intergenic
923375390 1:233357073-233357095 GAAGTTGATTAGAAGAAGGCTGG - Intronic
923482329 1:234397200-234397222 GAAGGGGAAGAGGAGGAGGAGGG + Intronic
923853345 1:237820368-237820390 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
924823188 1:247513807-247513829 GAGGGTGAGCAGAAAGAGGGTGG - Intronic
924829092 1:247573484-247573506 GAGGGTGAACAGAAGCAGGGTGG - Intronic
924883390 1:248187685-248187707 GAGAGTGAGCAGAAGCAGGATGG + Intergenic
924946798 1:248851904-248851926 GAAGGGGCTCAGAGGGAAGATGG - Intronic
1063572064 10:7224594-7224616 GAACGTGAGCAAAAGGAGGCAGG - Intronic
1063701257 10:8387389-8387411 GAAGGTAATTAGAATGAGAAGGG + Intergenic
1065038729 10:21668291-21668313 AAAGGAGACCAGAAGGAGGTGGG - Intronic
1065076082 10:22080592-22080614 GAAGGTGAGCTGAAGCAGGGTGG - Intergenic
1065076874 10:22089421-22089443 GAAGGTGAGCTGAAGCAGGGTGG + Intergenic
1065102707 10:22346155-22346177 GAAGGTGATCAAAGGCAGGGTGG - Intronic
1065440832 10:25752035-25752057 AAAGGAGATGAGAAGAAGGAAGG + Intergenic
1065887579 10:30092304-30092326 GAAGGTGATAAGTGGCAGGAAGG + Intronic
1066615468 10:37289057-37289079 CAGGGTGAGCAGAAGCAGGATGG - Intronic
1066617208 10:37307620-37307642 GAAGGGGCTCAGAGGTAGGAGGG + Intronic
1066632430 10:37470093-37470115 GAAGGAAGTCAGAAGGAGGTTGG + Intergenic
1066654964 10:37688524-37688546 GAAGGAGAGGAGAAGGAGGTGGG + Intergenic
1066705259 10:38170897-38170919 GAGGGAGAAAAGAAGGAGGAAGG - Intergenic
1066993574 10:42540000-42540022 GAGGGTGAGCCGAAGCAGGATGG - Intergenic
1067224432 10:44366435-44366457 GAAGGTGGAGAGTAGGAGGAGGG - Intergenic
1067878458 10:50024413-50024435 GAAGGTGATAAGCAGGAGGTGGG - Intergenic
1067893264 10:50153515-50153537 GAAGGTGATAAGCAGGAGGTGGG + Intergenic
1068357188 10:55923806-55923828 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1068895719 10:62198201-62198223 GAAGTTTATCAGAAGGAGGAAGG + Exonic
1069120899 10:64567792-64567814 GAGGGTGAGCAGAAGTAGGGAGG - Intergenic
1069708694 10:70475470-70475492 TAAGGTGGTCACAAGGAGCAAGG + Intergenic
1069733490 10:70634829-70634851 GCAGGTGATCAGAATGAGTCAGG + Intergenic
1070049950 10:72878841-72878863 GAAGGAGAAGAGAAAGAGGATGG + Intronic
1070160038 10:73860928-73860950 CAAGGTGACCACAAGGAGAATGG - Intronic
1070213086 10:74347277-74347299 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1070349175 10:75575716-75575738 GAGGGTGAGCCGAAGCAGGAGGG + Intronic
1070543201 10:77432132-77432154 GAAGGTGCTCAGAAGGGGAAAGG - Intronic
1070652876 10:78250679-78250701 GAAGCTGGTCAGAAGAAGGCTGG - Intergenic
1071710081 10:88041468-88041490 GATGGTGGTGAGAGGGAGGAGGG + Intergenic
1072154887 10:92715199-92715221 GAAGGTGAGAAGAGGAAGGAAGG - Intergenic
1072493788 10:95934683-95934705 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1072617513 10:97059535-97059557 CAAGGTGAGCAGAAGGAGAGGGG + Intronic
1072638525 10:97193307-97193329 GAAGGGGATGCGATGGAGGAGGG - Intronic
1072876093 10:99174959-99174981 GAAGGCGAGCAGAAGCAGGGTGG + Intronic
1073184773 10:101609274-101609296 TAAGGGGATCAGAAGGAGAAGGG + Intronic
1073424740 10:103449624-103449646 GATGGAGCTTAGAAGGAGGAAGG + Exonic
1073547196 10:104360624-104360646 GAGGGTGAAGAGTAGGAGGAGGG - Intronic
1074015463 10:109529867-109529889 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1074189305 10:111122321-111122343 AAAGGAGATCAGAAGGTGGGAGG - Intergenic
1074268329 10:111927718-111927740 GAAGGACAACAGAAGGATGAAGG - Intergenic
1074541797 10:114371285-114371307 GAAGGTGATGGAAAGGAGAAAGG + Intronic
1074727111 10:116322895-116322917 GAACGTCATCACAAGGAGGCTGG - Intergenic
1075106401 10:119542699-119542721 GAAGGCGAGGAGGAGGAGGAGGG + Exonic
1075586138 10:123659509-123659531 GAAAGTGATCAGAGGGCGGGAGG + Intergenic
1075969107 10:126637884-126637906 GATGGAGATGAGAATGAGGAAGG + Intronic
1076091545 10:127690428-127690450 GAAGGTGGGAAGAAGGTGGAAGG + Intergenic
1076318956 10:129564419-129564441 GAAGGGGAAGAGAAGGAGCAAGG - Intronic
1076319028 10:129564677-129564699 GAAGGAGAGGAGGAGGAGGAAGG - Intronic
1076559182 10:131350011-131350033 GAAGGTGGTTAGAAGGAGGGTGG - Intergenic
1077392588 11:2306987-2307009 GAAGGTGAGGAGAAGAAAGAGGG + Intronic
1077413166 11:2412856-2412878 GTAGGTGAACAGGAAGAGGAAGG + Exonic
1078062884 11:8059862-8059884 CAAGGAGACCAGAAGGAGGCTGG + Intronic
1078510877 11:11983077-11983099 GAATGTGATCAAAATGAGGCTGG - Intronic
1078912836 11:15749364-15749386 GAAGGTGAGCTCAAGAAGGAAGG + Intergenic
1078962648 11:16296424-16296446 GCAGCTGAGCAGAAGGAAGATGG + Intronic
1079714815 11:23731737-23731759 GAAGGCGAGCAGAAGCAGGGTGG + Intergenic
1079867821 11:25758137-25758159 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1080265508 11:30396604-30396626 GAAGCTGATCAGATGTAGGAAGG - Intronic
1080305554 11:30831106-30831128 GAGGGAGCTGAGAAGGAGGAGGG + Intronic
1080478364 11:32619857-32619879 GAAGGGAAGGAGAAGGAGGAGGG + Intronic
1080709982 11:34737670-34737692 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1080875093 11:36267598-36267620 GAAGAGGATGAGGAGGAGGAGGG - Intergenic
1081019158 11:37921823-37921845 GAAGGTAAACAGAAAGAGGCAGG - Intergenic
1081118198 11:39231917-39231939 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1081995087 11:47359020-47359042 GAAGGAGATCAGAGTCAGGAAGG + Intronic
1082686228 11:56242256-56242278 GAAGATGAACAGAAGGAAAAAGG + Intergenic
1082737827 11:56875935-56875957 AAAGGTGATAATGAGGAGGAAGG + Intergenic
1082876400 11:57992971-57992993 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1083341507 11:61961399-61961421 GAAGGTGATCAAATGAAGGCTGG + Intronic
1083490133 11:63009707-63009729 TTAGGGGATCAGAAGGGGGAGGG + Intronic
1083510140 11:63201990-63202012 GAGGGTGAGCAGAAGCAGGTTGG + Intronic
1083836326 11:65270943-65270965 GAAAGAGGACAGAAGGAGGAGGG - Intronic
1085319697 11:75566357-75566379 GAAGGCGCTGAGAAGCAGGAGGG - Exonic
1085910723 11:80822280-80822302 GTTGGTGATCTGAAGGAGGACGG + Intergenic
1086041580 11:82485970-82485992 GTAGGTGACAAGGAGGAGGAAGG - Intergenic
1086421830 11:86644906-86644928 GAGGGTGAACAGAAGCAGGGTGG + Intronic
1086644951 11:89209110-89209132 GAAGGTGAACCAAAGCAGGATGG + Intronic
1086890249 11:92249254-92249276 AACGATGATCAGAAGGAGAATGG + Intergenic
1086932664 11:92709517-92709539 GAAGGTCACCCGTAGGAGGAAGG + Intronic
1087082078 11:94180587-94180609 GAAGGAGATCAGAGGTAGAAAGG - Intronic
1087364241 11:97198693-97198715 GAAGGTGAGCTGAAGTAGGGTGG - Intergenic
1087376845 11:97353358-97353380 GAATGAGATGAGTAGGAGGAGGG - Intergenic
1087925058 11:103910443-103910465 GAAGGTGAGCTGAAGCAGGGTGG + Intronic
1088078379 11:105879186-105879208 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1088087388 11:105997215-105997237 GAAGGGGAAGAGGAGGAGGAAGG + Intronic
1088182323 11:107126841-107126863 GCAGGAGATCAGAAGGGGGAAGG - Intergenic
1088228521 11:107648275-107648297 GAAGGTAATGACATGGAGGAGGG - Intronic
1088999619 11:115040804-115040826 GAAGGTGAGTGGAATGAGGATGG - Intergenic
1089191414 11:116656205-116656227 GATGGTGCTCAGAAGAAGGTGGG - Intergenic
1089310455 11:117555061-117555083 GAAGCAGCTCAGAAGGAAGAGGG - Intronic
1089624092 11:119740403-119740425 GAGGGAGATCAGAAAGAGAAAGG - Intergenic
1089678555 11:120106799-120106821 GAAGGTGATCAGAGCGTGCAGGG - Intergenic
1089702884 11:120255863-120255885 CAAGGTCACCAGAGGGAGGAAGG - Intronic
1090439679 11:126715066-126715088 GAACCTGATCATTAGGAGGATGG - Intronic
1090461962 11:126899056-126899078 AAAGGTTAACAGAAGGTGGAAGG + Intronic
1090799813 11:130163363-130163385 GCAGGGGATGAGAAGGAGAAAGG - Intronic
1090811620 11:130249640-130249662 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1090830183 11:130415905-130415927 GAAGGTTGTCTGAAGGAGGAGGG - Intronic
1090952262 11:131484050-131484072 AAAGGTAATGAGCAGGAGGAGGG + Intronic
1091381520 12:64985-65007 GAATGGGATGGGAAGGAGGAAGG - Intergenic
1091441165 12:512457-512479 GAAGGTGGGCGGAAGGTGGAAGG - Intronic
1091687291 12:2572547-2572569 GGAGGAGAGGAGAAGGAGGAGGG - Intronic
1091805122 12:3350429-3350451 GAAGCTGTTCAGAGGAAGGATGG + Intergenic
1091992005 12:4962963-4962985 GAAGGTGATGGGAGGGAGGGGGG + Intergenic
1092291364 12:7161260-7161282 GACGATGACAAGAAGGAGGAGGG - Intergenic
1092398876 12:8154208-8154230 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1092440320 12:8495749-8495771 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1092505093 12:9090516-9090538 GAAGGAGAACAGAGGGAGAATGG + Intronic
1092637479 12:10467195-10467217 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1092847345 12:12596037-12596059 GCAGGTGATCAGAATGAGTTAGG + Intergenic
1092847363 12:12596188-12596210 GCAGGTGATCAGAATGAGTTAGG + Intergenic
1092847367 12:12596216-12596238 GCAGGTGATCAGAATGAGTTAGG + Intergenic
1092847371 12:12596244-12596266 GTAGGTGATCAGAATGAGTTAGG + Intergenic
1092847375 12:12596272-12596294 GCAGGTGATCAGAATGAGTTAGG + Intergenic
1092847379 12:12596300-12596322 GTAGGTGATCAGAATGAGTTAGG + Intergenic
1092847382 12:12596328-12596350 GCAGGTGATCAGAATGAGTTAGG + Intergenic
1092847386 12:12596356-12596378 GCAGGTGATCAGAATGAGTTAGG + Intergenic
1092847390 12:12596384-12596406 GCAGGTGATCAGAATGAGTTAGG + Intergenic
1093356973 12:18178224-18178246 GCAGGTGATCAGAATGAGTCAGG - Intronic
1093950464 12:25160414-25160436 GTAGGTGATCAGAATGAGTCAGG - Intronic
1094351475 12:29530656-29530678 GCAGGTGCTTTGAAGGAGGAAGG - Intronic
1095547449 12:43388326-43388348 GAGGGTGAACAGAAGCAGGCAGG - Intronic
1095664020 12:44773568-44773590 GTAGGTGGTTAGAAAGAGGAAGG - Intronic
1095856835 12:46869550-46869572 GAAGGTGATGAGAAGAAAAACGG + Intergenic
1095920699 12:47526870-47526892 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1096085217 12:48861151-48861173 GAAGGGTAGGAGAAGGAGGAAGG + Intronic
1096242822 12:49968355-49968377 GAAGGGGAGGGGAAGGAGGAAGG - Intronic
1097182137 12:57177666-57177688 GAGGGTGATGAGAAGGACCAAGG + Intronic
1097226404 12:57479039-57479061 GAAGGTGATGGGAGGTAGGAAGG + Intronic
1097289066 12:57898668-57898690 GAAGGAGATGAAGAGGAGGAGGG - Intergenic
1097740598 12:63237746-63237768 GATGATGATGAGGAGGAGGAAGG + Intergenic
1098123989 12:67270352-67270374 GAAGGTGGGAAGAAGGGGGAGGG + Intronic
1098176584 12:67798416-67798438 GAAGGTGATGAAAAGGAGGAAGG - Intergenic
1099071449 12:78049504-78049526 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1099133207 12:78862784-78862806 GAAGGGGAGGAGAAGGAGGATGG - Intergenic
1099253801 12:80290186-80290208 GAGGGTGAGCAGAAGCAGGGCGG - Intronic
1099512687 12:83556526-83556548 GAGGGTGAGCTGAAGGAGGGTGG - Intergenic
1100877246 12:98975214-98975236 GAAGGAGATGGGAGGGAGGAAGG - Intronic
1101725888 12:107387920-107387942 GAAGGAGAGGAGTAGGAGGAGGG - Intronic
1101843208 12:108342294-108342316 GGAGGGGGTCAGAAGGAGGAAGG + Intergenic
1102345658 12:112159484-112159506 GAGGGTGATCTGAAGCAGGGTGG - Intergenic
1102446281 12:113005253-113005275 GATGGTGGACAGAAGGTGGAGGG + Intronic
1102537890 12:113594960-113594982 GAAGGTGGACAGTGGGAGGAGGG - Intergenic
1103111011 12:118278285-118278307 GAGGGTGGAAAGAAGGAGGAGGG - Intronic
1103169238 12:118799447-118799469 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1103273384 12:119691467-119691489 GCAGATGCTCAGAAGGTGGATGG + Intronic
1104026604 12:125032110-125032132 GAAGGAAACCAGAATGAGGAGGG + Intergenic
1104091454 12:125521215-125521237 GAAGAGGAAGAGAAGGAGGAAGG - Intronic
1104450797 12:128866914-128866936 GAAGGTGACCTGAAGGTGGCTGG - Intronic
1104545700 12:129711075-129711097 GAAGGTGCTGAGAAGGACGAGGG - Intronic
1104749940 12:131231916-131231938 GGAGGTGAGGAGGAGGAGGAGGG - Intergenic
1105733716 13:23246259-23246281 GAAGCAGATGCGAAGGAGGAGGG + Intronic
1105899476 13:24743085-24743107 GAAGATGCACAGCAGGAGGAGGG - Intergenic
1106192602 13:27466744-27466766 GAAGCTGATGAGAAGGAGGGTGG + Intergenic
1106226961 13:27793135-27793157 AGAGGTGATCCGAAGCAGGATGG + Intronic
1106429339 13:29665429-29665451 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1106818847 13:33440692-33440714 GAAGGTTATCAGAATATGGATGG - Intergenic
1106874309 13:34055080-34055102 GAGGGTGAGCAGAAGCAGAATGG - Intergenic
1107374675 13:39789520-39789542 GCAGGTGATCAGAATGAGTCAGG - Intronic
1107473538 13:40713148-40713170 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1108166037 13:47694075-47694097 GGAGGAGATGAGAAGGAGAAAGG - Intergenic
1108940488 13:55947500-55947522 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1109457570 13:62612017-62612039 GAGGGTGAGCAGAAGCAGGGAGG - Intergenic
1109759839 13:66813420-66813442 GAAGGAGATGAGAGGAAGGAGGG + Intronic
1109856533 13:68135934-68135956 GAAGGTGAAGTAAAGGAGGAAGG - Intergenic
1109909263 13:68889041-68889063 GCAGGTGATCAGAATGAGTCAGG + Intergenic
1110135438 13:72062263-72062285 GAAGGTGAGCCGAAGCAGGGTGG + Intergenic
1110290419 13:73799256-73799278 GAAGGTGATGAAAGGGAGGAGGG + Intronic
1110324307 13:74196321-74196343 GCAGGAGATCAGAAGGAGGAGGG + Intergenic
1110540853 13:76705286-76705308 GGAGGGGATGAGAAGGAGAAAGG + Intergenic
1110551089 13:76812285-76812307 GAAGGTTATCAGAAGAAGCAGGG + Intergenic
1110656648 13:78007886-78007908 AAGGGTGATCAGAAATAGGATGG - Intergenic
1110756418 13:79179842-79179864 GAAGGTGATTAGAATGAGTCAGG + Intergenic
1110824598 13:79957955-79957977 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1110968689 13:81733369-81733391 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1111052933 13:82908833-82908855 GATGATGATCATGAGGAGGAGGG - Intergenic
1111684690 13:91487538-91487560 GAAGGTGATCAGATCTTGGAAGG - Intronic
1111742094 13:92217370-92217392 GAAGGTGAGATGAAGGATGAAGG - Intronic
1113186262 13:107688943-107688965 GATGGTGATGAGAAGCAGGAGGG + Intronic
1113222699 13:108123238-108123260 GAGGGAGAGCAGATGGAGGAAGG + Intergenic
1113921140 13:113912564-113912586 GAAGGAGAGGAGAAAGAGGATGG - Intergenic
1114844817 14:26308758-26308780 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1114981252 14:28168139-28168161 GAAGGTGAGCTGAAGCAGGGCGG + Intergenic
1114987173 14:28244549-28244571 GAATGTTGTGAGAAGGAGGAGGG - Intergenic
1115357083 14:32460429-32460451 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1115718171 14:36128835-36128857 GCAGGAGATCAGAGGGTGGAAGG + Intergenic
1116165590 14:41330335-41330357 GAAGGTGAGCTGAAGCAGGACGG - Intergenic
1116272848 14:42794770-42794792 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1116565323 14:46438329-46438351 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117005724 14:51419151-51419173 GAGGGTGATCTGAAGCAGGGCGG - Intergenic
1117104184 14:52381982-52382004 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1117120976 14:52568149-52568171 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1117237893 14:53798052-53798074 GAAGGTGAACTGAAGCAGGGTGG + Intergenic
1117850145 14:59958904-59958926 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1118010387 14:61604734-61604756 GAAGGTGCTGAGAAGGTTGATGG - Intronic
1118343459 14:64915519-64915541 GAAGGTGAGGAGCTGGAGGATGG + Intronic
1118437063 14:65781346-65781368 GAAGGGGAGGAGGAGGAGGAAGG - Intergenic
1118459571 14:65976093-65976115 GAAGAGGAGGAGAAGGAGGAAGG + Intronic
1118624280 14:67643386-67643408 GAAGGTCTTCAGTAGGAAGAAGG + Intronic
1118862081 14:69672281-69672303 GAAGGTGAGAAGAGAGAGGAGGG + Intronic
1118873108 14:69759803-69759825 GAAGGTGGACATTAGGAGGATGG - Intronic
1119463832 14:74836522-74836544 GAAAGTGAAAAGAAGAAGGAAGG - Intronic
1120209272 14:81618903-81618925 GAAGGTGACCAGAAGGTGTCAGG - Intergenic
1120450125 14:84655878-84655900 GAAGGTGAGCCGAAGCAGGGTGG - Intergenic
1120741038 14:88109204-88109226 GGAGATGATCAGAAGGAAGGTGG - Intergenic
1120968719 14:90190245-90190267 GGAGGTGGTGAGAAGGAGAATGG + Intergenic
1121062992 14:90933766-90933788 GGAGGTGATCATATGGAAGAAGG - Intronic
1121422437 14:93824959-93824981 GCAGGTGCTCAGAAGGGGGTGGG + Intergenic
1121593974 14:95144983-95145005 GAAGGTGATTAGACGGTGTATGG - Intronic
1122647936 14:103207392-103207414 GAAGGGGAGGGGAAGGAGGAAGG - Intergenic
1122874198 14:104655872-104655894 GGGCGTGATCAGGAGGAGGATGG + Intergenic
1123477315 15:20598978-20599000 GAAGGTGAGGAGCAGCAGGAAGG - Intergenic
1123668400 15:22628659-22628681 GGAAATGATCAGAATGAGGAGGG - Intergenic
1124000901 15:25758885-25758907 GCAGGTGATCAGAATGAGTAAGG - Intronic
1124000905 15:25758913-25758935 GCAGGTGATCAGAATGAGTTAGG - Intronic
1124524379 15:30435120-30435142 GGAAATGATCAGAATGAGGAGGG - Intergenic
1124534286 15:30531103-30531125 GGAAATGATCAGAATGAGGAGGG + Intergenic
1124581729 15:30961729-30961751 GAAGGTGGTCAGGAAAAGGAAGG - Intronic
1124593247 15:31071554-31071576 GAAGGCCATCAGAAGGAGGGTGG - Intronic
1124702784 15:31931271-31931293 GAATGAGATCAAAGGGAGGAAGG + Intergenic
1124764362 15:32476508-32476530 GGAAATGATCAGAATGAGGAGGG - Intergenic
1124774272 15:32572590-32572612 GGAAATGATCAGAATGAGGAGGG + Intergenic
1124888401 15:33708994-33709016 GCAGGTGATCAGAATGAGTCAGG + Intronic
1124993852 15:34703495-34703517 GAAGAAGAAGAGAAGGAGGAGGG - Intergenic
1125524720 15:40367752-40367774 GACGCTGCTCAGCAGGAGGAGGG - Exonic
1125690558 15:41592884-41592906 GTAGGTGATCAGAATGAGTCAGG - Intergenic
1126577257 15:50209372-50209394 GAAGGGGAGCAGAATCAGGAAGG + Intronic
1126676329 15:51161916-51161938 GAAGTTTATCAGCAAGAGGAGGG - Intergenic
1126778506 15:52119300-52119322 GGAGGTGATGAGAGGGAGGGAGG + Exonic
1126957272 15:53947555-53947577 CAAGGTGATCAGAGGCATGATGG - Intergenic
1127525067 15:59784655-59784677 GAAGGTGATCCAAAGCAGGGAGG - Intergenic
1127646743 15:60966135-60966157 GAAGGTGATATGAAGAAAGAGGG - Intronic
1127846824 15:62877605-62877627 TAAGGTGATCAGAAGCAGGTGGG + Intergenic
1127857731 15:62966559-62966581 GAAGGTGCTCAGAGGCAGGCTGG - Intergenic
1127905321 15:63372082-63372104 GAAGATGACCGGAAGGAGGCAGG - Intronic
1128454546 15:67825348-67825370 GGGGGTGAGGAGAAGGAGGAGGG - Intronic
1128552028 15:68604150-68604172 GAACGTGATAAGAACGACGAGGG - Intronic
1128649436 15:69399899-69399921 GCAGGTGCTGAGAAGGAAGAGGG + Intronic
1128857595 15:71032273-71032295 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1128898574 15:71398356-71398378 GAGGGTGACCTGAAGAAGGAAGG + Intronic
1129493553 15:75954065-75954087 GAAGGAGATAAGAGAGAGGAGGG - Intronic
1129898779 15:79129666-79129688 GATGGTGATCATAAGGATTATGG - Intergenic
1130060026 15:80563048-80563070 GAAGGAAGTCAGCAGGAGGAAGG - Intronic
1130062481 15:80579853-80579875 GAAGGTGAACTGAAGGTGGGAGG + Intronic
1130075138 15:80682171-80682193 GAAGTGGATCACATGGAGGAAGG + Intronic
1131439899 15:92451849-92451871 GATGGTGATCAGGAGCAGGGAGG - Intronic
1131571540 15:93542152-93542174 GGAGGGGATGAGATGGAGGAAGG + Intergenic
1131671656 15:94626236-94626258 GAAGGTGATGAGAAGAAAAATGG + Intergenic
1132724971 16:1334471-1334493 GTCGGTGAGCAGAGGGAGGAGGG + Intronic
1133897621 16:9944465-9944487 GATGGTGAGGAGGAGGAGGATGG - Intronic
1134813482 16:17187000-17187022 GCAGGTGCTCAGGAGGAGGGTGG + Intronic
1134822609 16:17258908-17258930 GAAGGTGAGCAGAATGGGGCTGG + Intronic
1136155843 16:28381467-28381489 GAAGGTGATGTGAGTGAGGAAGG - Intronic
1136171890 16:28494825-28494847 TGAGGAGATCAGAAGGAGGAGGG - Intronic
1136207242 16:28733822-28733844 GAAGGTGATGTGAGTGAGGAAGG + Intronic
1136517612 16:30777413-30777435 GAAAGTGACCTGAAGGATGAGGG - Intergenic
1137556998 16:49477140-49477162 GAGGGTGAGCGGAAGGGGGAGGG + Intergenic
1137699466 16:50486423-50486445 GAAGAAGAACAGGAGGAGGAGGG - Intergenic
1137794387 16:51203031-51203053 GAAGGTGTTCTGAGGGAGGCAGG - Intergenic
1138151468 16:54661507-54661529 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1138389669 16:56661303-56661325 GATGGTGCGCAGAGGGAGGAAGG - Intronic
1138835410 16:60428870-60428892 GAAGGGAAAGAGAAGGAGGATGG + Intergenic
1138886830 16:61090613-61090635 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1139995823 16:70979069-70979091 GAAGGAGAGCAGAATCAGGAAGG + Intronic
1140438025 16:74964488-74964510 GGAGGTGGTCAGAGGTAGGAAGG + Intronic
1140438375 16:74967344-74967366 TAAGGAGATGATAAGGAGGAGGG + Intronic
1141297819 16:82786124-82786146 GCAGGTGATCAGAATGAGTCAGG + Intronic
1141891752 16:86930858-86930880 GAAGAGGAGGAGAAGGAGGAGGG - Intergenic
1141932224 16:87213521-87213543 GATGGTGAGGAGAAGAAGGATGG + Intronic
1142377375 16:89712815-89712837 GGAGGTGAGGAGAAAGAGGAGGG + Intronic
1142890035 17:2937292-2937314 GAAGGCATTCAGAAGGAGCAAGG - Intronic
1143780291 17:9225642-9225664 GAAGGTGACCAGTAGGGGGAGGG + Intronic
1144114065 17:12068543-12068565 GTAGATGATGACAAGGAGGAAGG + Intronic
1144707636 17:17380143-17380165 AGAGGTGATCAGGAGGAGGAAGG + Intergenic
1145879826 17:28344878-28344900 GAAGGTTCTCAGCAGGAGGTGGG - Exonic
1146291771 17:31612906-31612928 AAAGGAGAGGAGAAGGAGGAGGG - Intergenic
1146532857 17:33624848-33624870 GAAGGTGAACAGATGTATGATGG - Intronic
1146634595 17:34494677-34494699 CCAGGTGACCAGAAGGAGCAGGG + Intergenic
1146640752 17:34539537-34539559 GAAGCCGATCATAAGCAGGAGGG - Intergenic
1146789808 17:35744972-35744994 GTAGGTGAGGAGGAGGAGGAAGG - Exonic
1146821518 17:35986602-35986624 GATGGTGATGAGGAGGAAGAAGG + Exonic
1147007312 17:37413942-37413964 GAGGGTGAACAGTGGGAGGAGGG - Intronic
1147196238 17:38768683-38768705 GGAGGAGGTCAGAAGGAAGAAGG + Exonic
1147526333 17:41227165-41227187 GAACGTGATCAGCAGCAAGAAGG - Exonic
1147527364 17:41238517-41238539 GAACGTGATCAGCAGCAAGAAGG - Exonic
1147628264 17:41913911-41913933 GAAGCTGGTCAGAAGGGGGCAGG + Intronic
1148215766 17:45833340-45833362 GCAGGTGCTCATGAGGAGGAGGG + Intronic
1148980922 17:51574296-51574318 GCAGGTGGTGAGAAGGAGGAAGG + Intergenic
1149107088 17:52982606-52982628 AAAGGGGAGGAGAAGGAGGAGGG - Intergenic
1149192926 17:54085790-54085812 GAAGATGAGCTGAAGCAGGATGG + Intergenic
1149281358 17:55108703-55108725 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1149365373 17:55938837-55938859 GAGGGTGAGCAGAAGCAGGTTGG + Intergenic
1149712560 17:58756277-58756299 GAGGGTGAGGAGGAGGAGGAGGG + Exonic
1149868956 17:60166051-60166073 GGAGGTGACCGGGAGGAGGAAGG - Intronic
1150124985 17:62629574-62629596 GCAGCTGAGCAGGAGGAGGATGG + Intronic
1150580463 17:66469116-66469138 GAATGTGGACAGAAAGAGGAAGG - Intronic
1150827095 17:68486584-68486606 GAAGGAAAGCAGAAGAAGGAAGG - Intergenic
1151345799 17:73500499-73500521 GAAGGAGAACAGAAGGAAGATGG - Intronic
1151345812 17:73500562-73500584 GGAGGAGAACAGAGGGAGGATGG - Intronic
1151894438 17:76970436-76970458 GCAGGTGATCAGAATGAGTCAGG - Intergenic
1151902755 17:77027870-77027892 GAAGGTGCTGAGGAAGAGGAGGG + Intergenic
1152261570 17:79270054-79270076 GAGGGTGGCAAGAAGGAGGAAGG - Intronic
1152923088 17:83075466-83075488 GAAGGTCATCAGGTGGAGGCTGG + Intergenic
1153119114 18:1700113-1700135 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1153795893 18:8621762-8621784 GAGGGTGATGGGTAGGAGGAAGG - Intronic
1153978972 18:10293380-10293402 GAAAGTGATAAGAAAGGGGAAGG + Intergenic
1155053927 18:22169390-22169412 GGAGGTGAAGAGGAGGAGGAGGG - Intergenic
1156525584 18:37764785-37764807 GAACTGGAGCAGAAGGAGGAGGG - Intergenic
1156746836 18:40402630-40402652 GAAAAAGAACAGAAGGAGGAGGG + Intergenic
1156969268 18:43135089-43135111 GGGTGTGATTAGAAGGAGGAGGG + Intergenic
1157068030 18:44374709-44374731 GAAAGTGAGCAGAAGCAGGGTGG + Intergenic
1157750675 18:50175264-50175286 GAAGGAGATTAGAAAGAGGAAGG - Intronic
1157758433 18:50240211-50240233 GCAGGTGATCAGAATGAGTCAGG - Intronic
1157758439 18:50240239-50240261 GTAGGTGATCAGAATGAGTCAGG - Intronic
1158388126 18:57018151-57018173 GATGCTAATCTGAAGGAGGAAGG + Intronic
1159002793 18:62988371-62988393 GGGGGTGTCCAGAAGGAGGACGG - Intergenic
1159325969 18:66918312-66918334 GAAGGTGAAGAAAGGGAGGAAGG - Intergenic
1159676165 18:71286606-71286628 GAAGGTTATAAGAGGGAGAAAGG + Intergenic
1159817292 18:73091077-73091099 GAAGGAGATGAGAAAGAAGATGG - Intergenic
1160063548 18:75553298-75553320 GCAGGTCTTCAGAAGGAGAAAGG + Intergenic
1160311059 18:77790630-77790652 GTAGGTGCTCAGAGGGAGAAAGG + Intergenic
1160761105 19:784928-784950 GAAGATGACCAGGAGGAGGAAGG + Intergenic
1160770483 19:828706-828728 GAAGGGGCTCAGATGGAGGAGGG + Intronic
1160770571 19:829006-829028 GAAGGGGCTCAGATGGAGGAGGG + Intronic
1160770668 19:829303-829325 GAAGGGACTCAGATGGAGGAGGG + Intronic
1160972518 19:1775859-1775881 GCAGGGGATCTGACGGAGGAGGG - Exonic
1162053089 19:8046797-8046819 GAGGGGGAGGAGAAGGAGGAGGG - Intronic
1162053108 19:8046845-8046867 GATGGGGAGGAGAAGGAGGAGGG - Intronic
1163050289 19:14678061-14678083 GCAGGTGATCAGAATGAGTCAGG + Intronic
1163779599 19:19239524-19239546 GAAGATGAGTGGAAGGAGGAAGG - Intronic
1163779634 19:19239638-19239660 GAAGATGAGTGGAAGGAGGAGGG - Intronic
1164250034 19:23468170-23468192 GAAGGAGAGGAGGAGGAGGAAGG - Intergenic
1164310256 19:24039749-24039771 TAATGTGATCAGAATGAAGAAGG + Intronic
1164324721 19:24181203-24181225 GGAGGAGAGGAGAAGGAGGATGG + Intergenic
1164463232 19:28465880-28465902 GAAGGAGAGAAGAAGGAAGAAGG + Intergenic
1165032931 19:33011483-33011505 GAAGGTGATCCGAGGGGAGATGG - Intronic
1165069753 19:33248494-33248516 GAAGAGGAGCAGGAGGAGGAAGG + Intergenic
1165077314 19:33287065-33287087 GCAGGAAATCAGACGGAGGAAGG - Intergenic
1165254669 19:34568511-34568533 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1165269814 19:34696520-34696542 GAAGGTGAGCAGAAGCAGGGTGG + Intergenic
1165781093 19:38434686-38434708 GGAGGGGATGAGAGGGAGGAGGG + Intronic
1166679748 19:44759201-44759223 GCCGGGGGTCAGAAGGAGGAGGG - Intronic
1167510544 19:49893394-49893416 GGAGGAGGTCAGGAGGAGGATGG + Intronic
1167555409 19:50192022-50192044 GATGCTGATCAGAAAGAAGAAGG - Intronic
1167645505 19:50703183-50703205 GAAGCTGAACAGGAAGAGGATGG - Intronic
1168164520 19:54537569-54537591 GAAGGTGATAAGGAGAAGCATGG - Intronic
1168490905 19:56808162-56808184 GATGGTGATCAGAAGGAATGGGG + Intronic
1168510190 19:56967471-56967493 GAGGAAGATCAGTAGGAGGAAGG - Intergenic
924989029 2:295429-295451 GAGGGTGGGCAGAAGGAGGCAGG - Intergenic
925142295 2:1558659-1558681 GGAGAAGATCAGAAGGAGGCAGG - Intergenic
925142301 2:1558687-1558709 GGAGAAGATCAGAAGGAGGCAGG - Intergenic
925142307 2:1558715-1558737 TAAGAAGATCAGAAGGAGGCAGG - Intergenic
925169757 2:1743680-1743702 GAAGGGGAGGAGGAGGAGGAAGG + Intronic
925169764 2:1743698-1743720 GAAGGGGAGGAGGAGGAGGAAGG + Intronic
925659221 2:6184474-6184496 GAAGGGGAAGAAAAGGAGGAAGG + Intergenic
925902084 2:8515934-8515956 GAAGGGGAGGAGGAGGAGGAGGG - Intergenic
926269255 2:11352823-11352845 ACAGGTGGTCAGAAAGAGGATGG + Intergenic
926877538 2:17498886-17498908 GAAGGTGAAGAGTGGGAGGAAGG - Intergenic
926920722 2:17937361-17937383 GGAGGGGATAAGAAGGAGGCAGG - Intronic
927182715 2:20458450-20458472 GAGGGTGAGCAGAAGCAAGATGG + Intergenic
927575567 2:24199346-24199368 GCAGGTGATCAGAATGAGTCAGG + Intronic
927975453 2:27335139-27335161 GAAGATGAGCAAAAGGAGGGAGG - Intronic
928107243 2:28478470-28478492 GAAGTTGTTGAGAAGGAAGAGGG + Intronic
928286006 2:29990532-29990554 GAGGGAGATGAGAGGGAGGAAGG + Intergenic
928378573 2:30799132-30799154 GAAGGGGGTAAGAAGAAGGAAGG + Intronic
929333625 2:40713249-40713271 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
930109062 2:47662775-47662797 GAAGATGCTCAGAAGAAGGTGGG + Intergenic
930951248 2:57146391-57146413 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
931238552 2:60432634-60432656 GAACGTGAACTGAAGGAGCAAGG + Intergenic
931423754 2:62152109-62152131 GGAGGTGAGCAGAGGGAAGATGG - Intergenic
931425787 2:62169820-62169842 GCAGGTGATCAGAATGAGTTAGG - Intergenic
932323536 2:70839072-70839094 GAAGGAGAAGAGAGGGAGGAGGG + Intergenic
933116992 2:78486440-78486462 GAAAGTGATCAGAATGAAGCAGG + Intergenic
933156624 2:78982585-78982607 AAAGGAGAGCAGAAGGAGGCTGG - Intergenic
933264575 2:80168508-80168530 GAAGGTGATCAGAAGGAGGAGGG - Intronic
933283750 2:80361449-80361471 GAAGGTAATCCTAAGGAGTATGG + Intronic
933488368 2:82950819-82950841 GAGGGTGAGCAGAAGGAGGGTGG - Intergenic
933691971 2:85185790-85185812 GAAGGTGGTCAGAACTGGGAGGG + Intronic
933738398 2:85513607-85513629 TTAGGGGATCAGAAGGAGGGAGG + Intergenic
933810943 2:86032351-86032373 GAGGGTGATGAGGAAGAGGAGGG - Exonic
934036025 2:88088955-88088977 GAAGGTGAGCAGGCTGAGGACGG + Intronic
934511240 2:94946337-94946359 GATGGTGAGCAGCAGGAGTAGGG - Intergenic
934520575 2:95017842-95017864 TGATGTGATCAGAGGGAGGATGG + Intergenic
935234463 2:101126924-101126946 GAAGGAGATGAGAAGGTGGAAGG - Intronic
936081111 2:109432905-109432927 GAATGGGATCAGGAGGAGCAGGG + Intronic
936181897 2:110274356-110274378 GAGGGTGATTAGAAGCAGGGTGG - Intergenic
936230671 2:110697323-110697345 GAGGGTGATTAGAAGCAGGGTGG + Intergenic
936577341 2:113667772-113667794 GAAGGTGAGCAGAGAGAGGGTGG + Intergenic
936658220 2:114513002-114513024 GAAGGAGAAGAAAAGGAGGAAGG + Intronic
936684493 2:114811714-114811736 GAAGGTGAGCAGGAGGAAGCTGG - Intronic
936832824 2:116669801-116669823 GAAGAGGAGGAGAAGGAGGAAGG - Intergenic
936900037 2:117472340-117472362 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
937058930 2:118967208-118967230 GAAGGTGTCCTGAAGCAGGACGG + Intronic
937778544 2:125810430-125810452 GAAGGTGAGCAGAATGATAAGGG + Intergenic
937789502 2:125943433-125943455 GGAGGTGCTGAGAAGGAGGGAGG + Intergenic
938144658 2:128823534-128823556 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
938224357 2:129602877-129602899 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
938468895 2:131542543-131542565 GAGGGTGATGAGAGGGAGCAGGG - Intergenic
938552307 2:132393555-132393577 GAAGGTGATCAGGAGCAGAGGGG - Intergenic
938773620 2:134522020-134522042 GAAGGAGATGAGAAACAGGATGG - Intronic
938915370 2:135933446-135933468 GAATGTCATCCGAAGGATGAGGG + Intronic
938952441 2:136267350-136267372 GAAGGTACTCAGAAGGAAAAAGG - Intergenic
939033458 2:137103161-137103183 GAAGCTGATCAGACGGAGAGTGG + Intronic
939180306 2:138795794-138795816 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
939817589 2:146915421-146915443 GCAAGGCATCAGAAGGAGGAAGG + Intergenic
939820063 2:146946643-146946665 GAGGGTGGAGAGAAGGAGGAGGG + Intergenic
940707393 2:157122678-157122700 CAAGGAGATCAGGACGAGGAAGG - Intergenic
940995800 2:160148620-160148642 GAGGGTGAGCAGAAGCAGGGCGG + Intronic
941306501 2:163875486-163875508 GAGGGAGATCATAAGGAAGATGG - Intergenic
941673438 2:168319306-168319328 GCAGCTGAGTAGAAGGAGGATGG + Intergenic
941682420 2:168413339-168413361 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
941876068 2:170434625-170434647 GCAGGTGATCAGAATGAGTCAGG + Intronic
941918545 2:170828051-170828073 GGAGGACAGCAGAAGGAGGAGGG - Intronic
941918554 2:170828089-170828111 GGAGGACAGCAGAAGGAGGAGGG - Intronic
942431380 2:175914596-175914618 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
943512237 2:188840464-188840486 GAGGGTGAGCTGAAGTAGGATGG + Intergenic
944267820 2:197748093-197748115 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
945210968 2:207381467-207381489 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
945720459 2:213412085-213412107 GTAGGTGATCAGAATGAGTCAGG - Intronic
945957260 2:216098034-216098056 GTAGGAGATAAGAGGGAGGATGG + Intronic
946133299 2:217624442-217624464 GCAGGAGATCAGATGGAGGATGG - Intronic
946422668 2:219573513-219573535 GAGGGGGAAGAGAAGGAGGAGGG - Intronic
946427880 2:219609036-219609058 GGCGGTGATCAGAGGGATGAGGG - Intronic
946553100 2:220823886-220823908 GAAGGGGAGGAAAAGGAGGAAGG - Intergenic
946912904 2:224484978-224485000 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
947159077 2:227193842-227193864 GAAGGAGAGGAGAAGGAGAAGGG + Intronic
947159094 2:227193909-227193931 GAAGGAGAGGAGAAGGAGAAGGG + Intronic
947159124 2:227194047-227194069 GAAGGAGAGGAGAAGGAGAAGGG + Intronic
947171499 2:227317250-227317272 GAAGATGGTCAGAAGCAGGGTGG + Intergenic
947330829 2:229027676-229027698 CAAGGTGCTAAAAAGGAGGAGGG + Intronic
947364595 2:229381118-229381140 GAGGGCGAGCAGAAGCAGGATGG + Intronic
947498001 2:230652822-230652844 GCAGGTGATCAGAATGAGTCAGG - Intergenic
947812983 2:233015823-233015845 GAGAGTGAGCAGAAGGATGAGGG - Exonic
947901107 2:233723002-233723024 GAAGAGGATGAGAAGGTGGAAGG + Intronic
948027604 2:234790360-234790382 GAAGGTGAGGAGAGGGAGGAAGG + Intergenic
948223200 2:236289651-236289673 GTTGGTGGTGAGAAGGAGGAGGG + Intergenic
948280680 2:236745579-236745601 TAAGGAGATCTGAAAGAGGAGGG + Intergenic
948556304 2:238813760-238813782 GGAGGAGAACAGCAGGAGGAAGG - Intergenic
1169260497 20:4134829-4134851 GAGGGAGAACTGAAGGAGGAGGG + Intronic
1169421410 20:5463663-5463685 GAAGGCGAGCAGAAGCAGGGTGG - Intergenic
1169524027 20:6403402-6403424 GTATGTGAACAGAGGGAGGAAGG + Intergenic
1169931890 20:10842585-10842607 GCAGGAGATCAAAAGGAGAAAGG - Intergenic
1169984189 20:11423418-11423440 GAGGGTAAGCAGAAGCAGGATGG - Intergenic
1170602448 20:17851191-17851213 GAAGAGGATGAGAAGGTGGAAGG + Intergenic
1170624619 20:18021773-18021795 GAAGGAGAGAAGAAGGTGGAAGG + Intronic
1171236448 20:23529288-23529310 GAAGGTAATCAGAATGAGTCAGG + Intergenic
1172292116 20:33784074-33784096 GAAGGAGATGGGGAGGAGGAGGG - Intronic
1172292207 20:33784327-33784349 GAGGGAGATGGGAAGGAGGAGGG - Intronic
1172702304 20:36861218-36861240 GAAGGTGAGGAGGAGGAGGGAGG - Intronic
1173134202 20:40424905-40424927 GAAGAGGAGGAGAAGGAGGAGGG + Intergenic
1174256226 20:49257634-49257656 GAAGGGGATGAGGAGGAAGAAGG - Exonic
1174533320 20:51231764-51231786 GAAGGTGCTCAGAGGATGGAAGG + Intergenic
1174776083 20:53344200-53344222 GATGATGATGAGGAGGAGGAGGG - Intronic
1175311334 20:58013674-58013696 GGAGCTGAGCTGAAGGAGGAAGG + Intergenic
1175366425 20:58459511-58459533 GATAGGGATCAGGAGGAGGAAGG + Exonic
1177092064 21:16781678-16781700 GAAGGTGAGCTGAAGCAGGATGG + Intergenic
1177136296 21:17308446-17308468 GAGGGTGAGCCGAAGGAGGGTGG + Intergenic
1178547285 21:33503003-33503025 GACACTGATCAGAAGGAGGCTGG + Intergenic
1178748297 21:35274969-35274991 GAGGGAGAGCAGAAGGAGGTGGG - Intronic
1178864534 21:36316971-36316993 GAGGGTGAACAGAAGCAGGGTGG - Intergenic
1179116684 21:38499741-38499763 GAAGGAGAGGAGGAGGAGGAGGG + Intronic
1180158951 21:45990537-45990559 GAAGGTGACCAGGGGAAGGACGG + Intronic
1180540968 22:16447367-16447389 GAGGGTGAGCTGAAGCAGGATGG + Intergenic
1180990048 22:19930295-19930317 GAAGGGGATGAGAGGGAGGTGGG - Intronic
1181054120 22:20251997-20252019 GATGGTGATGAGGATGAGGATGG - Intronic
1181532662 22:23525774-23525796 GAAGATGATGAGAAGACGGAGGG - Intergenic
1182329834 22:29543373-29543395 GAAGGGGATGGGGAGGAGGAAGG + Intronic
1182432862 22:30310870-30310892 GAGGGTGATAAGAAGAGGGAAGG - Intronic
1182931456 22:34178253-34178275 GAGGGGGATAAGGAGGAGGAAGG - Intergenic
1182980966 22:34670643-34670665 GCAGGACATCAGAAGGAGGAAGG - Intergenic
1183385411 22:37511390-37511412 GAAGGGGGTGAGGAGGAGGAGGG + Intronic
1184514969 22:44956245-44956267 GAAGCTGAGCAGGAAGAGGAAGG + Intronic
1184693599 22:46128245-46128267 GCATGTGCTCAGGAGGAGGATGG - Intergenic
1184883819 22:47329815-47329837 GAAGAGGAGCAGAAGGAGGAAGG + Intergenic
1185003451 22:48261284-48261306 GATGGTGATGAGGAGGAGGATGG - Intergenic
1185270507 22:49927521-49927543 GTAGGTAATCAGGAGGAGAACGG + Exonic
1185290143 22:50020349-50020371 GCACGTCATCAGATGGAGGAGGG - Intronic
949456671 3:4246232-4246254 GAGGGTGAGCAGAAGCAGGGCGG - Intronic
949632613 3:5944545-5944567 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
949787353 3:7756835-7756857 GCAGGTGATCAGAATGAGTCAGG - Intergenic
949939036 3:9139813-9139835 TAAGATGACCAGAAGAAGGAAGG + Intronic
950225756 3:11233194-11233216 GAAGGAGATGAGAAAGAGGGTGG - Intronic
950369977 3:12520929-12520951 GAGGGTGAAGAGAGGGAGGAGGG - Intronic
950991945 3:17449082-17449104 GAGGGTGAGCAGAAGCAGCATGG + Intronic
951646746 3:24900247-24900269 GAAGGTGGTCAGAAGTCTGAAGG + Intergenic
951741600 3:25931326-25931348 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
951826584 3:26875657-26875679 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
951832085 3:26942470-26942492 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
951912889 3:27769754-27769776 GATGGTGATCAGAGACAGGAAGG - Intergenic
952089251 3:29864860-29864882 GAAGGGGAAGAGAAGGAGGGAGG + Intronic
953555867 3:43946353-43946375 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
953695154 3:45152496-45152518 TAAGGTGACCAGAAGGAGCAAGG - Intergenic
954614192 3:51961141-51961163 GAAGGTGAGCGGGAGGTGGAGGG - Exonic
955410643 3:58653410-58653432 AAAGGTGACCCGAAGAAGGAAGG - Intronic
955807991 3:62756903-62756925 GGAGGTATTCAGGAGGAGGAGGG + Intronic
956264207 3:67379299-67379321 GAAGGTGCTCAAAAGAAGAAAGG - Intronic
956605245 3:71067030-71067052 GGAGGAGATCACTAGGAGGAGGG + Intronic
957037828 3:75311427-75311449 GCAGGAGATCAGAAGAAGCAAGG - Intergenic
957038350 3:75315768-75315790 GAAGGTGATCAGTAAGGGGAGGG + Intergenic
957695650 3:83635644-83635666 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
957888310 3:86320313-86320335 GAGGGTGAAGGGAAGGAGGAGGG - Intergenic
957943172 3:87030897-87030919 GAAGGTCTTCAGGATGAGGATGG + Intergenic
959146532 3:102552494-102552516 AAAGCTGATCAGAAAGAGTAAGG + Intergenic
959233207 3:103684319-103684341 TAATGTGATGAGAAGGAGAAAGG + Intergenic
959453689 3:106533909-106533931 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
959534526 3:107470203-107470225 GAGGGTGAGCAGAAGAAGGGTGG + Intergenic
959881287 3:111447411-111447433 GAAGGGGAGCAGAAGCAGGGTGG - Intronic
959941730 3:112087409-112087431 GGAGTTAATCAGAAGGTGGATGG - Intronic
960365167 3:116762239-116762261 GAACATTATGAGAAGGAGGAAGG + Intronic
960584452 3:119308109-119308131 CAAGGTGATCAGAAGAGTGAAGG + Intronic
960763401 3:121097609-121097631 GAGGGTGATCTGAAGCAGGGTGG - Intronic
960773236 3:121217477-121217499 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
960948642 3:122984126-122984148 GAAGGAGAAGAGAAGAAGGAAGG - Intronic
961086375 3:124071082-124071104 GAAGGTGATCAGGAAGGGGAGGG + Intergenic
961340113 3:126212246-126212268 GAAGGAGAGAAGAAGGAGGGAGG + Intergenic
961632456 3:128311349-128311371 AAAGGTGGTCAGAAGAAGCATGG + Intronic
961949274 3:130731046-130731068 GTAGGTCATCAGAAAGAGAAAGG - Intronic
961977431 3:131041947-131041969 GAGGGCGAGCAGAAGGAGGGTGG + Intronic
962048724 3:131789977-131789999 GGAGGTGGTTAGAAGGAGAATGG - Intronic
962156763 3:132956549-132956571 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
962270757 3:133976407-133976429 GAAGGGGATCTCAGGGAGGAGGG + Intronic
962399739 3:135048139-135048161 GGAGGTGCTGGGAAGGAGGAGGG + Intronic
962916943 3:139912756-139912778 GAAGGTGATAAGCAGCAAGACGG - Intergenic
962957357 3:140278489-140278511 AAAGGAGGCCAGAAGGAGGAGGG - Intronic
963226557 3:142868512-142868534 GCAGGTGATCAGAATGAGTCAGG - Intronic
963226561 3:142868540-142868562 GCAGGTGATCAGAATGAGTCAGG - Intronic
963765389 3:149329645-149329667 GAAGAGGATGAGAAGGAGAATGG + Intronic
963805895 3:149722619-149722641 GAAGGTGAACAGAGAGAGAAAGG - Intronic
963994590 3:151693203-151693225 AATGGTAACCAGAAGGAGGAAGG - Intergenic
964391325 3:156201110-156201132 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
964434308 3:156635924-156635946 AAAGGGGATCTGAAGAAGGAAGG - Intergenic
965172173 3:165279878-165279900 GAAGGAGAAAAGAAGGAAGAAGG - Intergenic
965221359 3:165931244-165931266 GAGGGTGAGCCGAAGGAGGGTGG + Intergenic
965511024 3:169568065-169568087 GAGGGTGAGCAGAAGCAGGATGG + Intronic
966148868 3:176844099-176844121 GAAGAGGATGAGGAGGAGGAGGG + Intergenic
966924946 3:184638610-184638632 GAAGGTGAGCAGAGAGAGGTTGG + Intronic
967442983 3:189530573-189530595 GAAGGAGAAAAGAAGGAAGAAGG - Intergenic
967864927 3:194182255-194182277 GAAGAAGAGCAGAAGTAGGAGGG - Intergenic
967995425 3:195162679-195162701 GAAGGTGCTAAGGATGAGGAAGG - Intronic
968581450 4:1397193-1397215 GGAGGTGAGCACAGGGAGGAAGG - Intergenic
968663700 4:1809655-1809677 GGAGGAGAGCAGAGGGAGGACGG - Intergenic
968952052 4:3700328-3700350 GAAGGGGAGAGGAAGGAGGAGGG + Intergenic
968971187 4:3796073-3796095 AAAGGTGGGCAGAAGGAGAAGGG - Intergenic
970214605 4:13745665-13745687 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
970776748 4:19683565-19683587 GAAGGTGATGAGATGCAAGATGG - Intergenic
971769845 4:30882158-30882180 GAAGGGGAAGAGAGGGAGGAAGG - Intronic
972032386 4:34477789-34477811 GAAGGGGAGGAGGAGGAGGAGGG - Intergenic
972131268 4:35836912-35836934 GAAGCTGAGCAGGAGGAGGAGGG - Intergenic
972186911 4:36540590-36540612 GAAAATGATCAGAAAGAGAATGG - Intergenic
972260945 4:37407878-37407900 GAGGGCGAGCAGAAGCAGGATGG + Intronic
972274676 4:37546038-37546060 ATAGATGATGAGAAGGAGGATGG + Intronic
972744898 4:41923271-41923293 GTAGGAGATCAGAGGGAGGTAGG + Intergenic
973006751 4:45017390-45017412 GCAGGTGATCAGAATGAGTTAGG - Intergenic
973184977 4:47315885-47315907 GAAGGTGGAGGGAAGGAGGAAGG + Intronic
973594396 4:52471546-52471568 GAAGGTGAAACGAAGGATGAAGG - Intergenic
973837410 4:54824541-54824563 GAAGGTGAGCAGAAGCAGGGTGG + Intergenic
973871381 4:55170081-55170103 GAAGGTGAGCTGAAGCAGGGTGG - Intergenic
974112201 4:57538051-57538073 GAGGAGGATCAGGAGGAGGAGGG - Intergenic
974506556 4:62781569-62781591 AAATGTGATCAGAAGTATGAGGG + Intergenic
975109502 4:70607960-70607982 GAAGGTGAAGAGAAGGGGGTAGG - Intergenic
975137926 4:70892598-70892620 GGAGGTTGCCAGAAGGAGGAAGG + Intergenic
975466418 4:74714252-74714274 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
975524168 4:75331146-75331168 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
975638700 4:76477821-76477843 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
975711413 4:77163650-77163672 GAAGGCATTCCGAAGGAGGAGGG + Intronic
976640689 4:87334553-87334575 GAAGGGGAGGAGGAGGAGGAGGG - Intergenic
976819977 4:89195220-89195242 GAAGGAGATGAGAAGAAAGAGGG - Intergenic
977006802 4:91577310-91577332 GAAAGTGCTCAGAAGAAGAAGGG + Intronic
977425460 4:96862689-96862711 AAAGGTGAGCAGAAGCAGGGTGG + Intergenic
977511854 4:97972000-97972022 GAAGGTGATCAGAAAGGTGAAGG - Intronic
977752385 4:100624871-100624893 GCAGATGATCAGATGCAGGAGGG + Intronic
979012248 4:115387092-115387114 GAGGGTGAGCAGAAGTAGGGTGG + Intergenic
979115199 4:116814962-116814984 GAGGGTGATCCGAAGCAGGGTGG + Intergenic
979301114 4:119088463-119088485 GAGGGTGATGGGAGGGAGGAGGG - Intergenic
981115238 4:140982376-140982398 GAAGGTTTTCAAGAGGAGGAAGG - Intronic
981476939 4:145196691-145196713 GCAGGTGATCAGAATGAGTTAGG + Intergenic
982815468 4:159878220-159878242 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
982825655 4:160001498-160001520 GAGGGTGAGCAGAAGTAGGGTGG + Intergenic
982915498 4:161203793-161203815 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
983485985 4:168331645-168331667 GAAGGCGAGCAGAAGCAGGGTGG - Intergenic
983518018 4:168677679-168677701 GAAGGCGATCAGAAGGTCGGGGG - Intronic
983840777 4:172455059-172455081 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
984232984 4:177121730-177121752 GATGGTGATAGGAAGGAAGAAGG + Intergenic
984565413 4:181324190-181324212 GAAGGTCAACACAAGGTGGAGGG - Intergenic
985167668 4:187114752-187114774 GAAGGTGAACAAAAGGAGTGGGG - Intergenic
985214615 4:187637641-187637663 GAGGGTGAAGAGAGGGAGGAGGG - Intergenic
985652281 5:1112560-1112582 GAGGGGGCGCAGAAGGAGGAGGG - Intergenic
985674049 5:1221228-1221250 GAAGATGATCAGCATGAGCAGGG - Exonic
987213056 5:15704112-15704134 GAGAGTGCTGAGAAGGAGGAGGG + Intronic
987722774 5:21659743-21659765 GAAGGTGGAGAGTAGGAGGAGGG + Intergenic
988502127 5:31792269-31792291 CAAGGTCATCAGAAGCAGGCAGG + Intronic
988618130 5:32794853-32794875 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
988719121 5:33858855-33858877 GAAGGCAAGCAGAAGCAGGATGG + Intronic
988737587 5:34038267-34038289 TAAGGTGAGCACAGGGAGGATGG + Intronic
989358114 5:40567359-40567381 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
989401733 5:41014955-41014977 GTAGGTGCTCAGGAGAAGGAAGG + Intronic
989451878 5:41596466-41596488 GAGGGTGAGCTGAAGCAGGATGG + Intergenic
989687710 5:44108848-44108870 GAAGGTGACCAGAAGCAGGGTGG - Intergenic
990278372 5:54224140-54224162 GAAGGCAATCACAAGGAGGCCGG + Intronic
991214322 5:64144759-64144781 GCTGGTGATCAGAGGGTGGAAGG - Intergenic
991387468 5:66106098-66106120 GAAGGTGAGCCGAAGCAGGGTGG + Intergenic
991528120 5:67585955-67585977 CCAGGTGTTCAGAAGGAGGAAGG + Intergenic
991555025 5:67886209-67886231 GAAAGTGATCAGAAGAATCATGG + Intergenic
992077767 5:73206913-73206935 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
992287207 5:75247990-75248012 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
992349674 5:75916275-75916297 GAAGGGGAGGAGGAGGAGGAAGG - Intergenic
992650879 5:78858786-78858808 GAAGATGATAACAAGGATGATGG - Intronic
992740702 5:79770583-79770605 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
992950261 5:81851310-81851332 GAGGTGGATCAGAGGGAGGAAGG + Intergenic
993055615 5:82976000-82976022 GAAGGTGATCATAATGAGTCAGG + Intergenic
993055636 5:82976111-82976133 GCAGGTGATCAGAATGAGTCAGG + Intergenic
993364631 5:87020395-87020417 GAAGGAGACCAGAATGAGTATGG - Intergenic
993573969 5:89578553-89578575 ACAGGTGATCAGAAGAAAGATGG + Intergenic
993622406 5:90184419-90184441 GAAGGAGATGAGAAGGAAGGCGG - Intergenic
993868808 5:93225559-93225581 CAAGGTGCTCAGAAGGAGTGAGG + Intergenic
994014963 5:94955109-94955131 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
994138039 5:96309748-96309770 GAAGGTGAGCTGAAGCAGGGTGG - Intergenic
994142945 5:96361627-96361649 GAAGGTGAGCTGAAGCAGGGTGG - Intergenic
994346042 5:98687467-98687489 AAAGGGAAGCAGAAGGAGGAAGG + Intergenic
994430415 5:99652740-99652762 GCAGGTGATCAGAATGAGTGAGG - Intergenic
994636533 5:102351462-102351484 GAAGGTGAGCTGAAGCAGGGCGG + Intergenic
994771462 5:103987075-103987097 GCAGGTTTTCAGAAGCAGGAGGG + Intergenic
995129005 5:108609910-108609932 GCAGGTGATCAGAATGAGTTAGG + Intergenic
995154463 5:108894143-108894165 GAAGGTGAGAAAAAGTAGGATGG - Intronic
995263860 5:110136247-110136269 GAGGGTGAGCAGAAGCAGGCTGG - Intergenic
995398788 5:111717506-111717528 GAAGGTGAGCAGAAGCAGGGTGG - Intronic
995449945 5:112289568-112289590 GAAGGATACCAGAAGGAGCATGG - Intronic
995464339 5:112435843-112435865 GAGGGTGAGCAGAAGCAGGCTGG + Intergenic
995474955 5:112538796-112538818 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
995548209 5:113253575-113253597 GCAGATGAGCACAAGGAGGAGGG + Intronic
995551683 5:113287958-113287980 GTAGGTGATCAGAACTGGGATGG - Intronic
995808477 5:116080046-116080068 GAAGGTGAGCAGAAGCAGGGTGG + Intergenic
995811232 5:116108991-116109013 GATGGTGAGCAGAAGCAGGGTGG - Intronic
996165729 5:120220686-120220708 GAAGTGGAGGAGAAGGAGGAGGG - Intergenic
996428000 5:123335642-123335664 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
996605903 5:125321704-125321726 GAATGTGAGCAGTAGGAGGTTGG + Intergenic
996910963 5:128656268-128656290 GAGGGGGAGCAGAAGCAGGATGG - Intronic
997068180 5:130588462-130588484 GAAGGTGAAAAAAAGCAGGAGGG + Intergenic
997809608 5:136954339-136954361 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
997910851 5:137871575-137871597 TACTGTGATCAGAAGAAGGAAGG + Intronic
998312174 5:141144462-141144484 GAAGGAGGCCAGAAGGAGGGTGG + Intronic
998386714 5:141761404-141761426 GGAGGTGGTGAGAAGTAGGAGGG - Intergenic
998490163 5:142539591-142539613 GAAGAAGAGGAGAAGGAGGAGGG - Intergenic
998613377 5:143713309-143713331 GCAGATGACCAGAAGGTGGAGGG - Intergenic
998939147 5:147261529-147261551 GTAGGTGATCAGAATGAGTCAGG + Intronic
998998926 5:147898340-147898362 GAAGGTGATGATGAGCAGGAAGG + Intronic
999271777 5:150300938-150300960 GAAGGAGAACAGAAGAAAGAAGG - Intronic
999774238 5:154799566-154799588 GAAGGGGAGGAGAAGGAAGAGGG - Intronic
1000194858 5:158947487-158947509 GAGGGCGAGCAGAAGCAGGACGG - Intronic
1000291769 5:159877504-159877526 GAAAGTGTTTAGAAGGAGGCTGG - Intergenic
1000294505 5:159901404-159901426 GAAGGGGAGGAGAAGGGGGAGGG + Intergenic
1000329871 5:160198037-160198059 GAAGGAGAGAAGAAGGGGGAAGG + Intronic
1000574791 5:162964661-162964683 GAGGGTGAGCTGAAGCAGGATGG - Intergenic
1001076009 5:168628678-168628700 GAAGGAGGGCAGGAGGAGGAAGG - Intergenic
1001132974 5:169079774-169079796 GAAGGGGAAGAGGAGGAGGAGGG + Intronic
1001168195 5:169390981-169391003 GATGGTGAGAAGGAGGAGGATGG + Intergenic
1001460766 5:171911592-171911614 GAAGGTAATCAAAAGAAGGATGG - Intronic
1001558263 5:172650986-172651008 GCAGGTGATCAGAATGAGTTAGG + Intronic
1001690796 5:173631279-173631301 GTAGGAGATGAGGAGGAGGAGGG - Intergenic
1001690813 5:173631329-173631351 GTAGGAGATGAGGAGGAGGAGGG - Intergenic
1001706052 5:173741776-173741798 GAAGGGGAGGAGGAGGAGGAGGG + Intergenic
1001801502 5:174548234-174548256 GAGGGTGAGGAGAAGGAAGAAGG - Intergenic
1001972443 5:175967658-175967680 GAAGGTGAGGAGAGGGTGGATGG - Intronic
1001977911 5:176015464-176015486 GAAGGAGAAAAGAGGGAGGAAGG - Intronic
1002239509 5:177828298-177828320 GAAGGAGAAAAGAGGGAGGAAGG + Intergenic
1002244996 5:177876122-177876144 GAAGGTGAGGAGAGGGTGGATGG + Intergenic
1003528258 6:6916540-6916562 GAAGGAAAGCAGAAGGAGGCAGG + Intergenic
1003565980 6:7222576-7222598 GAAGGTGTCCAGAAACAGGAGGG + Intronic
1003860308 6:10316860-10316882 GAATGTCACCAGAAGAAGGAGGG + Intergenic
1004205470 6:13587853-13587875 GAAGGTGAACTGGGGGAGGAAGG + Intronic
1005773319 6:29099934-29099956 GGAGGGGAGCAGAAGGGGGATGG + Intergenic
1005779369 6:29172408-29172430 GGAGGGGAGCAGAAGGGGGATGG + Intergenic
1005845443 6:29773377-29773399 GAAGGGGAAGAGAAGGAGGGAGG - Intergenic
1005980473 6:30832511-30832533 AAAGGTGATCAAAAAGAAGATGG - Intergenic
1006246868 6:32745127-32745149 GAAGGTGACAAGCAGGAGGGTGG - Intronic
1006262923 6:32891930-32891952 GAATATGCTAAGAAGGAGGAAGG + Intergenic
1006437813 6:34035317-34035339 GAAGGAGAACAGGGGGAGGATGG + Intronic
1006992504 6:38227531-38227553 GAAGGTGATCAGAAAGTGGCTGG + Intronic
1007029479 6:38615130-38615152 GAAGGTGAAAAGAAGAAGCATGG - Intronic
1007161252 6:39793154-39793176 GAAGAGGATGAGAAGGAAGAGGG + Intronic
1007267719 6:40609927-40609949 GAAGGGGAGAAGAAGGGGGAAGG - Intergenic
1008279915 6:49584641-49584663 GAAGTTGATGAGAAAGAAGATGG + Intergenic
1008319200 6:50086559-50086581 AAATGTGATCAGAAGGAGTACGG - Intergenic
1008407676 6:51136734-51136756 GAGGGTGAGCAGAAGGAGGGTGG - Intergenic
1009305982 6:62089522-62089544 GAGGGCGAGCAGAAGGAGGGTGG - Intronic
1009718335 6:67428676-67428698 GAGGGCGAACAGAAGCAGGATGG - Intergenic
1009988155 6:70806476-70806498 GAGGGTGAGCTGAAGGAGGGCGG - Intronic
1010069140 6:71722925-71722947 GAAAGTGATTAGAAGTAGTATGG - Intergenic
1010327692 6:74583998-74584020 AAAAATGATCAGAAGGAGGAAGG + Intergenic
1010330131 6:74613965-74613987 GAAGGTGGAGAGAAGAAGGAGGG - Intergenic
1010534801 6:77013382-77013404 GAAAGTGGTTAAAAGGAGGAAGG + Intergenic
1010574870 6:77518357-77518379 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1010672379 6:78701262-78701284 GAAGGGCATCAGAGGGAGAAAGG + Intergenic
1010702310 6:79065045-79065067 GAATATGATGGGAAGGAGGAAGG - Intronic
1011235656 6:85213452-85213474 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1011282835 6:85693777-85693799 GCAGGAGATTAGAGGGAGGAGGG + Intergenic
1011317253 6:86049221-86049243 GCAGGTGATCAGAATGAGTTAGG + Intergenic
1011831315 6:91374987-91375009 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1011861029 6:91756706-91756728 GAAGGTGCTCAAAAGGAGCCAGG + Intergenic
1011980850 6:93376004-93376026 GAAGATAGTCAGAAGGAGGTGGG + Intronic
1012128011 6:95454542-95454564 GAAGGCGAGCAGAAGCAGGGTGG - Intergenic
1012685468 6:102242859-102242881 GAAAGGGAGTAGAAGGAGGAGGG - Intergenic
1012898461 6:104978783-104978805 GGTTTTGATCAGAAGGAGGAAGG - Intronic
1013024956 6:106262703-106262725 GAGGGTGACCAGAAGCAGGGTGG + Intronic
1013601271 6:111707299-111707321 GAAGGTGTTCAGTAGGCTGAAGG - Intronic
1013682506 6:112541095-112541117 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1013920239 6:115394892-115394914 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1014048223 6:116919554-116919576 GAAGATGATAAGAAGCTGGATGG + Intronic
1014223629 6:118823388-118823410 GAAGGTGAGCAGAAGCAGGGTGG - Intronic
1014527905 6:122522706-122522728 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1014755939 6:125301982-125302004 GAAGGGGAGGAGGAGGAGGACGG - Intronic
1014909718 6:127077100-127077122 ATAGTTGATCAGAAGGAGAAGGG + Intergenic
1015763073 6:136685882-136685904 CAAGGTGCTCACAGGGAGGAGGG - Intronic
1015916178 6:138219403-138219425 GAAGGTGAGGAGGGGGAGGATGG + Intronic
1016114526 6:140263401-140263423 GAACATGAGCAGAAGAAGGAGGG - Intergenic
1016614194 6:146028181-146028203 CAAGGTGATGAGAATGAGGGCGG + Intronic
1017357039 6:153521464-153521486 GAGGGTGAGCTGAAGCAGGAGGG - Intergenic
1017587444 6:155942789-155942811 GAAGAGGAGCAGGAGGAGGAAGG + Intergenic
1018007085 6:159632291-159632313 TGATGTGATCAGAGGGAGGACGG - Intergenic
1018178553 6:161200100-161200122 GAATGTGCACAGAAAGAGGAAGG + Intronic
1018491980 6:164303191-164303213 GAAGGAGATTAGAGTGAGGAAGG + Intergenic
1018961005 6:168448477-168448499 GATGGGGATGAGGAGGAGGACGG + Intronic
1018961054 6:168448630-168448652 GATGGTGATGGGGAGGAGGATGG + Intronic
1018996644 6:168715289-168715311 GATGGTGAGGAGTAGGAGGATGG + Intergenic
1019071976 6:169354150-169354172 GAGGGTGAGCTGAAGGAGGGTGG - Intergenic
1019203753 6:170341775-170341797 GAGGGTGACCAGAAGCAGGGTGG - Intronic
1019327603 7:445993-446015 GATGGAGAAAAGAAGGAGGAGGG + Intergenic
1019632324 7:2056335-2056357 GACGGCGATCAGAAGCAGCATGG + Intronic
1020243410 7:6412667-6412689 GAATCTGATCAGATGGTGGAAGG + Intronic
1020487749 7:8739442-8739464 GAAGGCAATCAGAAGCAGGGTGG - Intronic
1020655966 7:10928390-10928412 GCAGGTAATCAGAATGAGGGTGG - Intergenic
1020823930 7:13003261-13003283 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1021347751 7:19548540-19548562 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1022058930 7:26770750-26770772 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1022286505 7:28959032-28959054 GAAGGCCATCAGAAGGGGGTAGG + Intergenic
1022633844 7:32112290-32112312 GAAGAAGAGGAGAAGGAGGAGGG - Intronic
1023443766 7:40210869-40210891 GCAGGTGATCAGAATGAGTCAGG + Intronic
1023511707 7:40959969-40959991 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1023878862 7:44307396-44307418 GGGGGTAAGCAGAAGGAGGAGGG + Intronic
1023894230 7:44418771-44418793 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1024639576 7:51317775-51317797 GCAGGGGATCAGAGGGAGGAAGG - Intergenic
1025104116 7:56156869-56156891 GAAGCTGTTCAAGAGGAGGAAGG - Intergenic
1025111037 7:56216411-56216433 GAAGGGTTGCAGAAGGAGGAGGG + Intergenic
1026112098 7:67466444-67466466 GAAGGAGAGAAGAAGGAGGGAGG - Intergenic
1026245429 7:68615341-68615363 GAAGATGAGGAGAAGAAGGAGGG + Intergenic
1026523928 7:71138421-71138443 GTAGGTGAGGAGGAGGAGGAAGG + Intronic
1026529046 7:71181496-71181518 GCTGGTGATGAGAAGGATGAAGG + Intronic
1026641558 7:72130652-72130674 GATGGTGATAAGGAGGAGGAGGG + Intronic
1027759776 7:82262834-82262856 GAAGGTGTTCAAAGGGAGAAGGG - Intronic
1028127692 7:87132879-87132901 GAAGGTAGTGAGAAGGAGGGGGG + Intergenic
1028694231 7:93690402-93690424 GCAGGAGGTCAGAAGGAGGGAGG + Intronic
1028793325 7:94877847-94877869 GCAGGTGATCAGAATGAGTCAGG - Intergenic
1028793337 7:94877936-94877958 GCAGGTGATCAGAATGAGTCAGG - Intergenic
1029896422 7:103989447-103989469 GAAGGCGAGAAGAAGGCGGACGG + Exonic
1030162015 7:106518614-106518636 GAAGGAGAGGAGAGGGAGGAAGG - Intergenic
1030415778 7:109240955-109240977 GAAGGTGAGCAGAATTAAGAAGG - Intergenic
1030482225 7:110119552-110119574 GAGGGTGAGCAGAAGCAGGCTGG + Intergenic
1031317334 7:120273574-120273596 GAAGGTGAAAAGGAGGAGGGAGG + Intergenic
1031408860 7:121419346-121419368 GGAGGTGATTAGGAGGAGCAGGG - Intergenic
1031537417 7:122952438-122952460 GAAGAGGAGGAGAAGGAGGAAGG + Intergenic
1031740842 7:125428276-125428298 GAAGGTGGTAAAAAGGAGCAGGG + Intergenic
1032026534 7:128446853-128446875 GAAGGTGACAGCAAGGAGGAAGG + Intergenic
1032161670 7:129515718-129515740 GAAGGTGATTAAGAGGAGGGTGG + Intergenic
1032476018 7:132211919-132211941 TAAGGAGGTCAGAAGAAGGAGGG + Intronic
1032523301 7:132562053-132562075 GAAGAGGAGGAGAAGGAGGAGGG - Intronic
1032659834 7:133970640-133970662 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1032884653 7:136124517-136124539 GAGGATCATCACAAGGAGGAGGG + Intergenic
1032893225 7:136222315-136222337 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1033092892 7:138403315-138403337 GCAGGTGATCAGAATGAGTCAGG - Intergenic
1033485338 7:141783594-141783616 TAAGGTCAACAGCAGGAGGAGGG + Intronic
1033617583 7:143031886-143031908 GAAGGTGAGCAGAAGCAGGGTGG + Intergenic
1033843128 7:145399326-145399348 GATGGTGAGGAGAAAGAGGATGG + Intergenic
1034096277 7:148410779-148410801 AAAGTTGAGCAGGAGGAGGAAGG + Intronic
1034280526 7:149850808-149850830 CAGGTGGATCAGAAGGAGGAAGG + Intronic
1034314402 7:150116928-150116950 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1034792493 7:153983841-153983863 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1035082415 7:156227949-156227971 GAAAGACATCAAAAGGAGGAGGG + Intergenic
1035161138 7:156950509-156950531 GAAAGTGAGGAGGAGGAGGAGGG + Exonic
1035212037 7:157336167-157336189 GATGGTGACCAGCAGGAGCAGGG - Intronic
1035481404 7:159190236-159190258 GAAGGAGAGGAGAAGGAGCAGGG + Intergenic
1035793982 8:2336757-2336779 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1035798823 8:2384951-2384973 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1036448727 8:8846288-8846310 GAGGAGGATAAGAAGGAGGAGGG + Intronic
1037285559 8:17294725-17294747 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1037412686 8:18615188-18615210 GCAGGTGATCAGAATGAGTCAGG - Intronic
1037809643 8:22080015-22080037 GAAGGTGACCAGTAGGAGCTGGG + Intronic
1038007394 8:23444366-23444388 GATGGAGAGGAGAAGGAGGAAGG + Intronic
1038482235 8:27909707-27909729 AAAGGTGATCAGGGGGATGAAGG - Exonic
1038483654 8:27918848-27918870 GAAGAAGAGGAGAAGGAGGAGGG + Intronic
1039282892 8:36006258-36006280 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
1039317287 8:36387740-36387762 GAAGGGGAAGAGGAGGAGGAGGG - Intergenic
1039639793 8:39206631-39206653 GAAGGTGACCTCAAGGATGAAGG - Intronic
1039742665 8:40396663-40396685 GCAGGAGATCAGAGGGAGCAAGG - Intergenic
1040690960 8:49937872-49937894 AAAGGAACTCAGAAGGAGGAGGG - Intronic
1040703786 8:50100925-50100947 GAAGGTGGACAGTGGGAGGAGGG - Intronic
1040963792 8:53064067-53064089 GAAAGACATAAGAAGGAGGAGGG + Intergenic
1040968890 8:53112787-53112809 GAGGGTGAGCTGAAGCAGGATGG - Intergenic
1040974635 8:53176461-53176483 AAAGGGGATGAGAAGGAGGAGGG + Intergenic
1040980822 8:53244761-53244783 TAAGGAGAACAGAAAGAGGATGG + Intronic
1041030425 8:53730857-53730879 GAAGGGGAGCAGTAGGATGAAGG + Intronic
1041078024 8:54186938-54186960 GAAAGTCATCTGGAGGAGGATGG - Intergenic
1041153082 8:54956559-54956581 GAAGGTGATGTGAATGAAGATGG - Intergenic
1041401366 8:57448750-57448772 GAGGGGGAGGAGAAGGAGGAGGG - Intergenic
1041419160 8:57647278-57647300 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1041479185 8:58299155-58299177 GCAGGTGATCAGAATGAGTTAGG + Intergenic
1042087021 8:65120534-65120556 GCAGGTGATCAGAATGAGTCAGG + Intergenic
1042088509 8:65133348-65133370 GCAGGTGATCAGAATGAGTTAGG + Intergenic
1042381827 8:68124488-68124510 GAAGGTGAAGGGTAGGAGGAGGG + Intronic
1042382541 8:68134558-68134580 GAAGGTCATCAGAAGAAAAAGGG + Intronic
1043036749 8:75208635-75208657 GAAGGTGAGCAGAAGCAGGATGG - Intergenic
1043253749 8:78106872-78106894 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1043472147 8:80573645-80573667 GAAGGTGAGTAGAAGGAGAATGG - Intergenic
1043656957 8:82679672-82679694 GAAGAGGAGAAGAAGGAGGAGGG + Intergenic
1043935403 8:86136911-86136933 GTCGCAGATCAGAAGGAGGAAGG - Intronic
1044509559 8:93058759-93058781 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1044722091 8:95160417-95160439 TGAGTTGTTCAGAAGGAGGAGGG + Intergenic
1044940346 8:97335434-97335456 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1045185265 8:99830895-99830917 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1045390499 8:101710120-101710142 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1046014550 8:108589901-108589923 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1046776010 8:118164114-118164136 GAGGGAGAGCAGCAGGAGGAAGG + Intergenic
1046959616 8:120096515-120096537 GAAGGTGGAGAGTAGGAGGAGGG - Intronic
1047606568 8:126480496-126480518 GAAGGTGAAAAGTAGGAAGAAGG + Intergenic
1048149896 8:131884038-131884060 GAAGATAACCAGAAGGATGAAGG + Intergenic
1048286156 8:133143242-133143264 GAAGGACACCTGAAGGAGGAAGG - Intergenic
1048457062 8:134587775-134587797 GAAGGAATTCAGAAGGTGGAAGG - Intronic
1048534166 8:135276905-135276927 GAAGGTGGAGGGAAGGAGGAAGG - Intergenic
1048573348 8:135672539-135672561 GAGGGTGCTCAGAAGGAGCGGGG - Intergenic
1048898386 8:139015349-139015371 GGAGGTGAGAAGCAGGAGGAGGG + Intergenic
1049470426 8:142772883-142772905 AAAGGTGGACAGAAGGAGGCAGG + Intronic
1049562986 8:143321352-143321374 GCAGGAAATGAGAAGGAGGACGG - Exonic
1049604598 8:143523425-143523447 GAAGGTGATCTCAGGGAGGGTGG + Intronic
1049653373 8:143787039-143787061 GAAACTGCTCAGAAGCAGGATGG + Intergenic
1050163349 9:2740391-2740413 GATTGTGATAAGAAGGGGGAGGG + Intronic
1050282012 9:4060339-4060361 GAAGGTGACGAGAAGCAGGCTGG - Intronic
1050436509 9:5616239-5616261 GAAGGTGATCAGCAGGGGCCAGG + Intergenic
1050515893 9:6444321-6444343 GATGGTAATCAAAAGGAGGAAGG + Intronic
1051452057 9:17207635-17207657 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1051611729 9:18968042-18968064 GAAGGTGAGCAGAAGCAGGGTGG - Intronic
1051814241 9:21087068-21087090 GAGGGTAAGCAGAAGGAGGGTGG + Intergenic
1052144127 9:25026158-25026180 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1052366278 9:27615214-27615236 GAGGGTGAGCAGAAGTAGGGTGG - Intergenic
1052506284 9:29358808-29358830 GAGGGTGAGCAGAAGTAGGGTGG + Intergenic
1052982546 9:34459384-34459406 GAATGTGAGAACAAGGAGGAAGG - Intronic
1053014482 9:34654202-34654224 AAGGGGGAGCAGAAGGAGGAAGG - Intronic
1053110520 9:35455776-35455798 GCAGGTGATCAGAATGAGTCAGG + Intergenic
1053111309 9:35461945-35461967 GCAGGTGATCAGAATGAGTCAGG + Intergenic
1053261495 9:36669601-36669623 GAAACTGATCAGCAGTAGGACGG + Intronic
1053441621 9:38120958-38120980 GAGGGGGAGGAGAAGGAGGAGGG + Intergenic
1053608245 9:39681685-39681707 GAAGGTGAGCTGAAGTAGGGTGG - Intergenic
1053866085 9:42438045-42438067 GAAGGTGAGCTGAAGTAGGGTGG - Intergenic
1054245286 9:62660724-62660746 GAAGGTGAGCTGAAGTAGGGTGG + Intergenic
1054559414 9:66695255-66695277 GAAGGTGAGCTGAAGTAGGGTGG + Intergenic
1055339053 9:75262234-75262256 GAAGGTGAGCAGAAGCAGGATGG - Intergenic
1055345124 9:75327443-75327465 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1055628676 9:78200799-78200821 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1055823970 9:80301562-80301584 GAGGGCGAGCAGAAGCAGGATGG - Intergenic
1056003608 9:82243297-82243319 GAAGGTGAGCTGAAGCAGGATGG - Intergenic
1056165547 9:83937409-83937431 GAAGGGAAGAAGAAGGAGGAGGG + Intergenic
1056385227 9:86091052-86091074 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1056407556 9:86289804-86289826 GAAGAAGATCAGGAGGAGGTGGG + Intronic
1056428663 9:86504847-86504869 CAAGGTGAGCAGAAGGTAGAGGG - Intergenic
1057049714 9:91914537-91914559 CAAGGTGACCGGCAGGAGGATGG - Intronic
1057079667 9:92163480-92163502 GCAGGTTTTCAGAGGGAGGAAGG - Intergenic
1057417847 9:94881057-94881079 GATGGAGGTCAGAAGGAGGCAGG + Intronic
1057744776 9:97742076-97742098 GAAGATGAGGAGGAGGAGGAGGG + Intergenic
1057754622 9:97822241-97822263 GAAGGTCATCACATGGAAGAGGG + Intergenic
1058157376 9:101530596-101530618 GATGGTGAACAGAAGGTGGCTGG + Intronic
1058203035 9:102067153-102067175 GAAGGTGAGCTGAAGCAGGGCGG - Intergenic
1058265712 9:102897255-102897277 GAGGGTGAGCAGAAGCAGGGAGG + Intergenic
1058290514 9:103235213-103235235 AAAGGTGATGAGATTGAGGAGGG + Intergenic
1058809317 9:108624381-108624403 GAAGGTTATAAGAAAGAGGGTGG - Intergenic
1059218792 9:112592135-112592157 GCAGGTGATCGGAATGAGGGTGG + Intronic
1059473724 9:114526904-114526926 GAAGATGAGAAGTAGGAGGAGGG + Intergenic
1059757184 9:117304542-117304564 GACTTTGATTAGAAGGAGGAGGG - Intronic
1059978238 9:119740983-119741005 GAAGGTGGAGAGTAGGAGGAGGG - Intergenic
1060395935 9:123316579-123316601 GAAGGTGCAGAGAAAGAGGAAGG + Intergenic
1060484203 9:124036943-124036965 GAAGGTGATCAGATGGAGAAGGG + Intergenic
1060484704 9:124039746-124039768 GAAAGTCATCAGGAAGAGGAAGG + Intergenic
1061160056 9:128888553-128888575 GCAGGTGAGGAGCAGGAGGAGGG + Intronic
1061236148 9:129343713-129343735 GATGGTGATGAGGAGAAGGATGG + Intergenic
1061973980 9:134059216-134059238 GAAGCTGCTCAGAGGGAAGAGGG + Intronic
1062047427 9:134431010-134431032 GAAGAAGATCTGAAGGAGGCTGG - Intronic
1062050638 9:134444754-134444776 GAAGGAGAAAAGAAGGAGGGAGG - Intergenic
1062281740 9:135754948-135754970 GGAGGGGACCATAAGGAGGAGGG - Intronic
1062449137 9:136608255-136608277 GAAGGAGAGGAGAAGGGGGAAGG + Intergenic
1185603560 X:1354870-1354892 GAAGGAGGTGAGGAGGAGGAAGG + Intronic
1185603620 X:1355037-1355059 GAAGGGGAGCAGATGGAGGAAGG + Intronic
1186118642 X:6333443-6333465 GAAGGTGGAGGGAAGGAGGAGGG - Intergenic
1186599890 X:11025091-11025113 GAAGGTGAGCAGAAGCAGAGTGG - Intergenic
1186659193 X:11651280-11651302 GAGGGTGAGCAGTGGGAGGAGGG - Intronic
1186688623 X:11951591-11951613 GAGGGTGAGCAGTGGGAGGAGGG + Intergenic
1186773393 X:12839656-12839678 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1187248408 X:17574671-17574693 GAGGGTGAGCCGAAGCAGGATGG - Intronic
1187284250 X:17887818-17887840 GAAGGAGAGGAGAAAGAGGATGG + Intergenic
1187660759 X:21544734-21544756 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1188915539 X:35905161-35905183 GAGAGTGAGCAGAAGCAGGATGG - Intergenic
1189178950 X:38985242-38985264 GATGGTGAACAAAAGGAGCATGG - Intergenic
1189253526 X:39619945-39619967 GAAGGCGATCAGAGGGAACAAGG + Intergenic
1189955537 X:46273754-46273776 GCAGGTGATCAGAATGAGTCAGG - Intergenic
1189960209 X:46317102-46317124 GAAGGTGGTGAGCATGAGGAAGG + Intergenic
1190061863 X:47216806-47216828 TAAAATGATCAGAAGGAGGTGGG - Intergenic
1190963805 X:55278395-55278417 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1191004996 X:55702268-55702290 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1191148181 X:57190691-57190713 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1191174241 X:57482534-57482556 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1191591253 X:62887957-62887979 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1191676556 X:63797624-63797646 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1191987306 X:66995435-66995457 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1192009176 X:67250062-67250084 GAAGGTGAACAGAAGCAGGGTGG + Intergenic
1192106008 X:68317648-68317670 GAAGAAGAAGAGAAGGAGGAAGG + Intronic
1192703246 X:73498409-73498431 GAGGGTGAGCTGAAGTAGGATGG - Intergenic
1192759273 X:74078346-74078368 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1192958257 X:76096140-76096162 GAGGGTAAGCAGAAGCAGGATGG - Intergenic
1192971222 X:76233496-76233518 GAAGGTGAGCAGAAGCAGTGTGG + Intergenic
1192980292 X:76332183-76332205 GAGGGTGAGCAGAAGCAGGCTGG + Intergenic
1193019981 X:76781082-76781104 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1193043882 X:77032069-77032091 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1193165574 X:78276810-78276832 GAAAGTGGACAGATGGAGGATGG + Intronic
1193394396 X:80967449-80967471 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1193398182 X:81010527-81010549 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1193514314 X:82445443-82445465 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1193552760 X:82918633-82918655 GATGGTGAACAGTGGGAGGAGGG - Intergenic
1193645627 X:84065963-84065985 GAGGGTGAGCAGAAGTAGGGTGG + Intronic
1194203193 X:90979359-90979381 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1194315371 X:92369793-92369815 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1194631539 X:96291548-96291570 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1194643487 X:96429882-96429904 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1194944190 X:100048613-100048635 GCAGGTGAACAGAAGGCAGAAGG + Intergenic
1195019098 X:100808485-100808507 GCAGGTGATCAGAATGAGTCAGG + Intergenic
1195070416 X:101273668-101273690 GAAGGCCATGATAAGGAGGATGG - Intronic
1195272011 X:103241667-103241689 GAAGAGGATGAGGAGGAGGAAGG - Intergenic
1196133315 X:112181025-112181047 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1196353352 X:114759267-114759289 GAAGCTGCTGAAAAGGAGGATGG - Intronic
1197184665 X:123573356-123573378 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1197614400 X:128675351-128675373 GAGGGTGAGCAGAAGCAGGGAGG - Intergenic
1197832902 X:130663829-130663851 GAAAGTGATCAAGAGGAGGAGGG - Intronic
1198039919 X:132840423-132840445 GAAGGGGAAGAGGAGGAGGAGGG - Intronic
1198209729 X:134505884-134505906 GGAAGTGATCAGAATGAGAAGGG + Intronic
1198395170 X:136212685-136212707 GAAGGGGCTGAGAAGGAGGGTGG - Intergenic
1198645577 X:138802388-138802410 AAGGGTGAGCAGAAGCAGGATGG - Intronic
1198737356 X:139801399-139801421 AAAAGTGATGAGAAGGAGGGAGG + Intronic
1198868894 X:141155353-141155375 GCAGGTGATCAGAATGAGTCAGG - Intergenic
1198944624 X:141996603-141996625 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1198948545 X:142042262-142042284 GCAGGTGATCAGAATGAGTCAGG + Intergenic
1199104607 X:143849140-143849162 GAAGGTTTTCAGAAGGAGTTTGG + Intergenic
1199316564 X:146385433-146385455 GAAAGTGAGCAGAAGAAGGAGGG + Intergenic
1199524976 X:148781980-148782002 GATGGCGAGCAGAAGCAGGATGG - Intronic
1199638525 X:149836764-149836786 GCAGGTGATCAGAATGAGTTAGG - Intergenic
1199653004 X:149966483-149966505 GTAGGTGTTCACAGGGAGGAGGG - Intergenic
1200549026 Y:4554785-4554807 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1200623420 Y:5481328-5481350 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1200763034 Y:7057172-7057194 GCAGGTAATCAGAATGAGGGTGG + Intronic
1201314470 Y:12630071-12630093 GAAGGTGAGCTGGAGCAGGATGG - Intergenic
1201474225 Y:14363425-14363447 GCAGGTGATCAGAATGAGTCGGG + Intergenic
1201498739 Y:14618362-14618384 GAGGGTGAGCAGAAGTAGGATGG - Intronic
1201590552 Y:15610496-15610518 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1201922123 Y:19245213-19245235 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic