ID: 933264989

View in Genome Browser
Species Human (GRCh38)
Location 2:80172160-80172182
Sequence TAGCCAAATCATTTTAGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 157}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933264989_933264991 13 Left 933264989 2:80172160-80172182 CCTGCACTAAAATGATTTGGCTA 0: 1
1: 0
2: 0
3: 4
4: 157
Right 933264991 2:80172196-80172218 GTTTTTTCAGCCCAACTAACTGG 0: 1
1: 0
2: 2
3: 8
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933264989 Original CRISPR TAGCCAAATCATTTTAGTGC AGG (reversed) Intronic
904398321 1:30238530-30238552 TAGGCAAATCATATTCATGCTGG - Intergenic
908840127 1:68271799-68271821 CAACCAAATCATTTTACTGTGGG + Intergenic
909696163 1:78470260-78470282 TAGCCTAACCATTTTTGTTCTGG - Intronic
912341369 1:108919233-108919255 CAGGCAAATCATTTGAGTTCAGG - Intronic
913224861 1:116690028-116690050 TGGCAAAATCATTTTACTTCTGG - Intergenic
915023040 1:152799123-152799145 TAACCAAAACAGTATAGTGCTGG - Intronic
916765204 1:167853598-167853620 TAGGAAAATAATTTTATTGCAGG - Intronic
918923448 1:190746810-190746832 GAGCCAAATTATTTTACTGGTGG - Intergenic
921609575 1:217195371-217195393 CAGCCAAACCATATTAGTGGTGG - Intergenic
1064485088 10:15778984-15779006 TAGACAAATTAATTTAGTGAAGG + Exonic
1064686971 10:17872675-17872697 TAGCCAAACCATGTTATTGATGG + Intronic
1066612963 10:37268799-37268821 AATCCAAATGATTTGAGTGCAGG - Intronic
1070506917 10:77121858-77121880 TAGCCAAATTATTATAGCCCAGG - Intronic
1071258304 10:83895203-83895225 TGGCCAAAGCATTTAAGAGCAGG - Intergenic
1072407377 10:95168246-95168268 TAGGCAGATCATTTGAGTCCAGG - Intergenic
1076984885 11:228397-228419 TAACCAAAACATTATAGTGCAGG + Intronic
1085131323 11:74041487-74041509 TTGCCAAATAATTATAATGCAGG - Intronic
1086223776 11:84482921-84482943 TTGCCAAAATATTTTAGTGGAGG + Intronic
1093655767 12:21692782-21692804 TAGCCAAAACAGCATAGTGCTGG + Intronic
1095509915 12:42939867-42939889 TAGTCAAAACAGTATAGTGCTGG - Intergenic
1095544294 12:43346293-43346315 CAGCCAAACCATATTAGTGGTGG + Intergenic
1097551927 12:61083764-61083786 TAGTCAAAACATTATAATGCTGG + Intergenic
1097903930 12:64900998-64901020 TAGCAAAATCAGCTTAATGCTGG + Intergenic
1099251186 12:80256955-80256977 TAGCAAAACCAATTTAGTTCTGG - Intronic
1100644052 12:96510421-96510443 CAGTCAGAACATTTTAGTGCTGG + Intronic
1105615084 13:22004617-22004639 TATGCAAATTATTTTTGTGCAGG - Intergenic
1106581637 13:31023837-31023859 TAGGCAAATCATTTGAGCTCAGG + Intergenic
1106866162 13:33966522-33966544 TAACAATATCATTTTATTGCAGG - Intronic
1107846016 13:44513596-44513618 TAGCCAATTCACTTTATTTCTGG - Intronic
1110082956 13:71340623-71340645 TAGGCAAATAATTTTACTGGGGG + Intergenic
1111058917 13:82986463-82986485 TATCCTAATCATTTTAGAGGAGG + Intergenic
1114793841 14:25689727-25689749 TAACCAGATCATTTTAATGTCGG + Intergenic
1114997762 14:28378326-28378348 TAGCCAAAGCAGTTTTGAGCAGG + Intergenic
1115249686 14:31332042-31332064 TTGCCAAATCATCTTAAAGCAGG - Intronic
1117858786 14:60066479-60066501 TAACCAAATCATTTTGGTTATGG + Intergenic
1118005002 14:61557807-61557829 AAGCCAGAACATTTCAGTGCTGG + Intronic
1118380305 14:65212572-65212594 TAGACAGACCATTTTACTGCTGG + Intergenic
1118575348 14:67236858-67236880 TGGGCAAATCATTTTAGGTCAGG + Intergenic
1119670740 14:76516259-76516281 TACCCAAATCCTTTTAGCACAGG - Intergenic
1120243549 14:81978827-81978849 TAGCCAGATCATTTGAGGTCAGG + Intergenic
1124793990 15:32758621-32758643 TAGCTATATCAATTTAGGGCAGG + Intergenic
1127053185 15:55106005-55106027 CAGCCAAACCATATTAATGCCGG + Intergenic
1134200792 16:12196989-12197011 TATCTGAAACATTTTAGTGCTGG + Intronic
1135800119 16:25486408-25486430 TACCCAAGTCATTTGAGAGCAGG + Intergenic
1138811050 16:60150967-60150989 TAGCCAAATCACTGAAGTGGAGG + Intergenic
1139279074 16:65754302-65754324 TAGCCAAACCATATCAGTGGGGG + Intergenic
1145027374 17:19478416-19478438 TATCCAAATCATTTTAGTCGGGG + Intergenic
1149094294 17:52822011-52822033 TAGACATATTATTTTAGTTCAGG - Intergenic
1150808891 17:68340745-68340767 GAGCCAATTCCTTTTATTGCAGG + Intronic
1153748728 18:8208189-8208211 TACACAGTTCATTTTAGTGCAGG + Intronic
1157645604 18:49266386-49266408 TAGGCAAATCATTTGAGACCAGG + Intronic
1164193839 19:22935878-22935900 GAGTCATATCATTTGAGTGCAGG - Intergenic
1164314429 19:24074492-24074514 TAGTCACATCATCTAAGTGCTGG - Intronic
925678662 2:6393697-6393719 TAGCCATAACATTTCAGTTCAGG - Intergenic
930156809 2:48114354-48114376 TAGGCAAAGCATTTTAATGATGG + Intergenic
930412742 2:51047365-51047387 TAGGCAGATCATTTTAGACCAGG - Intergenic
933264989 2:80172160-80172182 TAGCCAAATCATTTTAGTGCAGG - Intronic
935128477 2:100243859-100243881 CAGCCAAATCATTTGAGGTCAGG + Intergenic
940249601 2:151660141-151660163 TAGCCATTTCAGTTCAGTGCAGG + Intronic
940753082 2:157649632-157649654 AAGCCACAGCATTTTAGAGCTGG - Intergenic
944572118 2:201055469-201055491 AAGCCAAATCATTTGAGCCCAGG + Intronic
947326663 2:228986431-228986453 TAGCCAACTCATTTATGTGGTGG - Intronic
1170349830 20:15426571-15426593 CAGACAAATCACTTTAGAGCAGG - Intronic
1172563271 20:35907896-35907918 TAGTCACATAATTTTAGTGGGGG - Intronic
1177065629 21:16430571-16430593 TAGAAAAATAATTTCAGTGCAGG - Intergenic
1177846456 21:26293922-26293944 TATCCAAATCATTATCATGCAGG + Intergenic
1181147771 22:20860818-20860840 TAGGCAGATCATTTTAGCCCAGG + Intronic
1182632028 22:31694047-31694069 TGGGCAAATCATTTGAGTCCAGG + Intronic
1183666205 22:39247553-39247575 GACCCAAATCATTGCAGTGCAGG + Intergenic
951782498 3:26379907-26379929 TAGCCAAATCTTTTTAGAAGTGG + Intergenic
952872612 3:37914632-37914654 TAGCAAATTAATTTTATTGCAGG - Intronic
954560326 3:51550817-51550839 TAGGCAGATCATTTTAGGCCAGG + Intronic
955586164 3:60480338-60480360 AAACCAAATCATTCCAGTGCTGG + Intronic
956860556 3:73319631-73319653 TAGCCATATGACTTAAGTGCTGG - Intergenic
959011700 3:101085231-101085253 TAGCCAAACCATATCATTGCGGG - Intergenic
960098049 3:113707289-113707311 TAGGCAGATCACTTCAGTGCAGG - Intergenic
961344407 3:126253820-126253842 TATCCAAACAATTTTAGTACTGG - Intergenic
962296751 3:134196510-134196532 TAGGCAGATCACTTTAGTCCAGG + Intronic
962596879 3:136955192-136955214 TTGCCAGAGCATTGTAGTGCTGG + Intronic
964461165 3:156930687-156930709 TAATCAAATCAGTATAGTGCTGG + Intronic
965921625 3:173923387-173923409 TGGCCAATTCATTTTAGGGTGGG - Intronic
971003626 4:22350440-22350462 TAGCAAAAGCATTTAAGTCCTGG + Intronic
971503034 4:27337000-27337022 TGGACAAACCATTTTAGGGCAGG + Intergenic
971841656 4:31860387-31860409 TAGCAAAATCAACTTAATGCTGG + Intergenic
971894597 4:32575905-32575927 TAACCAAAACAGTATAGTGCTGG + Intergenic
973931792 4:55800674-55800696 TAGGCAGATCATTTTAGGTCAGG - Intergenic
974468459 4:62288349-62288371 TAGCAAAATCAGTTTAGCTCAGG - Intergenic
976252699 4:83069426-83069448 TAGCATAATCTTTTTTGTGCTGG + Intronic
976854365 4:89585281-89585303 TAGTAAAATCATTTGAGTACTGG - Intergenic
977388990 4:96383795-96383817 TACCCAAATCATGTAAATGCTGG - Intergenic
978253525 4:106663427-106663449 TAGCCATATTCTTTTATTGCAGG + Intergenic
978672928 4:111272911-111272933 TATGCAGATCATTTTAGTGTTGG + Intergenic
980623241 4:135337939-135337961 TATTCAGATTATTTTAGTGCTGG - Intergenic
981776855 4:148378403-148378425 TATCCAAACCAATTCAGTGCAGG - Intronic
982910929 4:161142237-161142259 TAGCCAAATCAGAATAGTTCTGG + Intergenic
983770567 4:171543986-171544008 TATCCAGATCCTTTTAGTCCAGG - Intergenic
984944361 4:184959657-184959679 CAGCCAAGCCCTTTTAGTGCAGG - Intergenic
988385156 5:30553593-30553615 GAGCCAAATCATATTAGAGGTGG - Intergenic
994013136 5:94931646-94931668 TAGCCTCATCATTTTATTCCTGG + Intronic
994416252 5:99475694-99475716 TAGCTAAATAATTTTAGAGAGGG + Intergenic
994463716 5:100099478-100099500 TAGCTAAATAATTTTAGAGAGGG - Intergenic
994950336 5:106453512-106453534 TAGTCCAATCTTGTTAGTGCAGG - Intergenic
997653428 5:135538357-135538379 TGGCCAAAAGATTTTAGTACAGG + Intergenic
997734274 5:136201958-136201980 TCTCCAAATCATTTTGGAGCTGG - Intergenic
998810101 5:145957883-145957905 TGGGCAGATCATTTTAGGGCAGG + Intronic
998978430 5:147673643-147673665 TGGCCAAATTATTAAAGTGCAGG + Intronic
999885022 5:155912702-155912724 TAGCCAATTCATTTTAGTCTTGG + Intronic
1000311744 5:160051728-160051750 TTGCCAAAGCATTTTAGAGTTGG + Intronic
1000425766 5:161089545-161089567 TATCCTAAGCATATTAGTGCAGG + Intergenic
1004269629 6:14182621-14182643 AAGCAAAATCACTTTAGTACAGG + Intergenic
1008358432 6:50585592-50585614 TAGTGAAAACATTTTATTGCTGG + Intergenic
1009618149 6:66037801-66037823 AAGCCATATCATTTTATTCCTGG + Intergenic
1009636381 6:66270019-66270041 TAGTCAAAACATTATGGTGCTGG + Intergenic
1009861037 6:69332583-69332605 TAGCCAAATGATTTTACTCAGGG + Intronic
1012117769 6:95325572-95325594 TAGTCAATTCATTTTAATGTTGG + Intergenic
1013255781 6:108383980-108384002 TAGCCAAATGATCTTTCTGCAGG + Intronic
1013752534 6:113423707-113423729 TAGCCAAATGATGTCAATGCTGG - Intergenic
1014054048 6:116992572-116992594 TTGCCTGATCATTTTAGTTCTGG + Intergenic
1015350654 6:132214501-132214523 AAGCTAAATCAATTCAGTGCTGG - Intergenic
1017538523 6:155374834-155374856 TAGACAAATCAATTTAATGGAGG - Intergenic
1020420212 7:7995279-7995301 TAGGCAAATCATTTGAGCCCAGG + Intronic
1025759611 7:64377752-64377774 GAGCCACATCATTTGGGTGCTGG - Intergenic
1030496142 7:110303335-110303357 TGGCAAAATCATTTGAGAGCTGG - Intergenic
1031126405 7:117778292-117778314 AAGCCAAATAATTTCAGTGAAGG + Intronic
1031935146 7:127728359-127728381 TATCTAAATCTTTCTAGTGCTGG + Intronic
1037866031 8:22442870-22442892 TTGCGAAGTCATTTTAGTACAGG - Intronic
1038680193 8:29659755-29659777 TAGCCAAAAGAGTTTACTGCAGG - Intergenic
1038785464 8:30610471-30610493 TAATCAAAACATTGTAGTGCTGG + Intronic
1040377730 8:46842694-46842716 GAGCCATATCATTTGAGTGCTGG - Intergenic
1040396317 8:47003769-47003791 GAGCCAAATCACCTAAGTGCTGG + Intergenic
1041159357 8:55022368-55022390 TTGCCAATTCATTTTATTGAAGG + Intergenic
1041494963 8:58475952-58475974 TAGCCAAAACAATATAGTACTGG - Intergenic
1041815137 8:61962063-61962085 TAGCCCAATCATTTAGGTGGAGG - Intergenic
1042272599 8:66970361-66970383 TGGGCAGATCATTTTAGTCCAGG - Intronic
1042632721 8:70837651-70837673 TAGCCAAATCTTGGTCGTGCTGG + Intergenic
1043189259 8:77196800-77196822 TACCCAAATCATATTAATGTTGG - Intergenic
1043447997 8:80338312-80338334 TAGCCAAATTATATTAATGTAGG + Intergenic
1043603526 8:81971079-81971101 TTGCCATTTCATTTTAGAGCTGG - Intergenic
1045956021 8:107909031-107909053 CAGCCAACTCATTGTGGTGCTGG - Intronic
1047596531 8:126383201-126383223 GAGTCACATCATTTTAGAGCTGG - Intergenic
1050137141 9:2478159-2478181 AAGCCAAATAATTTTAGTAATGG - Intergenic
1051730029 9:20131382-20131404 TAGACAAATAATTTGAATGCAGG + Intergenic
1055002944 9:71473959-71473981 CAGCCAAAGCATATCAGTGCTGG + Intergenic
1055161919 9:73140788-73140810 AAGCCAATTACTTTTAGTGCTGG + Intergenic
1056839502 9:89987041-89987063 TAGCTAAATCACTTTTGTGGAGG + Intergenic
1060085733 9:120699017-120699039 AAGACAAATCATGTTTGTGCTGG + Intronic
1186020708 X:5251917-5251939 TAAATAACTCATTTTAGTGCTGG + Intergenic
1186032935 X:5390398-5390420 AAACCAAATCATCTTAATGCAGG + Intergenic
1187996155 X:24929127-24929149 TAGCCAACCCAATTTGGTGCAGG - Intronic
1189075189 X:37906938-37906960 TAGAAAAATCATTTTGGTGGTGG + Intronic
1190772735 X:53528512-53528534 TGGGCAAATCATTTGAGTCCAGG - Intergenic
1191947624 X:66553101-66553123 TTGGCAGATCATTTGAGTGCAGG + Intergenic
1195990826 X:110680507-110680529 TAGCCAGATGATTCTAATGCAGG - Intronic
1196458424 X:115906035-115906057 TAGCCAAAGAATTACAGTGCTGG + Intergenic
1197440812 X:126487605-126487627 TAACAAAATAATTTTAGGGCTGG + Intergenic
1198050476 X:132947577-132947599 TAGCCACATCAGTTTACTTCTGG + Intronic
1198206930 X:134474972-134474994 TGGGAAAATCACTTTAGTGCAGG - Intronic
1199331792 X:146569329-146569351 AAGCCAAATAAATTTAGTGATGG + Intergenic
1200896607 Y:8382696-8382718 TAGCCAGATCACTTGGGTGCTGG + Intergenic
1202255549 Y:22916663-22916685 TAGCCACATCACTTGGGTGCTGG - Intergenic
1202408540 Y:24550412-24550434 TAGCCACATCACTTGGGTGCTGG - Intergenic
1202462242 Y:25119668-25119690 TAGCCACATCACTTGGGTGCTGG + Intergenic