ID: 933266048

View in Genome Browser
Species Human (GRCh38)
Location 2:80181308-80181330
Sequence GATGTTGCCACCACTGGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 529
Summary {0: 4, 1: 19, 2: 125, 3: 166, 4: 215}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933266048 Original CRISPR GATGTTGCCACCACTGGGGG TGG Intronic
900629682 1:3627683-3627705 GGTGTTTCCATCACTGCGGGGGG - Intronic
900881268 1:5382962-5382984 GATGATGACACCACAGGAGGGGG + Intergenic
901904414 1:12395238-12395260 GATGTTGCCACTACTGGGGATGG + Intronic
902444725 1:16455183-16455205 GCAGTTGGCAGCACTGGGGGAGG + Intronic
903155325 1:21438941-21438963 GCAGTTGGCAGCACTGGGGGAGG + Intergenic
904262693 1:29299078-29299100 GAAAGTGCCACCACTGAGGGAGG + Intronic
904335563 1:29795397-29795419 GATGTTGCCACTACTGGGGATGG - Intergenic
905255500 1:36679577-36679599 GATGTGGACACCATTGGGAGGGG + Intergenic
905464863 1:38145523-38145545 GATGTTGCCACTACTGGGAATGG - Intergenic
906867730 1:49440926-49440948 GATGTTGCCACTACTGGGGATGG - Intronic
906879348 1:49573901-49573923 GATGTTGCCACTACTGGGGTTGG - Intronic
907596974 1:55729075-55729097 GATGTTGCTACCACTGGGGATGG - Intergenic
907779990 1:57558197-57558219 CATGTTGCCACTACTGGGGATGG - Intronic
908187550 1:61667165-61667187 GATGTGGACACCCCTGGAGGGGG - Intergenic
908616601 1:65929293-65929315 GATGTTGCCACTACTGGGGATGG + Intronic
909172956 1:72318031-72318053 GATGTTGCCACTACTGGGTATGG + Intergenic
909549302 1:76879735-76879757 GATGTTGCCACTACTGGGGATGG + Intronic
909576558 1:77183291-77183313 GATGTTGCCACTGCTGGGGATGG - Intronic
909810667 1:79928992-79929014 AATGTTGCCACTACTAGGGAGGG - Intergenic
910466085 1:87501594-87501616 CCTGTTGCCATCAATGGGGGTGG - Intergenic
910587862 1:88899151-88899173 GATGTTGCCACTACTGGAGATGG - Intergenic
910639317 1:89442542-89442564 GATGTTGCCACTACTGGGGATGG + Intergenic
910831509 1:91466291-91466313 GATGTTGCCACTACTGGGAATGG + Intergenic
910948071 1:92615588-92615610 GTTGTTTCCACTACTGGGGATGG - Intronic
911883226 1:103267895-103267917 GATGTTGCCACTACTGGGGATGG - Intergenic
911980124 1:104557091-104557113 GAAGTTGCCACTACTGGGGATGG - Intergenic
911982222 1:104581850-104581872 GATGTTGCCACTACTGGGGATGG + Intergenic
912066691 1:105754022-105754044 GATGTTGCCACTACTGGAAATGG - Intergenic
912071045 1:105809967-105809989 GATGTTGCCACTACTGGGGATGG + Intergenic
912130248 1:106590635-106590657 GATCTTGCCACTACTGGGCATGG + Intergenic
912252183 1:108022379-108022401 GATGTTGCCACTACTGGGGGTGG + Intergenic
912733671 1:112131399-112131421 GATGTTGCCACTACTGGGGACGG + Intergenic
912932886 1:113980400-113980422 GATGCTGCCACTGCTGGAGGTGG + Exonic
912944175 1:114070751-114070773 GATGTTGCCACTACTGGGGATGG + Intergenic
915668010 1:157462231-157462253 AATGTTGCCACTAATGGGGATGG + Intergenic
915834887 1:159168807-159168829 AGGGTTGCCACCACTGGGTGGGG - Intergenic
916106686 1:161437876-161437898 GATGCTGCCACTACTGGGGATGG + Intergenic
916572344 1:166038815-166038837 GATGTTGCCACCACAGACTGAGG + Intergenic
917217566 1:172693483-172693505 GATGTTGCCACTACTAGGGATGG + Intergenic
917462384 1:175243638-175243660 GGTGTTGCCACTACTGAGGATGG - Intergenic
918756064 1:188340378-188340400 GATGTTGCCCCTGCTGGGGATGG + Intergenic
918774176 1:188608189-188608211 GATGTTACCTCTACTGGGGATGG - Intergenic
918814767 1:189168657-189168679 GATGTTGCCACCACTGGGGATGG - Intergenic
918957925 1:191235449-191235471 AATGTTGCCACTACTGGGGTTGG - Intergenic
919241461 1:194921931-194921953 GATGTTGCCACTACTGGGGATGG - Intergenic
920006245 1:202835752-202835774 GATGTGGCCAGCACAGAGGGAGG - Intergenic
920197072 1:204235787-204235809 GATGTTGCCACTATTGGGAATGG - Intronic
920284976 1:204872759-204872781 GGTGTTGCCATCACTGGGGGAGG - Intronic
921896449 1:220406581-220406603 CATGTGGCCTCCACTGGTGGAGG - Intergenic
921945005 1:220880140-220880162 GAGGGCGCCACCACTGGGGTGGG - Exonic
924847531 1:247788109-247788131 GATGTTGCCACTACTGGGGATGG + Intergenic
1064518002 10:16170813-16170835 GATTTTGCCACTACTGGGGGTGG + Intergenic
1064546000 10:16450382-16450404 GATGTTGCCATCACTGGGGATGG + Intronic
1066167377 10:32801840-32801862 GATGTTGCCACCACTTGGAGTGG + Intronic
1066169379 10:32825978-32826000 GATGTTGTCACTACTGGGGATGG - Intronic
1066543377 10:36473887-36473909 TATGTTGCCACTACTGGGGTTGG - Intergenic
1067125939 10:43515429-43515451 GATGTTGCCACTACCAGGGATGG + Intergenic
1067332800 10:45337640-45337662 GATGTCACCACTACTGGGGATGG - Intergenic
1067560811 10:47303182-47303204 GATGATGCCACCCATGTGGGAGG + Intronic
1067754756 10:48996631-48996653 GATGTTGCCACTACTGGGGATGG + Intergenic
1067907563 10:50309551-50309573 GATGTCAGCACCCCTGGGGGAGG - Intronic
1068446864 10:57136005-57136027 GATGTTGCCACTATTGGGGATGG - Intergenic
1068837588 10:61571172-61571194 GATGTTGCCACTAATGGGGATGG + Intergenic
1069192661 10:65508933-65508955 GATGTTGCCACTACTGGGGGTGG + Intergenic
1069791218 10:71022317-71022339 GATGTTGCCACTACTGGGGATGG + Intergenic
1071267445 10:83976571-83976593 GATGTTGCCACTACTGGGGATGG + Intergenic
1071378045 10:85030839-85030861 GATGTTGCCACTACTGGGGATGG - Intergenic
1071397121 10:85235158-85235180 GAACTTGCCACCTCTAGGGGAGG + Intergenic
1071674249 10:87639787-87639809 GATGTTGCCACCACTGTGAGTGG + Intergenic
1071943130 10:90610354-90610376 GACATTGCCACTACTGGGGATGG + Intergenic
1072209611 10:93234270-93234292 GATGTTGCCACTACTGGGGATGG + Intergenic
1073556980 10:104463328-104463350 GATGTTGCCACTACTGGGTATGG - Intergenic
1074891391 10:117739210-117739232 GGTGTTGCTCACACTGGGGGAGG - Intergenic
1075606521 10:123815537-123815559 GATGTTGCCACTACTGGGTATGG - Intronic
1076927765 10:133501811-133501833 GATGTTGCCACTACTGGGGATGG + Intergenic
1077174549 11:1182769-1182791 GATGTTGCCGGCACTGGCGGAGG - Intronic
1077174764 11:1183888-1183910 GATGTTGCCGGCACTGGCGGAGG - Intronic
1078358420 11:10649723-10649745 GAGGTTGCCACAATGGGGGGAGG + Intronic
1078963540 11:16308726-16308748 GATGTTTCCAGCACAGGGTGTGG - Intronic
1079995413 11:27290486-27290508 GATGTTGCCTCCTCTGTGGGTGG + Intergenic
1080494294 11:32801030-32801052 GATGGAGCCAACACTGGAGGAGG - Intergenic
1081590030 11:44416213-44416235 GATGTTGTCACTACTGGGGATGG - Intergenic
1082671352 11:56040463-56040485 GATGTTGCCACTACTAGGGGTGG - Intergenic
1082999279 11:59276961-59276983 GATGTTGCCGCTACTAGGGGTGG - Intergenic
1083092668 11:60217440-60217462 GATGTTGCCACTACTGGTGATGG - Intronic
1083717187 11:64584163-64584185 GATTTTGCCTCCTCTGCGGGGGG - Intergenic
1085747224 11:79125648-79125670 AATGTTGCCACTACTGGGGATGG - Intronic
1086141703 11:83506668-83506690 GATGTTGACACTACTGGGGATGG + Intronic
1086278280 11:85157881-85157903 GATGTTGCCACTACTGGGAATGG - Intronic
1088192036 11:107237095-107237117 GATGTTGCCACTACTGGGGATGG + Intergenic
1088264792 11:107978953-107978975 GATGTTGCCACTGCTGGGGATGG - Intergenic
1088407957 11:109501266-109501288 GATGTTGCCACTACTGGGGATGG + Intergenic
1088448998 11:109962752-109962774 GATGTTGCCACCACTGAGGGTGG - Intergenic
1088844329 11:113652124-113652146 CATGTTCCTACCACTGGGTGAGG - Intergenic
1089903273 11:122010975-122010997 GATGTTGCCATTACTGGGGATGG - Intergenic
1090631093 11:128648883-128648905 GCTGCTGCCAACACTGGGGAGGG - Intergenic
1091676262 12:2492830-2492852 GATGATGCCACCACTGCAAGTGG - Intronic
1092918098 12:13206419-13206441 GACGATGCAAACACTGGGGGAGG - Intronic
1093032250 12:14298804-14298826 GATGTTGCCACTACTGGGGATGG + Intergenic
1093049997 12:14493551-14493573 GATGTTGCCACTACTGGGGATGG + Intronic
1093422286 12:18988315-18988337 GTGTTTGCCACCACTGGAGGAGG - Intergenic
1094102190 12:26776671-26776693 GATGTTGCCACTACTGGGGATGG - Intronic
1095844823 12:46733084-46733106 GATGTTGCTGCTACTGGGGATGG + Intergenic
1095856574 12:46866264-46866286 GATGTTGCCACTACTGGGAATGG + Intergenic
1097070789 12:56353238-56353260 CATGTGGCCAGCACTGTGGGAGG - Intronic
1097076509 12:56398898-56398920 GATGTTGCCACTACTGGGGATGG - Intergenic
1097431854 12:59518812-59518834 GATGTTGCCATTTCTGGGGATGG + Intergenic
1098805106 12:75013479-75013501 GATGTTGCCACTACTGGGGATGG - Intergenic
1099184133 12:79499265-79499287 GATGTTGCCACTACTGAGAATGG + Intergenic
1099350672 12:81565114-81565136 GATGTTACCACTACTGGGGATGG - Intronic
1099365589 12:81762862-81762884 GATGTTGCCACTACTGGGGATGG - Intergenic
1099375302 12:81891375-81891397 GATGTTGCCACCATTGGGGATGG - Intergenic
1099380008 12:81941335-81941357 GGTGTTGCCACTACTGGGGATGG + Intergenic
1099400126 12:82193685-82193707 GAGGTTGCCACCACTGAAGTTGG - Intergenic
1099401453 12:82207293-82207315 GATGTTGCCACCACTGGGGTTGG + Intergenic
1099526039 12:83720581-83720603 GATGTTGCCACTACTGGGGATGG - Intergenic
1099577745 12:84402849-84402871 GATGTTGCCACTACTGGGGATGG - Intergenic
1099859742 12:88211202-88211224 GACGTTACCACTACTGGGGATGG + Intergenic
1100082975 12:90875643-90875665 GATGCTGCCACTACTGGGAATGG - Intergenic
1100241528 12:92714287-92714309 GATGTTGCCACTACTGGGGATGG + Intergenic
1101095038 12:101329745-101329767 GCTGATGCCACCACTTTGGGAGG + Intronic
1101248878 12:102911716-102911738 GATGTTCTCAGCACTGTGGGTGG - Intronic
1101263773 12:103063514-103063536 GATGTTGTCACTACTGGGGATGG - Intergenic
1101535037 12:105608704-105608726 GATGTTGCCACTACTGGGGATGG + Intergenic
1101542741 12:105680054-105680076 GATGTTGCCACTACTGGAAATGG - Intergenic
1101726944 12:107395704-107395726 GAGCTGGCCCCCACTGGGGGTGG - Intronic
1103035202 12:117651135-117651157 GATGTTGCCATTTCTGGGGATGG - Intronic
1103396157 12:120608854-120608876 GATGTTGTCACCACTAAGGGTGG - Intergenic
1104018392 12:124975499-124975521 GATGCTGTCTTCACTGGGGGAGG + Exonic
1105739424 13:23307514-23307536 GATGGTGCCAGCACTGGCTGTGG + Intronic
1106362516 13:29045566-29045588 GGTCTTGCCACCACAGGTGGAGG + Intronic
1106945508 13:34823419-34823441 GATGTTGCAAGCACTGGGATAGG - Intergenic
1107490123 13:40873759-40873781 GATGTTGCCACTACTGGGGATGG - Intergenic
1107983922 13:45758561-45758583 TATGTTGCCACTACTGGGGATGG + Intergenic
1108903904 13:55447083-55447105 TATGTTGCCACTACTGGGTAAGG - Intergenic
1109713021 13:66183575-66183597 AATGTTGCCACCACTAGGGGTGG + Intergenic
1109951360 13:69504755-69504777 GATGCTGCCACCACTGGGGATGG + Intergenic
1111016526 13:82388423-82388445 GATGCTGCCACTACTTGGGATGG + Intergenic
1111440752 13:88280604-88280626 GATGTTGCCACCACTGGGGGTGG - Intergenic
1112231485 13:97592750-97592772 GATGTTGCCACTACTGGGCATGG + Intergenic
1112250278 13:97772811-97772833 GATGTTGCCACTACTGGGAATGG + Intergenic
1113877019 13:113601093-113601115 GATGGTGCCACCACAGAGGAGGG - Intronic
1113921735 13:113917223-113917245 GACGTTGCCACCAGTGTGGAGGG + Intergenic
1114758601 14:25286321-25286343 GATGTTGCCACTACTGGGGATGG + Intergenic
1114793223 14:25682447-25682469 GATGCTGACCCCATTGGGGGAGG + Intergenic
1116058567 14:39894346-39894368 AATGTTGCCACCACTGGGGATGG - Intergenic
1116158735 14:41239266-41239288 GATGTCGCCACTACTGGGGATGG + Intergenic
1116414732 14:44666718-44666740 GATGTTGCCACTACTGGGGATGG - Intergenic
1116531795 14:45980795-45980817 GATGTTGCCACCACTAGGGATGG + Intergenic
1117001760 14:51377422-51377444 GATGTTGTCACCACTGGGGCTGG + Intergenic
1117216470 14:53557509-53557531 GGTGTTGCCTCTACTGGGGATGG - Intergenic
1117596626 14:57332488-57332510 GATGCTGCCACTACTGGGGATGG + Intergenic
1117633769 14:57721784-57721806 AATGTTGCCACTACTGGGGATGG - Intronic
1118881126 14:69826614-69826636 GATGTTGCCACTACTGGGGATGG + Intergenic
1119060107 14:71465066-71465088 GATGTTGCCGCTACTGGAGATGG + Intronic
1120082375 14:80230136-80230158 GATGTGGCCACTACTGGGAATGG + Intronic
1120231751 14:81847848-81847870 GATGTTGCCACCACTGGGGTTGG + Intergenic
1120973308 14:90227859-90227881 GATGTTGCCACTACTGGGGATGG - Intergenic
1121292609 14:92789107-92789129 TATGTTTCCACCGCTGGAGGAGG + Intergenic
1121371019 14:93358692-93358714 GATGTTGCCACTACTGGGAATGG - Intronic
1122485614 14:102077617-102077639 GATGATGGCACCACTTGGGGAGG - Intergenic
1122881509 14:104692484-104692506 CTTGTTGCTACCACTGGGGTAGG + Intronic
1125226870 15:37405469-37405491 GATGTTTGTACCCCTGGGGGAGG - Intergenic
1125794722 15:42395693-42395715 GATGCTGCCATCACAGGGGCTGG + Intronic
1126396040 15:48218750-48218772 GATTTTGAAACCACTGGGGAAGG - Intronic
1129961744 15:79692655-79692677 GATGTTGTCACTACTGGGGATGG + Intergenic
1131948383 15:97652774-97652796 TATTTTGCCACCACTGGGCGCGG + Intergenic
1132326817 15:100977455-100977477 GATGTTGTCACCACCTGGTGGGG - Intronic
1132924885 16:2424151-2424173 CTTGTTACCACCACCGGGGGTGG - Intergenic
1133241227 16:4415863-4415885 GATGCTGCCACGGCTGGGTGGGG - Intronic
1135202906 16:20454414-20454436 AATGCTGCCACTACTGGGTGGGG - Intronic
1136685278 16:31990372-31990394 GGTCTTGCCAGCGCTGGGGGAGG - Intergenic
1136785892 16:32933907-32933929 GGTCTTGCCAGCGCTGGGGGAGG - Intergenic
1136883880 16:33919897-33919919 GGTCTTGCCAGCGCTGGGGGAGG + Intergenic
1137551381 16:49439980-49440002 GATGTGGCCACCCCAGGGTGGGG - Intergenic
1140597766 16:76436236-76436258 GATGATGCCGCTACTGGGGATGG + Intronic
1141509304 16:84502272-84502294 GTGGTTGCCACAACTGGGGGAGG + Intronic
1141559894 16:84860610-84860632 GACGTTGCCACTACTGGGGATGG + Intronic
1203088129 16_KI270728v1_random:1195569-1195591 GGTCTTGCCAGCGCTGGGGGAGG - Intergenic
1143744848 17:8985153-8985175 AATGTTGCAGCCACTGGAGGAGG + Intergenic
1144371430 17:14595191-14595213 GTGGTTGCCAGGACTGGGGGAGG + Intergenic
1145253367 17:21308989-21309011 CATGTTTCCACCACTGTGGCTGG + Intronic
1146237848 17:31185027-31185049 GATGTTGCCACTACTGGGGATGG - Intronic
1146540411 17:33688664-33688686 GCTTTTGCCACTAGTGGGGGTGG - Intronic
1146647769 17:34586526-34586548 AATGTTGCAACAAGTGGGGGGGG + Intronic
1146758479 17:35454561-35454583 GATGTTGCCACTACTTGGGATGG - Intergenic
1146850568 17:36218361-36218383 GATGTTGCTACTACTGGGGATGG - Intronic
1147146226 17:38486052-38486074 GGTCTTGCCAGCGCTGGGGGAGG - Exonic
1148254109 17:46113104-46113126 TTTGTTGTCACAACTGGGGGTGG + Intronic
1149236357 17:54594840-54594862 GACGTTGCCACTACTGGGGATGG + Intergenic
1151037967 17:70822811-70822833 GATGTTGCCACTACTGGGGATGG + Intergenic
1151853915 17:76708657-76708679 GTTAATGCCACCACTGGGAGTGG + Intronic
1152831719 17:82501366-82501388 GTCTTTGCCTCCACTGGGGGTGG - Intergenic
1153218061 18:2838201-2838223 CATGTTGCCACTACTGGGGATGG + Intergenic
1154068123 18:11128539-11128561 GATGTTGCCGCTACTGGGGATGG - Intronic
1154505847 18:15040270-15040292 GATGTTGCCACTATTGGGCATGG - Intergenic
1155573497 18:27220611-27220633 GATGTTGCCACTACTGGGGATGG - Intergenic
1156192387 18:34734305-34734327 GATGTTGACTCTACTGGGGATGG + Intronic
1156303521 18:35856167-35856189 GATGTTGCCACTACTGGTGATGG - Intergenic
1156537434 18:37877930-37877952 GATGTTGCCACTACTGTGGATGG - Intergenic
1156990639 18:43403301-43403323 GATGTTGCCACTACTGGGGATGG + Intergenic
1156998259 18:43495118-43495140 GATGTTGCCACTACTGTGGATGG - Intergenic
1157341058 18:46778981-46779003 GATGTTGCCACTACTGGGGGTGG - Intergenic
1157532741 18:48435438-48435460 GATGTTGCAACCATAGGGTGAGG + Intergenic
1157683064 18:49622067-49622089 AATGTTGCCACCGCCGGGCGGGG + Intergenic
1157845605 18:51001191-51001213 TATGTTGCCACTACGGGGGGTGG - Intronic
1157871329 18:51232488-51232510 CATGTTTCTACCACTGGGGGTGG + Intergenic
1158483000 18:57838303-57838325 GATGTTACCACCACTGAAGGAGG + Intergenic
1159559435 18:69977759-69977781 GGTGTTGCCACTACTGGGGATGG + Intergenic
1161679038 19:5669842-5669864 GATGATGCCCACACTGTGGGTGG - Intergenic
1162116402 19:8432243-8432265 GATGTTACAACCACTGGGCCTGG - Intronic
1164097468 19:22024260-22024282 GATGTTGCCACTACTGGGGATGG + Intergenic
1164117655 19:22237709-22237731 GATGTTGCCACTACTGGGGATGG + Intergenic
1164200407 19:23013293-23013315 GATGTTACCACTACTGGGGATGG + Intergenic
1164473692 19:28556242-28556264 GTTGCTGCCACCACTGAGGAGGG - Intergenic
1164487717 19:28674727-28674749 GAATTTGTCACTACTGGGGGTGG - Intergenic
1166866276 19:45839544-45839566 GATGTTAAAACCACTGGGTGAGG + Intronic
1167876065 19:52413652-52413674 GATGTTGCTGCAACTGGAGGGGG + Intronic
925460377 2:4057877-4057899 GATGTTGCCACTACAGGGGATGG - Intergenic
925499745 2:4489510-4489532 GATGTTGCCACTACTGGGGATGG + Intergenic
926810742 2:16753275-16753297 GATGTTGCCACTACTGGGGATGG + Intergenic
926825936 2:16904951-16904973 GATGTTGCCACTACTGAGGATGG + Intergenic
927252797 2:21013242-21013264 GGTGTTGCCACCACTGTAGGAGG + Exonic
927467180 2:23346251-23346273 GATCTTGCCATCACTGGAGCTGG - Intergenic
927743333 2:25591378-25591400 GATGCTGGCTGCACTGGGGGAGG - Intronic
928545596 2:32326619-32326641 GACATTGCCACAACTGGGGAGGG + Intergenic
929270185 2:39963379-39963401 GATGTTGCCACTACTCAGGATGG + Intergenic
930295496 2:49548148-49548170 GATGTTGCCATCACTAGGAATGG + Intergenic
930536942 2:52654859-52654881 GGTGTTGCCACTACTGGGGATGG + Intergenic
930909808 2:56618235-56618257 GATGTTGCCACTACTGGGGATGG - Intergenic
932071751 2:68627620-68627642 GATGTTGCCATCAGTGTTGGTGG - Intronic
932870824 2:75395991-75396013 GATGTTGCCACAATTGGGGATGG + Intergenic
933266048 2:80181308-80181330 GATGTTGCCACCACTGGGGGTGG + Intronic
935025086 2:99269167-99269189 TATGTAGCCACCACTTGAGGAGG + Intronic
935425446 2:102913924-102913946 GATGTTGTCACTACTGGGGTTGG + Intergenic
935569424 2:104643301-104643323 GATGCTGTCACCATTGGCGGAGG - Intergenic
936640936 2:114312430-114312452 GATGTTGCCACTACTGGGGATGG - Intergenic
937785535 2:125890261-125890283 AATGTTGCCACTACTGGGGATGG + Intergenic
937799986 2:126072149-126072171 GATGTTGCAGCCATTGGTGGTGG - Intergenic
937802485 2:126096776-126096798 GATATTGCCACTACTGGGGATGG - Intergenic
937852903 2:126651292-126651314 GACGTTGCCACTACTGGGGATGG + Intergenic
939068739 2:137515260-137515282 GATGTTGCCACTAATGGGAATGG - Intronic
939086168 2:137721105-137721127 GATGTTGCCCCTACTGGGAATGG - Intergenic
939213472 2:139209318-139209340 GATGTTTCCACTACTGGGGGTGG - Intergenic
940171672 2:150835318-150835340 GATGTTGCCATTACTGGGGATGG + Intergenic
940472476 2:154116157-154116179 GATGTTGCCACTACTAGGGATGG + Intronic
940902974 2:159143458-159143480 GCTGTTTCCAGCACTTGGGGAGG + Intronic
941667648 2:168258579-168258601 GATGTTGCCACTACTGGGGATGG - Intergenic
943239554 2:185365194-185365216 AATGTTGCCACTACTGGGGATGG + Intergenic
943318191 2:186414260-186414282 GATATTACCACTACTGGGGATGG + Intergenic
943384364 2:187183454-187183476 GATGTTGCCACTACTGGGGATGG + Intergenic
943509131 2:188802692-188802714 GATGCTGCCCCTACTGGGGATGG - Intergenic
943517939 2:188909841-188909863 GATGTTGCCACTGCTGGGGATGG + Intergenic
945146336 2:206742426-206742448 GATGTTGCCACTACTGGGTATGG - Intronic
945641823 2:212441222-212441244 GATGTTGCCACTACTGGGGATGG - Intronic
945726156 2:213474066-213474088 GCTGTTGCCACTACTGGGCATGG + Intronic
946790582 2:223297152-223297174 GATGTTGCCACCACTGGGGGTGG - Intergenic
946817090 2:223590298-223590320 CATGTTGGCAACAGTGGGGGTGG + Intergenic
1170140039 20:13116753-13116775 GATGCTGCCACCAATGGTTGCGG - Intronic
1175261977 20:57680391-57680413 GTGGTTGCCACAACTGGGAGGGG + Intronic
1176378578 21:6100350-6100372 GAGCTTGCCCCCACCGGGGGTGG + Intergenic
1176997808 21:15577627-15577649 GATGTTGCCACTACTGGGGATGG - Intergenic
1177002981 21:15636139-15636161 GATGTTGCCACTACTGGGGATGG + Intergenic
1177363377 21:20103253-20103275 GATGTTGCCACTACTGGGGATGG - Intergenic
1177912837 21:27053625-27053647 GATATTGCCACTACTGGGGATGG - Intergenic
1177934045 21:27319513-27319535 GATGTTGCCACTACTAGAGATGG + Intergenic
1177991414 21:28039762-28039784 GATGTTGCCACTACTGGGCATGG + Intergenic
1178012290 21:28302315-28302337 AATGTTGCCACTACTGGGGATGG - Intergenic
1179744897 21:43437887-43437909 GAGCTTGCCCCCACCGGGGGTGG - Intergenic
1182965722 22:34519401-34519423 GATGTTGCCACTACTGGGGATGG + Intergenic
1183227033 22:36557485-36557507 GATAATGCCACCACAGGGGGAGG - Intergenic
1184603920 22:45560985-45561007 GATGTTGCCACTACTGGGGATGG + Intronic
949126007 3:445740-445762 GATATTGCCACTACTGGGGATGG + Intergenic
949245521 3:1922316-1922338 GATGTTGCTACTACTGGGGATGG - Intergenic
949418008 3:3833785-3833807 GATGTTGCCACTACTGGGGATGG + Intronic
949618837 3:5787188-5787210 GATGTTGCTATCACTGGAGTGGG + Intergenic
950177896 3:10888689-10888711 GATGTTGCCACGGCAGGGGCTGG + Intronic
951122249 3:18942984-18943006 GATGTTGCCACTAATGGGGATGG - Intergenic
951291039 3:20872796-20872818 GATGTTGCCACTCTTGGGGTTGG - Intergenic
951384196 3:22025163-22025185 TATGTTGCCACTACTGGGGATGG - Intronic
953868922 3:46609453-46609475 GTTCCTGCCCCCACTGGGGGAGG + Intronic
953897743 3:46815101-46815123 GATGTTGTCACTACTGGGGATGG + Intergenic
955035236 3:55261492-55261514 GATGTTGCCACTACTGGGGATGG - Intergenic
955607604 3:60722614-60722636 TTTGTTGTCACAACTGGGGGTGG - Intronic
956509293 3:69977761-69977783 AATGTTGCCACTACTGGGGATGG - Intergenic
956642017 3:71424341-71424363 GATGTTGCAAGCACTGGGTAGGG + Intronic
957247881 3:77735932-77735954 GATGTTGCCACTACTGGGGTTGG + Intergenic
957634103 3:82759533-82759555 GATGTTGCCCCCACTGTGGGTGG - Intergenic
957897779 3:86446150-86446172 GATGTTGCCACTACTGGGAATGG - Intergenic
958715439 3:97774511-97774533 GATGTTGCCACTACTGGGAATGG + Intronic
958789191 3:98631179-98631201 AATGTTGCCACTACTGGGAATGG + Intergenic
959204130 3:103283382-103283404 GATGTTGTCACTACTGCGGATGG + Intergenic
959377737 3:105605771-105605793 GATGTTGCCACTACTGGGGATGG + Intergenic
960349210 3:116573388-116573410 AATGTTGCCACTACTGGGGATGG - Intronic
960557159 3:119042592-119042614 CTTGCTGCCACCACTGTGGGGGG - Intronic
961119504 3:124361794-124361816 GATGGTGGCAGCAGTGGGGGTGG + Intronic
961119513 3:124361825-124361847 GATGGTGGCAGCAGTGGGGGTGG + Intronic
963629961 3:147720625-147720647 GATGTTGCCACTGCTGGGGATGG - Intergenic
965191170 3:165531146-165531168 GATGTTGCCAATACTGGGGATGG + Intergenic
965996139 3:174885036-174885058 GATGTTGCCTCTGCTGGGGATGG + Intronic
966044670 3:175533511-175533533 GATGTTGCCACTACTGGGGATGG + Intronic
967505629 3:190249780-190249802 GATGTTGCCACTACTGGAGATGG + Intergenic
967831415 3:193923375-193923397 GATGTTGCCACTACTGGAGATGG - Intergenic
968906514 4:3455023-3455045 AATGTTGCCACTACTGGGGATGG - Intergenic
970629178 4:17922851-17922873 GATGTTGACACCACTGGGAGTGG - Intronic
971101347 4:23468992-23469014 GATTTTGCCATCACTAGGGATGG + Intergenic
971979637 4:33735458-33735480 GATTATGCCACTACTGGGGATGG + Intergenic
972084890 4:35204434-35204456 GTTGTTGCCACTACTGGGGATGG - Intergenic
972095177 4:35340086-35340108 GATATTGCCACTACTGGGGATGG - Intergenic
972192565 4:36612676-36612698 GATATTGCCAGTACTGGGGATGG - Intergenic
972201631 4:36719749-36719771 GATACTGCCACTACTGGGGATGG + Intergenic
972805625 4:42527435-42527457 GAAGTTGCCCCTACTGGGGATGG - Intronic
973118092 4:46486434-46486456 GATGTTGCCACTACTGGTAATGG - Intergenic
974289258 4:59910165-59910187 GATATTGGCACTACTGGGGATGG - Intergenic
974458818 4:62162634-62162656 GATGTTACCACTACTGGGGATGG - Intergenic
974479365 4:62423459-62423481 GATGTTGCCACCACTGGGGTTGG + Intergenic
974747240 4:66091526-66091548 GATGTTGACACTACTGTGGATGG + Intergenic
975373677 4:73617397-73617419 CATCTTGCCACCACTGGGTCTGG + Intronic
975734047 4:77364609-77364631 GATGTTGCCACCACTTGGGGGGG + Intronic
977465651 4:97380805-97380827 GATATTGCCACTACTAGGGATGG - Intronic
977490428 4:97702656-97702678 GATATTGCCACTACTGGGGATGG + Intronic
978342178 4:107730199-107730221 GATGTTGCCACTACTGGAGATGG + Intergenic
978899428 4:113929443-113929465 GATGTTGCCACTACTGGGGATGG + Intronic
978966500 4:114748335-114748357 TATGTTGCCACTACTGGGGATGG - Intergenic
979075381 4:116263801-116263823 GATGTTGCCAGGACTGGGGATGG - Intergenic
979766679 4:124472198-124472220 GATGTTGCCACTACCAGGGATGG - Intergenic
980386581 4:132093087-132093109 GATGTTGCCACCATTGGGGGTGG + Intergenic
980388249 4:132113698-132113720 GATGTTGCCACTATTAGGGATGG + Intergenic
980406245 4:132356419-132356441 GATATTGCCACTATTGGGGATGG + Intergenic
980628326 4:135405062-135405084 GATGTTGCCACTACTGGGAATGG - Intergenic
981462450 4:145029199-145029221 GATGTTGCCACTACTGGGGATGG - Intronic
981834509 4:149039857-149039879 GATGTTGCCACTACTGGGGATGG - Intergenic
982526859 4:156489814-156489836 GATGTAGCCATTACTGGGGATGG - Intergenic
982835155 4:160113965-160113987 GATGTTGCCATTACTGCGGATGG - Intergenic
982847446 4:160271726-160271748 GATGTTGCCACTACTGGGAATGG - Intergenic
983785299 4:171722135-171722157 GATGTTGCCACTACTGGGGATGG + Intergenic
984061405 4:174992408-174992430 GATGTTGCCACTACTGAGGATGG + Intergenic
984400795 4:179261563-179261585 GATGTTCCTACCACTGGAGGTGG - Intergenic
985390515 4:189487701-189487723 CATCTTCCTACCACTGGGGGAGG + Intergenic
986086773 5:4460115-4460137 GATGTTGCCACTACTGGGGATGG - Intergenic
986338407 5:6771053-6771075 GCTGTTGCCTCCACTGGTTGGGG + Intergenic
986938655 5:12921334-12921356 GATGTTGCCACTACTGGGGATGG + Intergenic
986955876 5:13148739-13148761 GATGTTGCCACTACTGAGGATGG + Intergenic
987152819 5:15059076-15059098 GATGTTGCCAATACTGGGGATGG - Intergenic
987578696 5:19760932-19760954 GATGTCGCCACTACTGGGGATGG + Intronic
987657454 5:20824236-20824258 GATGTTGCCACTACTGGGGATGG + Intergenic
987885279 5:23805312-23805334 GATGTTGCCACTACAGGGGACGG - Intergenic
988080159 5:26404013-26404035 GATGTTGCCACTACTGGGGATGG + Intergenic
988107423 5:26769892-26769914 GATGTTGTCACTACTGGGGATGG - Intergenic
988169519 5:27635421-27635443 GATGTGGCCACTACTGGAGATGG + Intergenic
988188439 5:27898646-27898668 GATGTTGCCACTACTGGGGATGG - Intergenic
988233613 5:28509683-28509705 GATGTTGCCACTTCTGGGGATGG + Intergenic
988561778 5:32288282-32288304 GATGTTGCCACTACTGGGGATGG - Intronic
988766090 5:34379710-34379732 GATGTTGCCACTACTGGGGATGG - Intergenic
989045657 5:37270837-37270859 GATGCTGCTACTACTGGGGATGG + Intergenic
989097427 5:37794398-37794420 GTGGTTGCCACTACTGGGGATGG - Intergenic
989457991 5:41664368-41664390 GATATTGCCACTACTGGGGATGG + Intergenic
989486690 5:41998680-41998702 GATGTTGTCACTACTGGGGATGG + Intergenic
991507751 5:67342921-67342943 GATGTTGCAGCCACTGGGACTGG - Intergenic
991945784 5:71897540-71897562 GATGTTGCCACTATTGGGGATGG - Intergenic
992242552 5:74786970-74786992 GATGTTACCACTACTGGGGATGG - Intronic
993319503 5:86456005-86456027 GATATTGCCACTACTGGGGATGG - Intergenic
994291735 5:98034581-98034603 GATGTTGCCACTGCTGGGATGGG + Intergenic
994958120 5:106561732-106561754 GATGTTGCCCCTACTGGGGATGG - Intergenic
995269897 5:110208070-110208092 AATGTTGCCACTACTGGGTATGG + Intergenic
995279417 5:110316503-110316525 AATGTTGCCACTACTGGGGATGG + Intronic
995776648 5:115730275-115730297 GATGTTGCCACTACTGGGGATGG + Intergenic
996165292 5:120215132-120215154 GATATTGCCACTACTGGGTGTGG + Intergenic
996825216 5:127675215-127675237 GATATTGCCACTACTGGGGATGG - Intergenic
996909044 5:128634620-128634642 GATGTTACCACCACTAGGGGTGG + Intronic
999351045 5:150872280-150872302 GATGTTGCCCCCACTGGGGATGG - Intronic
1000111148 5:158109276-158109298 GAAGTTCCCACCCCTGGGGCTGG + Intergenic
1000730431 5:164828357-164828379 AATGTTGCCACTACTGGGGATGG - Intergenic
1002829218 6:804142-804164 GATGTGGCCACCACTGGAACAGG + Intergenic
1003696251 6:8408700-8408722 GATGTTGCCGCTACTGGGGATGG + Intergenic
1004824651 6:19405829-19405851 AATGTTGTCACCACTGGGGATGG + Intergenic
1005512919 6:26528291-26528313 TATGTTGCCACCTCTGAAGGAGG - Intergenic
1005622817 6:27635593-27635615 GATGTTGCCACTACTGGGGCTGG + Intergenic
1006061999 6:31430555-31430577 GATGTTGCCAATACTAGGGACGG - Intergenic
1006788940 6:36686282-36686304 GATGATGCCCCCACTCGGTGAGG - Exonic
1008399934 6:51052879-51052901 GATGTTGCCACTACTGGGGATGG - Intergenic
1008814926 6:55553964-55553986 GATGTTGTCAGCACTGGAGGTGG - Intronic
1009390454 6:63137657-63137679 GATGTTGCCACTACTGGGGATGG + Intergenic
1009887449 6:69640672-69640694 GATGTTGCCAAAACTGAGAGTGG + Intergenic
1010323212 6:74537790-74537812 GACGTTGCCACTACTGGGGAAGG - Intergenic
1010552086 6:77236119-77236141 GATGTTGCCACTACTGGGGATGG - Intergenic
1010818244 6:80385505-80385527 GATGTTGCCACTACTGGGAATGG - Intergenic
1010938499 6:81888307-81888329 GATGCTGCCACCACTGAGGGTGG + Intergenic
1011068687 6:83358728-83358750 GATGTTGCCACTACTGGAGATGG - Intronic
1011665905 6:89633257-89633279 GATGTTGCCATCTCTGGGTGAGG - Exonic
1012001600 6:93661859-93661881 GATGTTGCCACCACTGAGCATGG - Intergenic
1012344235 6:98167729-98167751 GATGTTGCCACTACTGGGGATGG - Intergenic
1012921141 6:105222079-105222101 AATGTTGCCACTACTGGTGATGG + Intergenic
1014416663 6:121192784-121192806 GATGTTGCCACTACTGGGGATGG - Intronic
1014456188 6:121637212-121637234 GATGTTACCACTACTGGGAATGG + Intergenic
1014534552 6:122599239-122599261 GATGTTGCCACTACTGGGGATGG + Intronic
1014969903 6:127801608-127801630 GATGTTGTCACTACTGGGGATGG - Intronic
1015475391 6:133654721-133654743 GATGTTGCCACTACTGGGGTTGG - Intergenic
1016120247 6:140335244-140335266 GATGTTGCCACCATTGGAGGTGG + Intergenic
1016147642 6:140695316-140695338 GATGTTGCCACTACTGGGGATGG + Intergenic
1016420329 6:143875882-143875904 GATGTTGCTACCACTGGGGAGGG + Intronic
1016576598 6:145575198-145575220 GATGTTGCCACTACTGGGGATGG + Intronic
1017977460 6:159370646-159370668 GATGTTGCCACTACCGGGGATGG + Intergenic
1018107680 6:160504407-160504429 GATGTTGCCAGTACTGAGGATGG + Intergenic
1018123328 6:160658134-160658156 GATGTTACCACTACTGGGGATGG + Intronic
1018469320 6:164082102-164082124 GTTGTTGTCAGCACTGGGGCTGG - Intergenic
1018535336 6:164813063-164813085 TATGTTTCCACCACTGGGGGTGG + Intergenic
1018569618 6:165195469-165195491 GATGTTGCCACTACTGGGGATGG - Intergenic
1018599521 6:165524925-165524947 GATGTTGCCACCACTGGGGATGG - Intronic
1018626915 6:165788908-165788930 GATGGTGCACACACTGGGGGTGG - Intronic
1018695234 6:166385720-166385742 ACTGTTGCCACCACTGGGCTGGG + Intergenic
1019040455 6:169099834-169099856 GATGTTGCCACCACTGGGGGTGG - Intergenic
1019327961 7:447743-447765 CAAGATGCCACCATTGGGGGAGG + Intergenic
1020364041 7:7360723-7360745 GATTTTCCCACCACTTGGTGTGG + Intronic
1020396366 7:7722931-7722953 AATGTTGCCAATACTGGGGATGG - Intronic
1020709973 7:11595013-11595035 GATGTTGTCACTACTGGGGATGG - Intronic
1022078541 7:26997738-26997760 GATATTGTCACTACTGGGGATGG - Intergenic
1024040227 7:45547284-45547306 GATGTAGCCACTACTGGGGATGG + Intergenic
1024884703 7:54127254-54127276 GATGTTGCCACTACTGGGAATGG + Intergenic
1024958609 7:54951684-54951706 GATGTTGTCACTACTGGGGATGG + Intergenic
1025004626 7:55344409-55344431 GGAGTTGCTGCCACTGGGGGCGG + Intergenic
1025761807 7:64402888-64402910 GATGTTGCCACTCCTGGGGATGG - Intergenic
1025849761 7:65236417-65236439 GCTGGTGCCACTACTGTGGGTGG + Intergenic
1027443550 7:78246067-78246089 GATGCAGCAACCACTGGGAGGGG - Intronic
1028043523 7:86088863-86088885 GATGTTGCTACTACTGGGGCTGG - Intergenic
1028141394 7:87279379-87279401 GATGTTGCCACTGCTGGGGATGG - Intergenic
1029254105 7:99257422-99257444 GAAGTGGACACCACTGAGGGTGG + Intergenic
1029424727 7:100488559-100488581 GATGTTGCCGTCAATGGTGGAGG - Exonic
1030191719 7:106817201-106817223 GATGCTGGTGCCACTGGGGGTGG - Intergenic
1030277107 7:107733508-107733530 GATGTTCCCACTACTGGGGATGG - Intergenic
1030368203 7:108670353-108670375 GATGTTGCCACTACTGGGGGTGG - Intergenic
1031236506 7:119185402-119185424 AATTTTGCCACCACTGTGGTAGG - Intergenic
1031474786 7:122207944-122207966 GATGTTGCCACTACTGGGGATGG + Intergenic
1031676223 7:124615738-124615760 GATGTTGCCACTACTGGGGATGG - Intergenic
1031779460 7:125942848-125942870 GATGTTGCCACTACCAGGGATGG + Intergenic
1032019095 7:128396683-128396705 GCTGCTGTCACCACTGGGGGTGG + Exonic
1032153463 7:129449540-129449562 GATATTGCCACTACTGGGGATGG + Intronic
1034169597 7:149052768-149052790 GATGTTGCCACTACTGGAGATGG - Intergenic
1039469154 8:37802890-37802912 GATCTTGGACCCACTGGGGGCGG - Intronic
1040916491 8:52570438-52570460 GATTTTGCCACTACTGGGGATGG + Intergenic
1041985847 8:63921881-63921903 GATGTAGCCACTACTGGGGATGG - Intergenic
1043257669 8:78156782-78156804 GATGTTGCCACTACTGGGGATGG - Intergenic
1043469467 8:80547932-80547954 GAGAATGCCAGCACTGGGGGTGG - Intergenic
1044150466 8:88770523-88770545 GATGTTGCCACTACTAGGGATGG - Intergenic
1044202051 8:89449881-89449903 GATTTTGCCACTACTGGAGATGG - Intergenic
1044286341 8:90415299-90415321 GATGTTGCCACTACTGGGGGTGG + Intergenic
1044487501 8:92769754-92769776 AATGTTGCCACTACTGAGGATGG + Intergenic
1044507277 8:93036664-93036686 GAAGTGGCCACCACTGAGGCTGG - Intergenic
1045221419 8:100204058-100204080 GATGTTGCCACTACTGGGTATGG - Intronic
1045498658 8:102728809-102728831 GATGGTGGAACCACAGGGGGAGG + Intergenic
1045826506 8:106404152-106404174 GATGCTGCTACCACTGGGTGTGG + Intronic
1046197219 8:110881647-110881669 AATGTTGCCACTACTGGGAATGG - Intergenic
1046417996 8:113940425-113940447 GATGTTGCCACTAGTGGGGATGG + Intergenic
1048084231 8:131159753-131159775 AATGTCGCCACTACTGGGGATGG + Intergenic
1050447402 9:5739727-5739749 GATGTTGCCACTATTGGGGATGG + Intronic
1050482305 9:6100001-6100023 GATGTTGCCACTACTGGGGATGG - Intergenic
1051881780 9:21848035-21848057 GATGCTGCCACTTCTGGGGATGG - Intronic
1052151779 9:25126126-25126148 GTTGTTGCCACTACTGGGAATGG + Intergenic
1052227268 9:26105771-26105793 GGTGTTGCCACTACTGGGAATGG - Intronic
1052368284 9:27638228-27638250 GACGTTGCCACTACTGGGGATGG - Intergenic
1052718445 9:32146516-32146538 GATGTTGCCACCACTGGGGATGG - Intergenic
1052997659 9:34559744-34559766 GCTCCTGCCACCGCTGGGGGTGG + Intronic
1053167795 9:35856809-35856831 GATGGTGACACCACTTTGGGTGG + Intergenic
1053620521 9:39809754-39809776 GCGGTGGCCACCACTGTGGGCGG - Intergenic
1055205294 9:73722656-73722678 GATGTTGCCACGAATGGGGATGG - Intergenic
1056314583 9:85375553-85375575 GATTTTGCCACCACTGGCGATGG + Intergenic
1057316230 9:93970528-93970550 GATGTTGCCACTACTGGGGATGG - Intergenic
1059066572 9:111091915-111091937 GATGTTGCCACTACTGGAGATGG - Intergenic
1060772350 9:126341755-126341777 TGGGTTGTCACCACTGGGGGAGG - Intronic
1062367556 9:136218472-136218494 GCTGTTCCCAGCACTGGGGCTGG - Intronic
1062594712 9:137294267-137294289 GATGTTGACGCCACCGAGGGAGG + Intergenic
1185844843 X:3428086-3428108 GATGTTCCAACAAATGGGGGTGG - Intergenic
1185874616 X:3692302-3692324 GTGGTTGTCACTACTGGGGGTGG - Intronic
1186279286 X:7975550-7975572 GATGTTGCCATTACAGGGGATGG - Intergenic
1186444791 X:9618002-9618024 TCAGTTGCCACAACTGGGGGAGG - Intronic
1186470142 X:9814687-9814709 GATGTTGCCATTACAGGGGATGG + Intronic
1186511865 X:10135536-10135558 GATGTGGCAAACACTGTGGGAGG + Intronic
1187042785 X:15614567-15614589 GTTGTTAACACCACTTGGGGGGG - Intergenic
1187604528 X:20869456-20869478 GATGTTGCCACCACTGGGGATGG - Intergenic
1188529886 X:31128062-31128084 GATGTTCCCATCATTTGGGGAGG + Intronic
1189601381 X:42630290-42630312 GATGTTACCATAACTGGGAGGGG - Intergenic
1191630440 X:63315817-63315839 GATGTTCCCACTACTGGGGATGG + Intergenic
1191659158 X:63632596-63632618 GATGTTGCCATTACTGGGGATGG + Intergenic
1191945916 X:66535301-66535323 GATGTTGCCACTACTGGAGATGG - Intergenic
1192262806 X:69517588-69517610 GATGTTGACAACACTGGGGTGGG + Intronic
1192298063 X:69870593-69870615 GACGTTGCCACTACTAGGGATGG + Intronic
1192661911 X:73050366-73050388 GATGTTGTCACCACTGGGGGTGG + Intergenic
1192917734 X:75671891-75671913 GATGTTGCGATCTCTGGGTGAGG + Intergenic
1192940758 X:75909512-75909534 GATATTGCCACTACTGGGGATGG - Intergenic
1193053093 X:77122571-77122593 GATGTTGTCATTACTGGGGATGG - Intergenic
1193155985 X:78174625-78174647 GATGTTGCCACGACTAGGGGTGG + Intergenic
1193297454 X:79850090-79850112 GATGTTGCCACTACTGGGGATGG - Intergenic
1193433231 X:81438028-81438050 GATGTTGCCACTACTGGTGATGG + Intergenic
1193574018 X:83177578-83177600 GATGTTGCCACCACTGGGGATGG + Intergenic
1193832600 X:86307511-86307533 GATGTTGCCACTACTGGAGATGG - Intronic
1193869651 X:86780957-86780979 GATGTTGCCACTACTGGGGATGG + Intronic
1193876945 X:86872693-86872715 GATGTTGCCACTACTGGGGATGG - Intergenic
1193879156 X:86900347-86900369 GATGTTGCCACTACTGAGGATGG + Intergenic
1193978907 X:88157603-88157625 GTTGTTGACACCACTGGGGGTGG - Intergenic
1194179928 X:90698565-90698587 GATCTTGCCACTACTGGGGATGG + Intergenic
1194833595 X:98656194-98656216 GATGTTGCCACTAATGGGAATGG - Intergenic
1195749199 X:108147284-108147306 GATATTGCCACTACTGGAGATGG + Intronic
1195782715 X:108482474-108482496 GATGTTGCCACTACTGGGGATGG + Intronic
1195810006 X:108818433-108818455 GATGTTGCCACTACTGGGGATGG + Intergenic
1195976183 X:110530080-110530102 AATGATCCCACCACTGGGCGTGG - Intergenic
1196275470 X:113761505-113761527 GATGTTGCCACTACTGGGGATGG - Intergenic
1197001953 X:121450444-121450466 GATGTTGCCATTACTGGGGATGG - Intergenic
1197044121 X:121975838-121975860 AATGTTGCCACCACTGGGAATGG - Intergenic
1197074401 X:122337507-122337529 GATGTTGCCACTACTGGGGTGGG + Intergenic
1197097128 X:122610233-122610255 GATGTTGCCACTACTGGGGATGG - Intergenic
1197372363 X:125640457-125640479 GAGGTTGCCACCACTAGGGGAGG + Intergenic
1197404747 X:126036580-126036602 GATGTTGCCACTACTGGGGATGG - Intergenic
1197426083 X:126298221-126298243 GATGTTGCCAATACTGGGGATGG + Intergenic
1197469310 X:126848408-126848430 GCTGTTGCCTGTACTGGGGGAGG - Intergenic
1197497817 X:127207581-127207603 GATCTTGCCACCACTGGGGGTGG + Intergenic
1197536020 X:127690193-127690215 AATGCTGCCACTGCTGGGGGTGG + Intergenic
1197537285 X:127706659-127706681 AATGTTGCCACCACTTGGGATGG - Intergenic
1197591514 X:128416738-128416760 GATGTCGCCACTACTGTGGATGG - Intergenic
1197956205 X:131951266-131951288 GGTGTTGCCATTACTGGGGATGG - Intergenic
1198783384 X:140260397-140260419 GATGTTGCCGCTACTGGGGATGG + Intergenic
1198794557 X:140381651-140381673 GATGGTGCCACAACTGAGGTGGG - Intergenic
1199627427 X:149753202-149753224 AATGTTGCCACTACTGGGGATGG + Intergenic
1200121387 X:153792630-153792652 GATGTTGCCATCTGTGAGGGAGG - Intronic
1200340641 X:155391694-155391716 GATGTTGCCACTACTGGGGATGG + Intergenic
1200520949 Y:4209432-4209454 GATGTTGCCACTACTGCGGATGG - Intergenic
1200526584 Y:4280734-4280756 GATCTTGCCACTACTGGGGATGG + Intergenic
1201400309 Y:13597599-13597621 GATGTTGCCACCACTGGGGCTGG + Intergenic
1202368655 Y:24183117-24183139 GATGTTCTCACCACTGGGGGCGG - Intergenic
1202502130 Y:25487000-25487022 GATGTTCTCACCACTGGGGGCGG + Intergenic