ID: 933264731

View in Genome Browser
Species Human (GRCh38)
Location 2:80169578-80169600
Sequence CCACAGAAACAGATAGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 429
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 402}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933264731_933264739 5 Left 933264731 2:80169578-80169600 CCCTGCTCTATCTGTTTCTGTGG 0: 1
1: 0
2: 1
3: 25
4: 402
Right 933264739 2:80169606-80169628 ACTCTGTGGGTAGGAGGTGTTGG 0: 1
1: 0
2: 3
3: 23
4: 240
933264731_933264735 -8 Left 933264731 2:80169578-80169600 CCCTGCTCTATCTGTTTCTGTGG 0: 1
1: 0
2: 1
3: 25
4: 402
Right 933264735 2:80169593-80169615 TTCTGTGGCCTAAACTCTGTGGG 0: 1
1: 0
2: 1
3: 16
4: 138
933264731_933264736 -4 Left 933264731 2:80169578-80169600 CCCTGCTCTATCTGTTTCTGTGG 0: 1
1: 0
2: 1
3: 25
4: 402
Right 933264736 2:80169597-80169619 GTGGCCTAAACTCTGTGGGTAGG 0: 1
1: 1
2: 0
3: 9
4: 189
933264731_933264742 29 Left 933264731 2:80169578-80169600 CCCTGCTCTATCTGTTTCTGTGG 0: 1
1: 0
2: 1
3: 25
4: 402
Right 933264742 2:80169630-80169652 CTGATGGATGCTTCCTACCTTGG 0: 1
1: 0
2: 0
3: 20
4: 235
933264731_933264740 13 Left 933264731 2:80169578-80169600 CCCTGCTCTATCTGTTTCTGTGG 0: 1
1: 0
2: 1
3: 25
4: 402
Right 933264740 2:80169614-80169636 GGTAGGAGGTGTTGGCCTGATGG 0: 1
1: 0
2: 0
3: 24
4: 374
933264731_933264734 -9 Left 933264731 2:80169578-80169600 CCCTGCTCTATCTGTTTCTGTGG 0: 1
1: 0
2: 1
3: 25
4: 402
Right 933264734 2:80169592-80169614 TTTCTGTGGCCTAAACTCTGTGG 0: 1
1: 0
2: 2
3: 17
4: 208
933264731_933264737 -1 Left 933264731 2:80169578-80169600 CCCTGCTCTATCTGTTTCTGTGG 0: 1
1: 0
2: 1
3: 25
4: 402
Right 933264737 2:80169600-80169622 GCCTAAACTCTGTGGGTAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933264731 Original CRISPR CCACAGAAACAGATAGAGCA GGG (reversed) Intronic
900390079 1:2430004-2430026 ACAGAGAAACAGCTGGAGCATGG + Intronic
900933264 1:5749674-5749696 ACACAGAAACAGAAAGAGATGGG + Intergenic
901062289 1:6477309-6477331 GCACAGCACCAGATAGAGAAAGG + Intronic
902677408 1:18018363-18018385 CCACAGTAACTGATTGAGGAAGG - Intergenic
902853105 1:19177181-19177203 CATCAGACACAGGTAGAGCAGGG + Intronic
903582610 1:24383263-24383285 CAAGAAAAACAGATACAGCAAGG - Intronic
905384339 1:37590461-37590483 GCACAGGAAGGGATAGAGCAAGG + Intronic
905701087 1:40014983-40015005 CCACAGAAGGAGAAAGAGCATGG + Intergenic
906541810 1:46592618-46592640 CAACAGAGACAGGGAGAGCAGGG + Intronic
906712096 1:47938342-47938364 CTCCAGAGACAGATAGAGCTGGG - Intronic
906867453 1:49438007-49438029 CCATAAAAACAGATACAGAAAGG + Intronic
907270436 1:53287961-53287983 CCACACAAAGAGATAGAGACGGG + Intronic
907826763 1:58025134-58025156 CCAGAGAAACAGAAACAGTAGGG - Intronic
909178129 1:72385741-72385763 CCACAGTAACAAAAACAGCATGG - Intergenic
909562870 1:77024991-77025013 CCACAGACAGAGAGAGAGCCTGG - Intronic
911466157 1:98255510-98255532 CTACAGTAACCAATAGAGCATGG + Intergenic
912970379 1:114275784-114275806 CCTCAGAACCAGATACGGCAGGG + Intergenic
913252924 1:116927085-116927107 AAACAGAAGCAGAAAGAGCAAGG + Intronic
913352464 1:117876217-117876239 TCACAGGAACTAATAGAGCAAGG - Intronic
913686878 1:121240682-121240704 CCAGAGGAACAGATAAGGCAAGG - Intronic
914038738 1:144028310-144028332 CCAGAGGAACAGATAAGGCAAGG - Intergenic
914150716 1:145039620-145039642 CCAGAGGAACAGATAAGGCAAGG + Intronic
915108181 1:153547112-153547134 CCAAAGAAAGAGAGAGAGGAAGG + Intronic
917100990 1:171445206-171445228 CCACAAGAACAGATAGGCCAGGG + Intergenic
917364226 1:174211174-174211196 TCACAGAAAAAGACAGAGTATGG + Intronic
919023623 1:192140086-192140108 TCACAGAAATAGATTGAGAATGG - Intergenic
919463380 1:197904268-197904290 CCACAGACAAAGATGAAGCAAGG - Intronic
921253201 1:213316663-213316685 CTACAGAGAAAAATAGAGCAAGG + Intergenic
921318238 1:213912531-213912553 TCACAGAAAGACTTAGAGCATGG - Intergenic
921915589 1:220606902-220606924 CTACAGTAACTGAAAGAGCATGG - Intronic
924608065 1:245552101-245552123 CCAGAGAAACAGAACCAGCAGGG + Intronic
1063361239 10:5460810-5460832 CCAAAGAAACATATTCAGCACGG - Intergenic
1065170993 10:23028904-23028926 CCAAAGAATCAGAAAAAGCAAGG - Intronic
1065841897 10:29709091-29709113 CCACAGAAAAATATGGGGCAGGG + Intronic
1070495938 10:77022477-77022499 CAAAAGAAACAGAGACAGCAAGG - Intronic
1070897883 10:80000709-80000731 CCCCAGAAATAGAAATAGCAAGG + Intergenic
1071363167 10:84871256-84871278 CTACAGAAACCAAAAGAGCATGG + Intergenic
1071876744 10:89850959-89850981 CCACAGAAGCAGGTGGAGCAGGG + Intergenic
1071939176 10:90569144-90569166 CTACAGTAACAAAAAGAGCATGG - Intergenic
1073798569 10:107015344-107015366 ACACACACACAAATAGAGCAGGG + Intronic
1074543552 10:114385501-114385523 CCAGAGAGTCAGATAGAGCTGGG + Intronic
1074642128 10:115398062-115398084 CCACAGAAATTGGTAGAGTATGG + Intronic
1075712862 10:124540148-124540170 GCACAGACACAGAAACAGCACGG - Intronic
1076430827 10:130400921-130400943 CCACATAATGAGACAGAGCAGGG - Intergenic
1077478430 11:2801954-2801976 GCACAGAAAAAGCCAGAGCAGGG + Intronic
1077604249 11:3597185-3597207 CAACAGATAAAGATACAGCATGG + Intergenic
1077873777 11:6285199-6285221 ACACAGAAACAGAGAGAGAGAGG - Intergenic
1078353714 11:10617330-10617352 CCACAAATACAGAAGGAGCAAGG + Intronic
1078465181 11:11544935-11544957 CCTCGGAACCAGGTAGAGCAGGG - Intronic
1078669963 11:13355893-13355915 CCACAGGAAAGGAGAGAGCATGG - Intronic
1079032094 11:16993453-16993475 CCACAGGAACTGAGAGAGCTGGG - Intronic
1079373862 11:19874339-19874361 CCACAGGAAGAGAAAGAACAGGG + Intronic
1079559918 11:21809207-21809229 CCACAGAAAAACATAGAGTCAGG - Intergenic
1080841228 11:35985263-35985285 CCACAGAACCAGACAGTGGAAGG - Intronic
1081040329 11:38201868-38201890 CACCAGAAACAGACAAAGCAAGG + Intergenic
1081325851 11:41743511-41743533 CTACAGTAACGGAAAGAGCATGG + Intergenic
1082897167 11:58204338-58204360 CCACAGAAAAAGACAGGACATGG + Intergenic
1083695126 11:64437522-64437544 GCAGAGAGACAGAAAGAGCATGG + Intergenic
1084812620 11:71623475-71623497 CAACAGATAAGGATAGAGCATGG - Intergenic
1085655090 11:78306886-78306908 TCACAGAAAGAGATAAAGTAAGG + Intronic
1086802290 11:91192202-91192224 CCATAGCATCAGAGAGAGCAGGG - Intergenic
1087149411 11:94845192-94845214 TCACAGAAACAGTTTCAGCAGGG + Intronic
1087459412 11:98425829-98425851 CCACAGAAACAGAGAGTATAAGG - Intergenic
1089109788 11:116046332-116046354 ACACAGAAACAGAAACAGCCAGG + Intergenic
1089941570 11:122423360-122423382 CCAAAGAAAAACATAGGGCAAGG + Intergenic
1090400203 11:126443984-126444006 CCAAAGCACCAGATAGGGCAGGG + Intronic
1090703339 11:129315426-129315448 TCACAGGGACAGATGGAGCAGGG + Intergenic
1090948160 11:131449642-131449664 CCACAAGAACAGAGAGAGCACGG - Intronic
1091944291 12:4521449-4521471 CAACAGAAACAGATTTAGAAAGG + Intronic
1092052123 12:5479386-5479408 TCACAGATACTGATACAGCATGG + Intronic
1092173495 12:6387905-6387927 CCACAGGTACAGGTACAGCAGGG + Intronic
1093651249 12:21648171-21648193 CCATAAAAACAGTAAGAGCAAGG - Intronic
1093682279 12:22016449-22016471 CCACAGAAAGAGTAAGAGGATGG + Intergenic
1093695196 12:22151316-22151338 CCACAGTAACAAAAACAGCATGG + Intronic
1094672696 12:32586527-32586549 CCTCAGAAACAATTAAAGCATGG + Intronic
1095215800 12:39545868-39545890 CCAAAGAAGCAGAAAGAGGAAGG + Intergenic
1095423913 12:42054517-42054539 TCACAGAAACACATGGAGCCGGG - Intergenic
1096507269 12:52102012-52102034 CAACAGATAAAGATACAGCATGG - Intergenic
1096559527 12:52425573-52425595 TCACAGAAACAGAGAGTGGAGGG + Intronic
1096564378 12:52465396-52465418 CCACAGAAAATGATAAAGCAGGG + Intergenic
1097078693 12:56413542-56413564 CCACAGAACCAGGGAGAGCCAGG - Intergenic
1099098842 12:78411130-78411152 CCACAGAAACATGTAGAGCTTGG + Intergenic
1100761152 12:97808971-97808993 CTACAGTAACAAAAAGAGCATGG + Intergenic
1102457988 12:113082572-113082594 ACACAGAAACAAAGAGACCAGGG - Intronic
1102688746 12:114744075-114744097 CCAAAGAAACAGATATTGGAGGG - Intergenic
1102739112 12:115190481-115190503 CCACAGAGAGAGAGAAAGCAAGG + Intergenic
1103126815 12:118430558-118430580 CTACAGAAAAAAATACAGCATGG - Intergenic
1103403550 12:120659372-120659394 CCAATGAAACAGGAAGAGCAGGG - Intronic
1103707229 12:122883344-122883366 CCACAGAAACACAAAAAGCTAGG + Intronic
1104226028 12:126834293-126834315 CCACAGTAACAAAAACAGCATGG - Intergenic
1105226928 13:18444299-18444321 CTACAGTAACCGAAAGAGCATGG + Intergenic
1105895501 13:24714361-24714383 GCCCAGAACAAGATAGAGCATGG + Intergenic
1105975109 13:25466668-25466690 CCACAGAATCTGAGAGGGCAGGG + Intronic
1106139400 13:26998995-26999017 CCAGGAAAACAGAAAGAGCAGGG + Intergenic
1106216320 13:27704142-27704164 CCACACAGAAAGCTAGAGCAGGG + Intergenic
1106875945 13:34072932-34072954 CCACATAAACAGAATTAGCATGG - Intergenic
1107742919 13:43472556-43472578 CCACAGCAATAAATAGAGTAGGG + Intronic
1108089644 13:46835152-46835174 CCAAACAAACACATTGAGCAGGG + Exonic
1109859368 13:68177684-68177706 ACACAGAAAGAGATAGAGAGTGG - Intergenic
1110282758 13:73714530-73714552 CCAAAGAAGCCGATAGAGCAGGG - Intronic
1111065971 13:83091774-83091796 CCACAGACACAAAAACAGCATGG + Intergenic
1111546390 13:89742426-89742448 CTACAGAAACACATAGACTAGGG + Intergenic
1111815922 13:93152469-93152491 GCACAGAGAGAGACAGAGCAAGG - Intergenic
1112263157 13:97896870-97896892 CCACAGATACATCTAGTGCATGG - Intergenic
1113890391 13:113732341-113732363 CCACAGACACAGAGTGACCACGG - Intronic
1114058311 14:18995507-18995529 CCACAGTAACAGAAACAGCGTGG - Intronic
1114104235 14:19406247-19406269 CCACAGTAACAGAAACAGCGTGG + Intronic
1114261452 14:21039529-21039551 CAACAGAAAAAGATGGAGGAAGG - Intronic
1114545379 14:23496542-23496564 CCACAGAGAAAAATAAAGCAGGG - Intronic
1114797951 14:25738505-25738527 CCACAGTAACCCAAAGAGCATGG + Intergenic
1116919714 14:50560346-50560368 CCACAGAAGCAGAAAGTGGAGGG - Intronic
1119211630 14:72836365-72836387 CCAGAGAAACTGTCAGAGCAGGG + Intronic
1119895177 14:78214004-78214026 CCACAGGAACAGACACATCAGGG - Intergenic
1120062920 14:80005591-80005613 CCACAGATACATAAATAGCAAGG + Intergenic
1120955131 14:90075355-90075377 CCAGAGAAAAAGATACAACAAGG - Intronic
1121211961 14:92213968-92213990 CCACAGAGACCGGCAGAGCATGG - Intergenic
1121628880 14:95408323-95408345 ACACAGAAAGAGAGAGAGAAAGG + Intronic
1121688399 14:95856719-95856741 CCACAGAAGCAGAGAGAGATTGG - Intergenic
1122275794 14:100590162-100590184 CCACAAGAACAGATTGAGCAAGG + Intergenic
1122317440 14:100834554-100834576 CAACAGAAGCAGAAAAAGCAGGG - Intergenic
1122356164 14:101124257-101124279 CAACAGAAACATCTAGGGCAGGG - Intergenic
1124065907 15:26343505-26343527 CCAGAAAAACAGTCAGAGCAGGG - Intergenic
1124883782 15:33665274-33665296 CTAAAGAAACAGATACAGAAAGG - Intronic
1125695543 15:41634108-41634130 CTACAGAAAAAAATAAAGCAGGG - Intronic
1126611355 15:50532651-50532673 CATCAGAACCAGATAGCGCAGGG + Intronic
1127337807 15:58007141-58007163 CAACAGAAACACATAAATCAAGG + Intronic
1127639280 15:60900473-60900495 CCTCAGAGTCAGATAGAGCTGGG + Intronic
1127764605 15:62172862-62172884 CCAGAGATACAGATATAGGAGGG - Intergenic
1129290233 15:74560800-74560822 CCACAGAAATACATATACCAGGG - Intronic
1129899406 15:79134642-79134664 CCACAGAAACTGGTAGATAAGGG - Intergenic
1131397612 15:92098933-92098955 CCACAGCTAGGGATAGAGCAGGG + Intronic
1133415988 16:5607386-5607408 CCTCAGGCACAGATAGCGCAGGG + Intergenic
1133735370 16:8610994-8611016 CCACAGAATCAGACTGAGGATGG + Intergenic
1134686691 16:16163896-16163918 CCACAGTAAGTGATAGAGCCTGG + Intronic
1135328148 16:21540777-21540799 CCACAGAGACAGAAGCAGCACGG - Intergenic
1135859938 16:26047036-26047058 GCACAGAAACAGGTAAATCAAGG - Intronic
1136338501 16:29626797-29626819 CCACAGAGACAGAAGCAGCACGG - Intergenic
1136599298 16:31273812-31273834 CCTCAGAAACAGAGAGAGCCTGG - Intronic
1137872890 16:51967650-51967672 ACACACAAACAGATGGAGAAAGG - Intergenic
1138368297 16:56501664-56501686 CCACAGGGCCAGATAGAGCAAGG - Intronic
1139835488 16:69835012-69835034 GCACGGATGCAGATAGAGCAGGG + Intronic
1142041238 16:87895711-87895733 CCACAGAGACAGAAGCAGCAGGG - Intronic
1144624417 17:16837547-16837569 GCAGAGAAACAGAGGGAGCAGGG + Intergenic
1144882010 17:18435173-18435195 GCAGAGAAACAGAGGGAGCAGGG - Intergenic
1145150223 17:20509213-20509235 GCAGAGAAACAGAGGGAGCAGGG + Intergenic
1146696468 17:34912348-34912370 GAAGAGAAGCAGATAGAGCAAGG + Intergenic
1146907749 17:36628972-36628994 CCCATGAAACAGATTGAGCAAGG + Intergenic
1147186729 17:38717078-38717100 CCACTCCAAAAGATAGAGCACGG + Intronic
1147578550 17:41616268-41616290 GCAGAGAAACAGAGAGAGCAGGG + Intergenic
1148488083 17:48004061-48004083 GCACAGAACAAGACAGAGCACGG - Intergenic
1148843106 17:50511745-50511767 CCAAAGAACCAGAAAGAGCTGGG + Intronic
1149093940 17:52817722-52817744 ACACATAAACAGAAAAAGCACGG - Intergenic
1149440816 17:56672198-56672220 CGACAGAAAGAGAGAGAACAGGG - Intergenic
1150613511 17:66751855-66751877 CCAGAGCAAGAGAGAGAGCAGGG + Intronic
1150997699 17:70338111-70338133 CCACAGCAATAGATAAGGCAGGG - Intergenic
1151033989 17:70776976-70776998 CCACAGAAATAAATAGAGTCAGG - Intergenic
1152500908 17:80708510-80708532 CCACAGCAACAGCTACAGAAGGG - Intronic
1152504452 17:80738355-80738377 CCACAGAAAGGGATGGTGCATGG - Intronic
1152563014 17:81087973-81087995 TCACAGAAACAGCTTGAGGACGG - Intronic
1155198637 18:23498692-23498714 CAACAGAAAGAGATAGCTCATGG + Intergenic
1155411101 18:25546128-25546150 CTAAAGAAAGAGATAGAGCTGGG + Intergenic
1156627144 18:38922837-38922859 CCCAATAAACAGAAAGAGCATGG - Intergenic
1156919213 18:42500026-42500048 CCACAGTAACAAAAACAGCATGG + Intergenic
1157202628 18:45672006-45672028 CCCCAGAGATAGATGGAGCACGG + Intronic
1157311883 18:46559198-46559220 CCACAGGAACAAACAGAGAATGG - Exonic
1158232757 18:55277174-55277196 CCACAGAAACAGTTGCATCATGG - Intronic
1158251987 18:55499501-55499523 CTACATAAACAGATGGAGCTAGG - Intronic
1158489409 18:57896379-57896401 CAAGAGAAAGAGATAGAGAAGGG + Intergenic
1159697081 18:71574005-71574027 CTACAGTAACAAAAAGAGCATGG - Intergenic
1160850512 19:1189380-1189402 ACAAAGAACCACATAGAGCAGGG - Intronic
1163361323 19:16847935-16847957 CCACAGAAACAGGAAGCACATGG - Intronic
1164563861 19:29312107-29312129 CCACAGAGAGAAATAAAGCATGG + Intergenic
1166136596 19:40780883-40780905 ACACCGAAACAGAAAGAGAAGGG + Intronic
1166184336 19:41129799-41129821 ACACAGAAACAGGCAGAGCTGGG + Intergenic
1166399227 19:42465797-42465819 CCAAAGAAAGAAAGAGAGCACGG - Intergenic
1167858828 19:52266654-52266676 CCACAGAAACAGAGAGATACAGG - Intergenic
1168136145 19:54353232-54353254 GGACAGAGACAGACAGAGCAGGG + Exonic
1168136686 19:54356490-54356512 CGCCAGAATCAGATAAAGCAGGG - Exonic
1168161362 19:54512503-54512525 ACACACACACAGAGAGAGCAGGG - Intergenic
1168691270 19:58379054-58379076 CCACAGAAACTAATAGAGACTGG + Intronic
926013953 2:9431967-9431989 TCACAGTAAGAGACAGAGCAAGG + Intronic
926410936 2:12601939-12601961 ACACAGAAACAGAAAGAGTGAGG - Intergenic
926708591 2:15856691-15856713 GCACAGAGACAAATAGGGCATGG + Intergenic
927405733 2:22764264-22764286 TCACAGAAGCAGAGAGAGAATGG - Intergenic
928572996 2:32627394-32627416 CCAAAGAAACAGTTAGAGGGCGG - Intergenic
928581796 2:32715453-32715475 CCACAGAAACAAAAATAGCATGG - Intronic
928765690 2:34642501-34642523 AAACAGAAACAGAAAGAGAAAGG + Intergenic
928818314 2:35325720-35325742 ACACAGAATCAGCTAAAGCAGGG - Intergenic
929120648 2:38481372-38481394 CAAGAAAAACAGATAGAGGAAGG + Intergenic
931090592 2:58881996-58882018 CCACATCACCAAATAGAGCAAGG + Intergenic
931143900 2:59495119-59495141 CCACAGTAACCAAAAGAGCATGG - Intergenic
933264731 2:80169578-80169600 CCACAGAAACAGATAGAGCAGGG - Intronic
933794927 2:85911929-85911951 CTACAGAAAAAAAAAGAGCATGG - Intergenic
934105859 2:88693864-88693886 CCACAGAAACAGACAGAGCTGGG - Intronic
934721775 2:96583194-96583216 CCACAGAATCAGACAGATAATGG - Intergenic
934791590 2:97066984-97067006 GGACAGGCACAGATAGAGCAAGG + Intergenic
935100837 2:99994342-99994364 CCAAAGAAACAGAAAGAGAGAGG + Intronic
935328002 2:101955275-101955297 ACACAGAGAGAGAGAGAGCAAGG - Intergenic
935438302 2:103061006-103061028 CCACAGTAACAAAAACAGCATGG + Intergenic
936013131 2:108938127-108938149 CCACAGAGGCAGGAAGAGCATGG + Intronic
936634161 2:114236285-114236307 CCAAAGAGACAGAGAGAGGAAGG + Intergenic
937211854 2:120278832-120278854 GCACAGAAACAGCGGGAGCAGGG - Intronic
938281811 2:130068737-130068759 CCACAGTAACGGAAACAGCATGG - Intergenic
938332430 2:130457292-130457314 CCACAGTAACGGAAACAGCATGG - Intergenic
938357377 2:130663376-130663398 CCACAGTAACGGAAACAGCATGG + Intergenic
938432722 2:131260196-131260218 CCACAGTAACAGAAACAGCGTGG - Intronic
938433808 2:131270163-131270185 CCACAGTAACGGAAACAGCATGG + Intronic
938525553 2:132126538-132126560 CTACAGTAACCGAAAGAGCATGG - Intergenic
939114027 2:138040157-138040179 CCACAGAAACAGAAAGGACAAGG - Intergenic
943221266 2:185109448-185109470 CTACAGTAACAGAAATAGCATGG + Intergenic
943270072 2:185789127-185789149 CCACTGAAACAGATAGCTTAGGG + Exonic
943273078 2:185832303-185832325 CAACAGCAGCAGATTGAGCAGGG + Intronic
945533074 2:210980162-210980184 CCACAGTAACAAAAACAGCATGG - Intergenic
946319929 2:218947017-218947039 CCAGAGAAAAAAATGGAGCAGGG + Intergenic
947431790 2:230035524-230035546 ACACAGAGAGAGATAGAGGAGGG + Exonic
1168999112 20:2154129-2154151 CCACAGAAAAAGCTAGAGCTTGG + Intronic
1169017428 20:2303352-2303374 CCACAGAGACAGAAAGAGTTGGG + Intronic
1169523995 20:6403103-6403125 GCACAGAACCAGAGAGAGAAGGG - Intergenic
1169529450 20:6468627-6468649 CCACAGAAGCATAAATAGCATGG + Intergenic
1174694268 20:52541616-52541638 TCACAGAAACAGATGATGCATGG - Intergenic
1174831558 20:53817805-53817827 CCAAAGACACACATAGAGCTGGG - Intergenic
1176770977 21:13073321-13073343 CTACAGTAACCGAAAGAGCATGG + Intergenic
1176945051 21:14969827-14969849 CCAAAGAAAAAGATACAGAAAGG + Intronic
1177347660 21:19894371-19894393 ACAGAGAGACAGAGAGAGCATGG - Intergenic
1178749932 21:35292516-35292538 AAACAGAAAAAAATAGAGCAGGG + Intronic
1179086939 21:38226479-38226501 CCACCCAAACAGAAAAAGCACGG - Intronic
1179166372 21:38938321-38938343 TCACAGAGACAGAAAGAGGAGGG - Intergenic
1180476799 22:15718126-15718148 CCACAGTAACAGAAACAGCGTGG - Intronic
1182256355 22:29041626-29041648 CCACAGAGACTGATTGAGCAGGG - Intronic
1182483653 22:30626437-30626459 CTGCAGAAACAGATTGAGCAAGG - Intronic
1182711782 22:32327796-32327818 CCACGGACACAGATGCAGCAAGG + Intergenic
1183354941 22:37353204-37353226 CCGCAGAACCAGATAGAGCTGGG - Intergenic
1184379433 22:44135868-44135890 ACACAGAAACAGACAGAGGGAGG - Intronic
1184432796 22:44451295-44451317 CCCCAGAAACAGCGAGACCATGG + Intergenic
949988336 3:9557008-9557030 CCTCTGAAAGAGAGAGAGCAGGG + Intergenic
951084005 3:18489381-18489403 GCACAGAAACAAATAGGGGAAGG + Intergenic
951928986 3:27942441-27942463 CCACAGGATCAGGAAGAGCAAGG - Intergenic
953227271 3:41032354-41032376 CCACACTACAAGATAGAGCAGGG + Intergenic
953784613 3:45901727-45901749 CCACAAAAACATAGAGAACAGGG - Exonic
953890643 3:46749760-46749782 CCACAGAAAATGAAAGAGGAGGG + Intronic
954413700 3:50382517-50382539 CCACAGGAACAGACAGCGAAGGG - Intronic
959286208 3:104414500-104414522 CCATAGAAACTCATAGAGCTGGG + Intergenic
959369781 3:105508905-105508927 ACACAGAAACAGAGAGTGGATGG - Intronic
959652461 3:108764178-108764200 CCGCAGAAACTGCTAGAGGAGGG + Intergenic
959721238 3:109491780-109491802 CCACAGAAACAGAAATGGTAGGG + Intergenic
960359970 3:116699135-116699157 CCACAGTAACCAATACAGCATGG + Intronic
960524277 3:118691857-118691879 CCACAGAGAGACAGAGAGCATGG - Intergenic
960814421 3:121658305-121658327 CCACGGAAACAGACACATCATGG + Exonic
961034379 3:123632226-123632248 TCACAGAGACAGAGAGAGCTGGG - Intronic
961451366 3:127003759-127003781 CCACAGAAACAGATGTATGAAGG + Intronic
965926674 3:173988919-173988941 CAACAGAAAAAGAGAGAACAAGG - Intronic
967106288 3:186257295-186257317 CCACAGATCCAGGTAGAGCTGGG + Intronic
969018692 4:4123843-4123865 CAACAGATAAAGATACAGCATGG + Intergenic
969139467 4:5055858-5055880 CCACAAAAAAAAATAAAGCAAGG - Intronic
970030730 4:11671398-11671420 CCACAGGAACACAAAGAGAAAGG + Intergenic
970701756 4:18749798-18749820 CCACTGAAACAGCTCTAGCAAGG + Intergenic
971737880 4:30480533-30480555 CTACAGTAACAGAAACAGCATGG - Intergenic
971935293 4:33139705-33139727 CCACAGAAAGCTATTGAGCATGG + Intergenic
972370058 4:38414851-38414873 CCACTAAAAAAGAAAGAGCAAGG + Intergenic
973635423 4:52857731-52857753 CCACAGAGAGAGAGAAAGCAGGG - Intergenic
974125076 4:57686111-57686133 CCAGATAAGCAGATAGTGCAGGG - Intergenic
975613589 4:76224377-76224399 CCACAGAAATGGAGAGAGGAGGG + Intronic
976716656 4:88130120-88130142 AAACTGAAACATATAGAGCAGGG + Intronic
977475292 4:97499786-97499808 CAGCAGAAACAGCTAGTGCAAGG + Intronic
977552861 4:98460392-98460414 CCACTGAGACATTTAGAGCAAGG - Intergenic
977871459 4:102095362-102095384 CCAAACAAACACATAGATCATGG + Intergenic
978073105 4:104494978-104495000 ACACACAAACAGAGAGAGAAGGG - Intergenic
978230818 4:106396333-106396355 CCAGAGAAAGAGAGAGAGAAAGG - Intergenic
980157196 4:129121920-129121942 CCACAGTAACTGAAACAGCATGG - Intergenic
980452763 4:132997003-132997025 CTTCAGAAACACATAAAGCAAGG - Intergenic
982092651 4:151893763-151893785 AGACAGAAACAGAGAGAGAAAGG - Intergenic
982802078 4:159718137-159718159 CCACACCAACAGGTAGAGCAAGG + Intergenic
983171114 4:164537628-164537650 CCACAGAAAAAGTTAGAGGTGGG + Intergenic
983721907 4:170865689-170865711 CCTCAGAAACACAGGGAGCAAGG - Intergenic
983835629 4:172380058-172380080 CCATATAAACAGCTAGAGCAGGG - Intronic
983987594 4:174078997-174079019 CAAAAGAAACAGCTAGAGCGAGG - Intergenic
984325485 4:178244573-178244595 CCACAGTAACCGAAACAGCATGG - Intergenic
985724659 5:1509618-1509640 CCACAGACACAAACCGAGCAAGG + Intronic
985857005 5:2436236-2436258 CCACAGAGACATAGAGACCATGG - Intergenic
987859916 5:23471388-23471410 CCATAGAAACAGACAGAGAGTGG - Intergenic
989005204 5:36802358-36802380 TCACATAAAGAGATAAAGCAAGG - Intergenic
989468512 5:41786241-41786263 CCACACACACAGAGAGAGGAAGG + Intronic
989499779 5:42152018-42152040 ACAGAAGAACAGATAGAGCAAGG - Intergenic
989639751 5:43571503-43571525 TTACAGAAACAGATAGACAAAGG + Intergenic
989971753 5:50533596-50533618 CCACAGTAACAAAAACAGCATGG + Intergenic
990087089 5:51992472-51992494 CCATAGAAACAGAAAGGGCCGGG + Intergenic
990889634 5:60633888-60633910 CCTCAGAAATAGATAGTACAGGG + Intronic
991058190 5:62342517-62342539 CCACAGCCAGTGATAGAGCATGG + Intronic
992540829 5:77761977-77761999 CCACAGAAACTGATTCTGCATGG - Intronic
993197939 5:84774518-84774540 CAAGAGGAACAGTTAGAGCAGGG + Intergenic
993403115 5:87477310-87477332 CTACAGTAACAAATACAGCATGG + Intergenic
993414640 5:87611620-87611642 CCACAGCAACAGAAAGAAAATGG - Intergenic
993897586 5:93556109-93556131 CTACAGAAGCAGAAAGAACATGG - Intergenic
995121357 5:108539091-108539113 CCACTGAGACAGAAATAGCAGGG - Intergenic
995537946 5:113156247-113156269 TCACAGAATCAGATAAAGCTGGG + Intronic
999694811 5:154179423-154179445 CAACAGGAAAACATAGAGCAAGG + Intronic
1000663011 5:163959452-163959474 CCAAAGAATCAGATTCAGCATGG - Intergenic
1000925162 5:167185142-167185164 CCAGAGAAACAGAAACAGTAGGG - Intergenic
1001714072 5:173800553-173800575 CCACAGGGACTGAGAGAGCAAGG - Intergenic
1001931899 5:175679080-175679102 CCACAGAAAGAGGTAGAACTTGG - Intronic
1001979972 5:176031322-176031344 CCAAGGAAACAGTCAGAGCAGGG + Intronic
1002237410 5:177812341-177812363 CCAAGGAAACAGTCAGAGCAGGG - Intergenic
1002769907 6:281910-281932 CCACAGATACAGCTTGATCATGG - Intergenic
1002795712 6:469706-469728 ACACAGAGACAGAGAGAGGAGGG - Intergenic
1003249185 6:4410497-4410519 CCACAGTAACAAAAACAGCATGG + Intergenic
1003496478 6:6668023-6668045 CCACTGTGACAGATACAGCAAGG - Intergenic
1003511074 6:6781088-6781110 CCACAGAATCAGGCCGAGCACGG - Intergenic
1005143165 6:22657536-22657558 CCACAGTACATGATAGAGCAGGG + Intergenic
1008873287 6:56298400-56298422 TCACTGAAACAGTAAGAGCAGGG + Intronic
1009783101 6:68295637-68295659 CTACAGAAACAAAAACAGCATGG + Intergenic
1010406044 6:75506828-75506850 CCACAGTAACCAAAAGAGCATGG + Intergenic
1010415903 6:75611161-75611183 CCACAGAAGCAGAGTCAGCAGGG - Intronic
1011974187 6:93273333-93273355 TTACAGAATGAGATAGAGCATGG - Intronic
1014119204 6:117703525-117703547 ACACAGAAACACACAGATCATGG - Intronic
1014767490 6:125423516-125423538 CCTCAGAAACTGATAGAAAATGG - Intergenic
1015488184 6:133795545-133795567 CTACAGTAACAGAAACAGCATGG - Intergenic
1016167790 6:140969189-140969211 ACACAGAGACAGAGAGAGAAAGG + Intergenic
1016474570 6:144413045-144413067 ACAAAGAAACAGATACAGCAGGG - Intronic
1016527364 6:145017283-145017305 GCACAGACACAGACAGGGCAAGG - Intergenic
1017422580 6:154288118-154288140 CTACAGAAAAAGAAAGAGAAGGG + Intronic
1017680028 6:156854233-156854255 CCAGAAAAACAGAAAGAGGAGGG - Intronic
1017978825 6:159380737-159380759 CCAGAGAAAGAGAGAGAGCCTGG - Intergenic
1018279034 6:162164562-162164584 CCACAGTAACATATAGATTAGGG - Intronic
1018990765 6:168671689-168671711 CCACAGAAGCAGAGGGACCAGGG - Intronic
1019011204 6:168844818-168844840 CAACAGAACCAGATAGAGAGAGG - Intergenic
1019265175 7:111115-111137 CGAAAGAAACAGAAGGAGCATGG - Intergenic
1019311686 7:365005-365027 CTGCAGAAACAGAAAGTGCAGGG - Intergenic
1019705058 7:2493654-2493676 GAACAGAAACAGAGAGAGCAGGG - Intergenic
1020669399 7:11087723-11087745 CCACACACACAGATGAAGCATGG - Intronic
1021428784 7:20535928-20535950 ACACAGAAAGAGAGAGAGAAGGG - Intergenic
1021877721 7:25064223-25064245 CCACAAAAATAAATAAAGCAGGG + Intergenic
1022218428 7:28288592-28288614 CTATAGAAACAGACAGATCAAGG + Intergenic
1023079875 7:36516443-36516465 CCACACACACAGAAAGTGCACGG + Intronic
1023408450 7:39862256-39862278 CCACAGTAACAAAAACAGCATGG - Intergenic
1024818402 7:53297920-53297942 CCTGACAAACTGATAGAGCAGGG + Intergenic
1025137415 7:56430278-56430300 CCACAGTAACAAAAACAGCATGG + Intergenic
1025947231 7:66114073-66114095 CCACGAAAACAGACAGAGCCCGG + Intronic
1027221539 7:76217240-76217262 ACACACACACAGAAAGAGCACGG + Intronic
1027344741 7:77246312-77246334 CCACAGAAGTAGAAACAGCATGG - Intronic
1027792096 7:82647178-82647200 CTACAGTAACAAATACAGCATGG + Intergenic
1028337669 7:89677631-89677653 CTACAGAAACCAAAAGAGCAGGG + Intergenic
1030161918 7:106518011-106518033 CCACAGAAACAGCTTTTGCAAGG + Intergenic
1030496938 7:110312076-110312098 CAACAGCAAGAGAGAGAGCAAGG - Intergenic
1030531206 7:110713289-110713311 CCACAGTAACCAAAAGAGCATGG - Intronic
1030623402 7:111816882-111816904 GCACAGAATCAGCTAAAGCAGGG + Intronic
1031302896 7:120085964-120085986 CCAGAGAAACAGAAAGGGAATGG + Intergenic
1032062245 7:128734866-128734888 CCACAGAAAGAGAATGAGCTTGG + Intergenic
1034234626 7:149557100-149557122 CCCCAGAAACAGATGGGGAATGG + Intergenic
1034239406 7:149598332-149598354 CCCCAGAAACAGATGGGGAATGG + Intergenic
1034852758 7:154510968-154510990 ACACAGAGAGAGAGAGAGCAAGG + Intronic
1035372435 7:158388023-158388045 CCAGAGAAACAGACTCAGCAGGG - Intronic
1035395220 7:158530519-158530541 CGACTTAAACACATAGAGCAAGG + Intronic
1036753039 8:11455267-11455289 CCCCAGACACACACAGAGCAAGG - Intronic
1037388706 8:18369600-18369622 CCACAGTAACCAAAAGAGCATGG + Intergenic
1037568456 8:20137833-20137855 CAACAGCAAAATATAGAGCAAGG + Intergenic
1038495277 8:27997242-27997264 CCACAGATAAAGAAATAGCAAGG - Intergenic
1039393200 8:37199368-37199390 TCCCAGAAACAAATAGATCAAGG + Intergenic
1039781297 8:40788950-40788972 CTACAGAAAGAGAGAGAGGAAGG + Intronic
1040445827 8:47492399-47492421 CCCAAGAAACAGATAAACCATGG + Intronic
1040784100 8:51145305-51145327 CTACAGTAACAAAAAGAGCATGG + Intergenic
1046050436 8:109015196-109015218 CAAAAGAAACAGTAAGAGCATGG + Intergenic
1046228248 8:111315719-111315741 TCACAGAAACAGAAAAGGCAAGG + Intergenic
1048125523 8:131630833-131630855 ACACAGTAACTGACAGAGCAGGG - Intergenic
1049567587 8:143349170-143349192 ACACACAAACAGAGAGAGAACGG + Intronic
1050392020 9:5154083-5154105 CTACAGTAACAGAAACAGCATGG + Intronic
1050451147 9:5782581-5782603 CCACAGTAACAAAAACAGCATGG + Intronic
1050970649 9:11868449-11868471 CCAAAGAAACAGAAATAGAATGG + Intergenic
1052268735 9:26604466-26604488 CCTCAGAAACAGACAGTGCAAGG + Intergenic
1053273952 9:36769524-36769546 ACACAGAAAGAGACGGAGCATGG - Intergenic
1054708464 9:68486467-68486489 CCATAGAGACAGAAAGATCAGGG - Intronic
1056035095 9:82595866-82595888 CCACAGAAAAAGATCGGCCATGG + Intergenic
1058840307 9:108900983-108901005 ACACAGAGATAGATAGGGCATGG + Intronic
1059058252 9:111007054-111007076 CCACTGAAAGAGAGAGAGAAAGG - Intronic
1059264378 9:113012155-113012177 CCACCGAAAAATAAAGAGCACGG + Intergenic
1060006099 9:120001178-120001200 TAATAGAAACAGAAAGAGCATGG - Intergenic
1060933279 9:127502315-127502337 CCACAGAAACAGAACAGGCACGG - Intronic
1185521655 X:744707-744729 CCAGAGAAACAGATTCAACAGGG - Intergenic
1185522645 X:752997-753019 CCAGAGAAACAGATTCAACAGGG - Intergenic
1185721862 X:2388674-2388696 ACACAGACACAGACAGAGGAAGG + Intronic
1186306415 X:8264562-8264584 CCAGAGAAACAGAATGAACAGGG - Intergenic
1186398360 X:9233524-9233546 CCCTAGAAAAAGACAGAGCAGGG - Intergenic
1187588656 X:20691601-20691623 TGACAGAAAGAGAAAGAGCATGG - Intergenic
1188721770 X:33530826-33530848 GCATAGAAACAGACAGAGAAAGG - Intergenic
1188808284 X:34618986-34619008 CCACAGAGAAAGAAATAGCAAGG - Intergenic
1189296715 X:39923626-39923648 CCACATAAACAGAAAGACCCTGG + Intergenic
1189921100 X:45903992-45904014 CCACAAAAACAGAGGGAGAAGGG + Intergenic
1189936616 X:46075937-46075959 CTACAGAAACAAAAACAGCATGG - Intergenic
1190341794 X:49303012-49303034 CCACAGCAGCAGAAAGTGCAGGG - Intergenic
1190640697 X:52481203-52481225 CTACAGAAAATGATGGAGCAGGG + Intergenic
1190646975 X:52531662-52531684 CTACAGAAAATGATGGAGCAGGG - Intergenic
1190975975 X:55401281-55401303 CCACAGTAACCAAAAGAGCATGG + Intergenic
1191749429 X:64525760-64525782 CTACAGAAACAAACAGAGCATGG + Intergenic
1192078723 X:68026476-68026498 CCAAAGAAAGGGATAGAGAAAGG - Intergenic
1192317278 X:70062806-70062828 CCACAGAAAGAGAGAAAGAATGG + Exonic
1194523531 X:94947417-94947439 CCACAGTAACCAAAAGAGCATGG + Intergenic
1194653816 X:96547226-96547248 GCACAGAAAAAAATAAAGCAAGG - Intergenic
1195260125 X:103123646-103123668 CCACACAAACTGATGGAGCCCGG + Intergenic
1195811975 X:108844185-108844207 CCACAGTAACCAAAAGAGCATGG - Intergenic
1195898974 X:109777859-109777881 CCAGAGATCCAGACAGAGCATGG + Intergenic
1196053986 X:111335323-111335345 CCACAGGAAGATATAGAGGAAGG - Intronic
1197123865 X:122921769-122921791 CTACAGTAACAGAAACAGCATGG - Intergenic
1197552066 X:127903234-127903256 TGACAGTAACAGATAGATCATGG + Intergenic
1197844069 X:130782389-130782411 CCACAGAAAGAGATAAAACCAGG + Intronic
1199107258 X:143884510-143884532 CCATTGAAACAGCTAGAGCATGG + Intergenic
1200641854 Y:5730001-5730023 CTACAGTAACAAAAAGAGCACGG - Intronic
1200700790 Y:6400651-6400673 CCACAGAAAAATAAAGAACATGG + Intergenic
1200709789 Y:6473104-6473126 CCACAGAAAAATAAAGAACACGG + Intergenic
1200910234 Y:8525402-8525424 CCACAGAAAAATAAAGAACATGG - Intergenic
1200915708 Y:8569470-8569492 CCACAGAAAAATAAAGAACATGG - Intergenic
1200924908 Y:8645724-8645746 CCACAGAAAAATAAAGAACATGG - Intergenic
1200926445 Y:8659140-8659162 CCACAGAAAAATAAAGAACATGG - Intergenic
1200928054 Y:8672229-8672251 CCACAGAAAAATAAAGAACACGG - Intergenic
1200929607 Y:8685179-8685201 CCACAGAAACATAAAGAACAGGG + Intergenic
1200930851 Y:8695793-8695815 CTACAGAAAAAGAGAGAACACGG + Intergenic
1200933860 Y:8721374-8721396 CCACAGAAAAATAAAGAACATGG + Intergenic
1200937472 Y:8750818-8750840 CCACAGAAAAATAAAGAACAAGG + Intergenic
1201024323 Y:9691604-9691626 CCACAGAAAAATAAAGAACACGG - Intergenic
1201033322 Y:9764047-9764069 CCACAGAAAAATAAAGAACATGG - Intergenic
1201038411 Y:9805634-9805656 CCACAGAAACATAAAGAACAGGG - Intergenic
1202129850 Y:21599625-21599647 CCACAGAAAAATAAAGAACATGG + Intergenic
1202175594 Y:22096109-22096131 CCACAGAAAAATAAAGAACACGG + Intergenic
1202178094 Y:22116037-22116059 CCACAGAAAAATAAAGAACAGGG + Intergenic
1202179208 Y:22125151-22125173 CCACAGAAATATAAAGAACATGG + Intergenic
1202179812 Y:22130070-22130092 CCACAGAAAAATAAAGAACATGG + Intergenic
1202190818 Y:22242445-22242467 CTACAGTAACAAAAAGAGCATGG - Intergenic
1202211549 Y:22456324-22456346 CCACAGAAAAATAAAGAACATGG - Intergenic
1202212153 Y:22461243-22461265 CCACAGAAATATAAAGAACATGG - Intergenic
1202213267 Y:22470358-22470380 CCACAGAAAAATAAAGAACAGGG - Intergenic
1202215767 Y:22490273-22490295 CCACAGAAAAATAAAGAACACGG - Intergenic