ID: 933264715

View in Genome Browser
Species Human (GRCh38)
Location 2:80169383-80169405
Sequence TGGGAAGGCCAGATTCTGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 179}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933264715_933264720 5 Left 933264715 2:80169383-80169405 CCAATCAGAATCTGGCCTTCCCA 0: 1
1: 0
2: 0
3: 13
4: 179
Right 933264720 2:80169411-80169433 TACAAAGGTATACGTTATAAAGG 0: 1
1: 0
2: 0
3: 9
4: 148
933264715_933264716 -10 Left 933264715 2:80169383-80169405 CCAATCAGAATCTGGCCTTCCCA 0: 1
1: 0
2: 0
3: 13
4: 179
Right 933264716 2:80169396-80169418 GGCCTTCCCAGCTTTTACAAAGG 0: 1
1: 0
2: 0
3: 18
4: 161
933264715_933264721 30 Left 933264715 2:80169383-80169405 CCAATCAGAATCTGGCCTTCCCA 0: 1
1: 0
2: 0
3: 13
4: 179
Right 933264721 2:80169436-80169458 TACGTGTTACAAAAGAAGAATGG 0: 1
1: 0
2: 0
3: 17
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933264715 Original CRISPR TGGGAAGGCCAGATTCTGAT TGG (reversed) Intronic
900191258 1:1353258-1353280 TGGGGCTGCCAGGTTCTGATGGG + Exonic
900915957 1:5638801-5638823 TGGGGAAGCCATCTTCTGATTGG - Intergenic
902198507 1:14816051-14816073 TTGGAATGCCAGCTTCTGTTGGG + Intronic
902779299 1:18694011-18694033 GGGGAAGCCCAGAGTATGATAGG - Intronic
902814073 1:18906109-18906131 AGGGAAAGCCAGAGTGTGATGGG - Exonic
903630007 1:24761171-24761193 TGGGAAGGGCTAGTTCTGATGGG + Intronic
905938097 1:41840720-41840742 TGGCACGGCCAGGATCTGATGGG - Intronic
906867220 1:49434885-49434907 TGGGAATGCCAGAGTGAGATGGG - Intronic
909017615 1:70396716-70396738 AGGGAAGGCAAGATCATGATGGG + Intergenic
910538614 1:88329149-88329171 TGGCAAGTCCAAAATCTGATGGG + Intergenic
910715802 1:90228337-90228359 TAGGCAGGCCATAGTCTGATAGG - Intergenic
910775571 1:90871305-90871327 TGTGAAGGCCAGATTCTCCATGG - Intergenic
911640161 1:100279869-100279891 TCGACAGGCCAGATTCTGAAAGG + Intronic
911744162 1:101420772-101420794 TGGCAAGTCCAAAATCTGATAGG - Intergenic
912144740 1:106779531-106779553 TGTGAAGTGCAGATTCAGATAGG - Intergenic
913211939 1:116589482-116589504 GGTGAAGGCCAGATCCTGAAGGG - Intronic
913973568 1:143435733-143435755 TGGGCTGGCTAGATTCAGATGGG - Intergenic
914067956 1:144261340-144261362 TGGGCTGGCTAGATTCAGATGGG - Intergenic
914111199 1:144705014-144705036 TGGGCTGGCTAGATTCAGATGGG + Intergenic
915895886 1:159810278-159810300 TTGGAAAGCCAGAGTCTGACAGG + Intronic
916762751 1:167832066-167832088 TGGGGAAGGCAGTTTCTGATGGG + Intronic
918106566 1:181420244-181420266 TGGGTAAGCCAAATGCTGATGGG + Intronic
920910646 1:210213343-210213365 TGGGATGGCCAGTTTCTTCTTGG + Intergenic
1063175836 10:3550298-3550320 AGGGAAGGCATGATTCTGAAAGG - Intergenic
1063228081 10:4034679-4034701 TGGAGACGCCAGACTCTGATAGG - Intergenic
1065373389 10:25012587-25012609 TTGCAAGTCCAGATTCTAATAGG - Intronic
1067463225 10:46473885-46473907 TGGGAAGGCCAGGCCCTTATCGG - Intergenic
1067789197 10:49275022-49275044 TGAGAAGGCCAGGTTCTGTGAGG + Intergenic
1067966102 10:50914552-50914574 TGGCTAGGACAGATTCTGATTGG + Intergenic
1070832712 10:79430010-79430032 TGGGCAGGCTAGAACCTGATTGG - Intronic
1074118703 10:110477216-110477238 TGGCAAGGCCAGATTATGCAGGG - Intergenic
1074432261 10:113404111-113404133 TTGACAGGCCAGACTCTGATTGG + Intergenic
1076082896 10:127599638-127599660 TGGGAAAGTGAGATGCTGATGGG + Intergenic
1077778548 11:5298557-5298579 TGGGAAGACAATATGCTGATGGG + Intronic
1078142295 11:8701328-8701350 TGGGAAGGCCAGCTTCCGGGGGG + Intronic
1078510467 11:11980798-11980820 GGGAAAGGCAAGATTCAGATGGG + Intronic
1082251883 11:49991653-49991675 TGGGAAGGGCAGAATGAGATTGG - Intergenic
1083263588 11:61536016-61536038 TGGGAAGGGGAGAGTCTGCTGGG + Intronic
1083771274 11:64869071-64869093 TAAGAAGCTCAGATTCTGATGGG + Intronic
1084845654 11:71897587-71897609 TAGGAATGCTCGATTCTGATCGG + Intronic
1084933421 11:72574506-72574528 AGGCAAGGCCAGATCCTGAAGGG - Intergenic
1087661832 11:100997470-100997492 TGGGGAGGGCAGCTTCTCATAGG + Intergenic
1089385560 11:118065235-118065257 TGGGAAAGCCAGATTAGGCTGGG - Intergenic
1091450862 12:571178-571200 TTGGTTGGCCAGATTTTGATGGG - Intronic
1093822742 12:23642266-23642288 TTGGAAGGCCAGATCCAGAGAGG - Intronic
1093909814 12:24733914-24733936 TTGGAGGGCCTGATGCTGATTGG - Intergenic
1094554295 12:31483054-31483076 AGGGAAGAGCAGATTTTGATGGG - Intronic
1095874523 12:47066230-47066252 TGCAAAGGCCATATGCTGATGGG - Intergenic
1097277126 12:57821261-57821283 TGGGCAGGCAGGGTTCTGATGGG + Exonic
1100032723 12:90212990-90213012 TGGGCAGCTCAGATTCTGGTAGG + Intergenic
1100198437 12:92273279-92273301 TGGCAAGTCCACAATCTGATGGG - Intergenic
1102029407 12:109731348-109731370 TGGGAGGGCCGGATTCTGAGTGG - Intronic
1107500967 13:40975262-40975284 TGGAATGGCAAGATTCTGTTAGG - Intronic
1110477558 13:75934778-75934800 AGGTAAGGCAAAATTCTGATTGG + Intergenic
1110740554 13:78991074-78991096 TGGGAAGGAAGGCTTCTGATAGG + Intergenic
1111186850 13:84748717-84748739 TGGTAAGTCCAAAATCTGATCGG - Intergenic
1113155994 13:107322653-107322675 TGGGAACCTCAGATTTTGATGGG + Intronic
1114417818 14:22556116-22556138 TGGGAAGACGAGCTTCTGACTGG + Intergenic
1115192003 14:30755877-30755899 AGGGAAGTCCAGACTCTGAGGGG + Intergenic
1118017008 14:61670872-61670894 TGGAAAGGACAGTTGCTGATAGG + Intergenic
1120265974 14:82251637-82251659 TGGGAGGGCCAGTTTTTCATGGG - Intergenic
1120327426 14:83049144-83049166 TGGGAAGGTCTTATGCTGATGGG - Intergenic
1121625348 14:95381617-95381639 TGTGAATGCCATATTCTGTTTGG - Intergenic
1124205773 15:27718759-27718781 TGGGAAGGGCACCTTCTTATAGG + Intergenic
1125755855 15:42064400-42064422 TGGTGAGTCCAGAGTCTGATGGG + Intergenic
1126860505 15:52878237-52878259 TGGCCAGGCCAGATACTTATAGG - Intergenic
1127385088 15:58460588-58460610 TGGGAAACCCAGGCTCTGATGGG + Intronic
1127808852 15:62545776-62545798 TGGCAGGGCCTTATTCTGATTGG + Intronic
1127997178 15:64160031-64160053 TGGGAGGGCCAGGTTCTGCTGGG - Intronic
1130937241 15:88480806-88480828 TGGGAAGGTCAGTCTCTGAGAGG - Intergenic
1134288094 16:12879723-12879745 TGGGAGGACCAGATTCTGGTGGG - Intergenic
1138827410 16:60337029-60337051 TAGGAAGGCCAGAACCTGATGGG - Intergenic
1138860466 16:60749894-60749916 AGGGAAGGACAGATCCTGGTTGG + Intergenic
1143107056 17:4535182-4535204 TGGGCAGGCCAGAGTCAGACAGG - Intronic
1145935979 17:28715126-28715148 AGGGAAGGCCAGAGTCAGAGGGG + Intronic
1148161337 17:45451843-45451865 TGTGAAGGCCAGGCTCTGAGGGG - Intronic
1149207683 17:54267342-54267364 TGGGAAGGCCAGATTTTTCGCGG - Intergenic
1149909530 17:60554284-60554306 GGGGAATGCCACATGCTGATAGG - Intergenic
1151194468 17:72421695-72421717 TGAGAAGGACAGAGTCTGACAGG + Intergenic
1155831272 18:30517235-30517257 TGTGGAGGACAGATTTTGATTGG + Intergenic
1158000095 18:52608394-52608416 TGGGAAGGCCAGGTCCTCAGTGG - Intronic
1158768517 18:60485787-60485809 TGTGAAGGCCAGGACCTGATAGG + Intergenic
1162924047 19:13920750-13920772 TAGGAAGGCCAGCTGCTGCTGGG - Exonic
1168444262 19:56398233-56398255 TGGGGCAGCCAGCTTCTGATTGG - Intronic
927143209 2:20143586-20143608 TGGGAAGACAAGATTCGGGTGGG - Intergenic
927821170 2:26266457-26266479 TTGGAAGGCCAGGTTCTTATGGG + Intronic
928843873 2:35645067-35645089 GGGAAAGGATAGATTCTGATGGG - Intergenic
929830841 2:45345047-45345069 TGAGAAGGAAAGATGCTGATGGG - Intergenic
932383394 2:71306921-71306943 TGGGAATGGAATATTCTGATTGG + Intronic
933251748 2:80036700-80036722 TGGGAAGGGAAGATCCTGGTGGG + Intronic
933264715 2:80169383-80169405 TGGGAAGGCCAGATTCTGATTGG - Intronic
933383759 2:81583871-81583893 CGGGAAGGCCAGATGCAGAGAGG + Intergenic
934178262 2:89596699-89596721 TGGGCTGGCTAGATTCAGATGGG - Intergenic
934288557 2:91670991-91671013 TGGGCTGGCTAGATTCAGATGGG - Intergenic
934299133 2:91766629-91766651 GGTGAAGGCCAGATCCTGAAGGG + Intergenic
937110378 2:119362746-119362768 TGGGAGTGGAAGATTCTGATAGG - Intronic
937473247 2:122191446-122191468 CTGAAAGGCCAGATTCAGATGGG - Intergenic
938950903 2:136253721-136253743 TGGGAAGGCTGGCTTGTGATGGG + Intergenic
940667374 2:156625414-156625436 TGGGCAGGACAGATTCTGGCAGG - Intergenic
941091793 2:161185352-161185374 TGGGAAGGGCAGATTGTAGTAGG + Intronic
945336155 2:208595180-208595202 TGGGAAGGGCAGATTTTAACTGG - Intronic
946308901 2:218872034-218872056 TGAGAAGGCCAGATGCTGGACGG + Intronic
946844154 2:223844458-223844480 TGGGAAAGCAATATTCTGATTGG - Intergenic
947587587 2:231366102-231366124 TGGCAAGCGCAGAATCTGATGGG + Intronic
1170483759 20:16794393-16794415 GGGGAAGGCATGACTCTGATGGG - Intergenic
1170600351 20:17836800-17836822 TGGGAAAGCCAGAGTCTGGTGGG + Intergenic
1171210202 20:23310728-23310750 AGAGCAGGCCAGACTCTGATGGG - Intergenic
1172665141 20:36593800-36593822 TGGGTAGGGCAGACTCTGCTTGG + Exonic
1172947047 20:38697595-38697617 TCGGAAGAACAGATTCTGCTCGG - Intergenic
1173050960 20:39561392-39561414 AGGGAAGGCCAGAACTTGATGGG + Intergenic
1173310542 20:41892732-41892754 TGGGAAAGGCAGACCCTGATGGG - Intergenic
1173483306 20:43420804-43420826 AGGTAAGGCGAGATTCTTATAGG - Intergenic
1175293040 20:57890973-57890995 TGGGAAGGCCAGAGTGGTATAGG - Intergenic
1175681772 20:60994628-60994650 TGGGAGGGACAGATTCTACTGGG - Intergenic
1175855374 20:62118234-62118256 TCGAAATGTCAGATTCTGATAGG - Intergenic
1177953680 21:27570175-27570197 TGGGGAGGCCAGATTCTTCCTGG - Intergenic
1181314387 22:21962215-21962237 AGGGAAGGCCAGGTCCTGAATGG + Intronic
1182349872 22:29693281-29693303 TTGGAAAGCCCGGTTCTGATGGG - Intronic
1183639601 22:39084886-39084908 TGGAGAGGCCAAATTCTGCTTGG + Intronic
1185105137 22:48864495-48864517 TGGGCAGGCCTGTCTCTGATGGG + Intergenic
949543487 3:5052738-5052760 TGGGAAGTTCAGATTCTTTTAGG - Intergenic
951038611 3:17963116-17963138 TGGAATGGCCAGCTTCTCATTGG + Intronic
951966332 3:28389762-28389784 TGGCAAGTCCAGTTTCTGATGGG + Intronic
953385596 3:42504153-42504175 TGGGAGGGCCAGATGGTGGTTGG - Intronic
956836354 3:73099384-73099406 TGGGTGGGCCTAATTCTGATGGG + Intergenic
959906399 3:111715746-111715768 TCAGAAGGCCAGAGTCTGAGAGG - Intronic
962875380 3:139532150-139532172 TGGGAAGAGCACCTTCTGATAGG - Intronic
963764103 3:149315882-149315904 TGGGAAGGTCAAACTCTGACTGG + Intergenic
968740150 4:2324140-2324162 TGGAAAGTCCAAATTCTGCTGGG + Intronic
971318225 4:25584751-25584773 TGGGAAGACCAGAATCTCCTGGG + Intergenic
973924870 4:55727511-55727533 TTGGAGGGCCAGATTGTGCTAGG - Intergenic
975193095 4:71489634-71489656 TGGGAAGCCCATCTTCTGAGAGG + Intronic
980981657 4:139659333-139659355 TGAGAAGGCCTCACTCTGATGGG - Intergenic
984477001 4:180248090-180248112 TGGGTAGGCCAGATGGTGTTTGG - Intergenic
986691725 5:10318894-10318916 TGGGTTGGCCATATTCTGCTAGG + Intergenic
990175847 5:53107535-53107557 TGGAAAGGCCATGTACTGATTGG - Intronic
991122641 5:63033379-63033401 TGGGAAGGCATGATTGTGTTTGG + Intergenic
992090282 5:73310823-73310845 TCGGAAGGCCAGATCCAGAAGGG + Intergenic
992757944 5:79926610-79926632 TGGAAAGGCCAGAGTCTTCTGGG - Intergenic
993247149 5:85465536-85465558 TGGGAAGGCCAGTTTTTCACAGG + Intergenic
995222587 5:109667663-109667685 GAGGAAGGACAGATTCTGAGAGG + Intergenic
995751013 5:115453362-115453384 TGGGAAGGGCAGAGGCTGTTAGG + Intergenic
997393814 5:133540165-133540187 TGGCAAATCCAGAATCTGATGGG - Intronic
999142292 5:149370554-149370576 AGGGAATGCCACATGCTGATTGG + Intergenic
999848092 5:155507405-155507427 TGAAAAGGACAGATGCTGATGGG - Intergenic
1000900103 5:166902442-166902464 TGAGAAAGCCAGACTCTAATTGG + Intergenic
1002451624 5:179322245-179322267 TGGGAATGCCAAAATCTGATGGG + Intronic
1002665496 5:180820721-180820743 TGGAAAGGCAAGAGTCTGGTAGG + Intergenic
1005107071 6:22235166-22235188 TGGAAAGGGCAAACTCTGATTGG + Intergenic
1005445453 6:25917978-25918000 AGAGAATGCCAGAATCTGATAGG + Intronic
1005650172 6:27878735-27878757 TGGGCAGGCAGGGTTCTGATGGG + Intergenic
1005813738 6:29534069-29534091 TGGGATTGCCAGATGCTGAGAGG - Intergenic
1006673245 6:35743085-35743107 AGGGAAGGGCAGGTACTGATGGG + Intronic
1006840947 6:37027599-37027621 TGGGAAGGCCAGGGCCTGACGGG - Intronic
1010892099 6:81325799-81325821 TGTGTAGGCCAGATTGTGAAGGG - Intergenic
1013071349 6:106732119-106732141 TGGGAAGGGGAGATGTTGATTGG - Intergenic
1015684996 6:135849766-135849788 TGGGAGGGCCAGATTTTGGAAGG - Intergenic
1019602655 7:1893061-1893083 TGGGAAGGCCATACTCTGCCTGG - Intronic
1021720131 7:23496755-23496777 TGATAAGGCAAGACTCTGATTGG - Intergenic
1023867320 7:44244392-44244414 TGGGTAGGCCAGAGCCCGATGGG - Intronic
1024435905 7:49354413-49354435 TGGGATGGCGAGATTGTGAGAGG - Intergenic
1024445291 7:49470649-49470671 TGGGAACCTCTGATTCTGATTGG + Intergenic
1024932806 7:54681289-54681311 AGGGAAGACCAGAACCTGATTGG - Intergenic
1030453407 7:109742725-109742747 TGGTAAGTCCAAAATCTGATGGG + Intergenic
1030461217 7:109839271-109839293 TGGGCAGGCAGGGTTCTGATGGG - Intergenic
1035529365 8:338748-338770 TGGGAAGGTCAGGTCCTGAGCGG + Intergenic
1037782093 8:21876763-21876785 TGGGAAGCACAGTCTCTGATAGG + Intergenic
1038511199 8:28137419-28137441 TGGAAAGGCCAGATGGTGAGGGG + Intronic
1038698816 8:29830378-29830400 TGGCAAGTCCAAATTCTGCTGGG - Intergenic
1040686768 8:49881607-49881629 AGGGAAGCCCAGGTTCAGATGGG - Intergenic
1041178154 8:55219285-55219307 TGGGAAGAGCAGATTCTGAATGG - Intronic
1042875941 8:73440066-73440088 TGGGAAGACCAGATTTTGCTTGG + Intronic
1043413351 8:80022893-80022915 TGGGAAGTCATGAGTCTGATTGG + Intronic
1044226975 8:89730294-89730316 AGGGAAGTCCAGGTTCTGATAGG - Intergenic
1044728412 8:95211421-95211443 TAGGAAGCCAAGATTTTGATAGG - Intergenic
1046088665 8:109470734-109470756 TGGGACAGCCAGTTTCTGAGTGG + Intronic
1047208680 8:122823061-122823083 TGGGAAGGACACATCCTGAGAGG - Intronic
1047650479 8:126914806-126914828 GTGGAAGGCCAGTTTCTGCTGGG + Intergenic
1048580345 8:135725272-135725294 TGGGTAGGGGAGATTCTGGTAGG + Intergenic
1051488094 9:17630540-17630562 TGGGAAGGGCAGAATGTGGTAGG + Intronic
1055909429 9:81330601-81330623 TGGGAAGGGAAGATCCTGGTGGG + Intergenic
1057035810 9:91811127-91811149 TGGGAAGGAAAGATTCGTATGGG - Intronic
1186762924 X:12742057-12742079 TGGGATGACCAGAGTCTGAACGG - Intergenic
1187538395 X:20165426-20165448 TGGAAAGGCCAGGATCTCATGGG - Intronic
1188065586 X:25655761-25655783 TGGCCAGCCCAGATTCTGAGGGG + Intergenic
1188361109 X:29255321-29255343 TGGGGAGGCCTGATTCAGCTAGG - Intronic
1190539424 X:51461869-51461891 TGGGAAGGCCAGGTTTTTCTTGG + Intergenic
1191889560 X:65926310-65926332 TGGGAGGGCCAGTTTTTTATGGG - Intergenic
1192736182 X:73851438-73851460 CGGGAAGGCCACATCATGATGGG - Intergenic
1195713047 X:107790485-107790507 AGGCAAGGCCAGATTGTGAGGGG - Intronic
1196011874 X:110897673-110897695 TGGGAAGGCATGATTGTGTTTGG - Intergenic
1196210445 X:112990187-112990209 AAGGAAGGCCAGATATTGATAGG - Intergenic
1199843627 X:151675171-151675193 GGGAAAGGTCAGATTCTGAAAGG + Intronic