ID: 933271971

View in Genome Browser
Species Human (GRCh38)
Location 2:80242723-80242745
Sequence CTGCCCTATCTGGATAAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 101}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933271971_933271979 20 Left 933271971 2:80242723-80242745 CCTCCCTTATCCAGATAGGGCAG 0: 1
1: 0
2: 0
3: 6
4: 101
Right 933271979 2:80242766-80242788 AGCTGTTCCTCTGCCAGCCTGGG 0: 1
1: 0
2: 1
3: 33
4: 344
933271971_933271978 19 Left 933271971 2:80242723-80242745 CCTCCCTTATCCAGATAGGGCAG 0: 1
1: 0
2: 0
3: 6
4: 101
Right 933271978 2:80242765-80242787 GAGCTGTTCCTCTGCCAGCCTGG 0: 1
1: 0
2: 0
3: 26
4: 266
933271971_933271975 -7 Left 933271971 2:80242723-80242745 CCTCCCTTATCCAGATAGGGCAG 0: 1
1: 0
2: 0
3: 6
4: 101
Right 933271975 2:80242739-80242761 AGGGCAGCTGAACAGCAGTCTGG 0: 1
1: 0
2: 1
3: 20
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933271971 Original CRISPR CTGCCCTATCTGGATAAGGG AGG (reversed) Intronic
901790281 1:11650260-11650282 CTGCCCCAGCTGGCTGAGGGTGG + Intronic
902745828 1:18473757-18473779 CTGACCTAACTGAATAAGGCGGG + Intergenic
903976066 1:27151029-27151051 CTGCCTTGTAGGGATAAGGGTGG - Intronic
907285983 1:53379984-53380006 GTGCCCTGTCTGTATAATGGAGG + Intergenic
910089891 1:83449958-83449980 ATTCCCTTTCTGGAGAAGGGAGG + Intergenic
910482923 1:87678016-87678038 CTGCTCTATTTGGATAAGGATGG - Intergenic
913129406 1:115826330-115826352 CTGCTATATTTGGATAAGAGAGG + Intergenic
915505688 1:156354868-156354890 CTGCTTGATCTGGAGAAGGGGGG - Intronic
920914296 1:210247651-210247673 CTGCCCTTTCTGGAGCTGGGAGG + Intergenic
922670932 1:227508305-227508327 CTGCCCTTTCTGGTTAAAGGGGG + Intergenic
1065072034 10:22035169-22035191 CTGCCCTATCTGGCTATGGTAGG + Intergenic
1065770911 10:29077719-29077741 CTGCCCCATCTGAGTAAGAGAGG + Intergenic
1070040375 10:72772302-72772324 CTGCCTAATCTGAATAGGGGAGG - Intronic
1070635098 10:78119242-78119264 CTTCCCTAACTGGATATGGAGGG + Intergenic
1072058923 10:91788976-91788998 CAGCCATATCTGCATTAGGGGGG - Intergenic
1072470370 10:95707377-95707399 CTGCCCTTTCTGAATTGGGGTGG - Intergenic
1074258542 10:111828606-111828628 CTGCCCATCCTGGATCAGGGTGG - Intergenic
1078381791 11:10848942-10848964 CTGCCTTATCTGTTTAAGTGAGG + Intronic
1079110018 11:17600091-17600113 CTGCCCTTTCTGACTATGGGTGG + Intronic
1086880650 11:92149669-92149691 CTGCCCAAACTGGAAAAAGGAGG - Intergenic
1087981086 11:104615675-104615697 CTGCCTTATCTGAAGAAAGGGGG + Intergenic
1089640761 11:119845734-119845756 ATGCCCCATTTGGAGAAGGGGGG - Intergenic
1096491115 12:52013606-52013628 CTCCCCTTTCTGGCTAAGGTAGG + Intronic
1097124954 12:56766678-56766700 CAGCCCTATGTGGATGAGAGGGG + Intronic
1102227048 12:111236069-111236091 CTTTCCTATCTGGAAAAGGGGGG + Intronic
1112565002 13:100545300-100545322 CTTCCCCATCTGCAAAAGGGGGG - Intronic
1116543716 14:46135426-46135448 CTGGCATATCTGCATAAGCGAGG - Intergenic
1118774377 14:68964479-68964501 CAGCCCTGACTGGAGAAGGGAGG - Intronic
1119499650 14:75113601-75113623 CTGCCCTAACTGAACAAGTGAGG - Intronic
1125482428 15:40089757-40089779 CTCCCCTCTCTGGATCAAGGTGG - Exonic
1125598211 15:40900856-40900878 CTGGCCTATCTGGAGCAGGCTGG + Exonic
1125651446 15:41321010-41321032 CTGCCCCATCTTGAGAAGTGAGG + Intronic
1126886561 15:53157535-53157557 CTGTCTTATCTGTAAAAGGGAGG - Intergenic
1129952540 15:79604841-79604863 CTGCCCTATCCAGCCAAGGGAGG - Intergenic
1132149043 15:99446944-99446966 CTGCCCCCGCTGGGTAAGGGCGG - Intergenic
1136117748 16:28105990-28106012 CTTCCCAATCTGGAGATGGGGGG + Intronic
1139325158 16:66146876-66146898 CTAGCCTAGCTGCATAAGGGTGG - Intergenic
1142398980 16:89849302-89849324 CTGCCCAAGCTGGATCAGGACGG - Intronic
1148223803 17:45883992-45884014 GTGCCATATCTGTATTAGGGGGG + Intergenic
1149450968 17:56749781-56749803 CTTCCCTATCTGTAAAATGGGGG + Intergenic
1155505699 18:26530503-26530525 GTGCCCTCTGTGGATGAGGGAGG - Intronic
1156486118 18:37466789-37466811 TTCCCCAATCTGGATAAGGCTGG - Intronic
1156820336 18:41364742-41364764 CTCCACTATAAGGATAAGGGGGG + Intergenic
1161337081 19:3720520-3720542 CAGCCCTGACTGGATAAGGCTGG + Intronic
1162389291 19:10379681-10379703 TTTCCCCATCTGGAAAAGGGAGG + Exonic
1162459837 19:10808206-10808228 CTGCCCAATGGGGAGAAGGGAGG - Intronic
1162491494 19:10995232-10995254 CTGCCTTCTCTGGAAAATGGAGG + Intronic
1162602100 19:11676990-11677012 CTGCCCTGTCTGGGAAAGTGAGG - Intergenic
1162986804 19:14276062-14276084 CTGCCTTAACTGGCTAATGGTGG + Intergenic
1163665197 19:18599960-18599982 CTTCCCTATCTGTAAAATGGGGG - Intronic
1163681474 19:18684673-18684695 CTGCCCTCTCAGGACCAGGGTGG + Intronic
1164883029 19:31752027-31752049 CTCCCCTCTCTGGATAATGTGGG - Intergenic
927476940 2:23420755-23420777 GTGCCATTTCTGGAAAAGGGTGG - Intronic
932466169 2:71925748-71925770 CTGCCATATCTCGAGAAGGAGGG - Intergenic
933271971 2:80242723-80242745 CTGCCCTATCTGGATAAGGGAGG - Intronic
939782391 2:146465139-146465161 GTGGCCTGTCTGGCTAAGGGAGG + Intergenic
1168834014 20:864891-864913 TTCCCCCATCTGGATAATGGGGG - Intergenic
1171992186 20:31705061-31705083 TTGTCCTACCTGGATAAGGAAGG - Intronic
1178157387 21:29871099-29871121 CTGCTCTCCCTGGATAAGGCTGG + Intronic
1179610161 21:42545107-42545129 CTGCCCAAATTGGATCAGGGAGG - Intronic
950726553 3:14920898-14920920 CTGCCCCATCTGGAGGAGTGAGG + Intronic
952260673 3:31737005-31737027 TTGCCATATCTGGATAATGATGG - Intronic
953740535 3:45534939-45534961 TTGTCCTATCTAGATGAGGGTGG + Intronic
954224486 3:49173323-49173345 CTGCCTTTTCTGGCTAAGGTGGG + Intronic
955868686 3:63413832-63413854 CTGCCCTAGAAGGATAATGGAGG + Intronic
955881230 3:63548351-63548373 CTTCCCTATCTGCATAATGTTGG + Intronic
958514268 3:95092294-95092316 GTTCACTATCTGGGTAAGGGGGG + Intergenic
959598480 3:108153062-108153084 CTGCCCTCTCTGGAAAATGAAGG - Intergenic
961129013 3:124448010-124448032 AAGCCCTATTTGGAGAAGGGCGG - Intronic
962897700 3:139730933-139730955 CTGCCCTATGCTGCTAAGGGTGG + Intergenic
966001694 3:174956691-174956713 CTGCCAGTTCTGGAGAAGGGTGG + Intronic
966711037 3:182973077-182973099 CTCCCCCATGTGGATAAGAGGGG - Intronic
983033639 4:162835604-162835626 CTGCCCTTTCTGGAATAGAGGGG + Intergenic
985484261 5:140034-140056 CGGCTCTTTCTGGATAAGGAAGG - Intergenic
987111781 5:14694274-14694296 CTGCCCAATCAGGCTAAGGGTGG + Exonic
991643245 5:68775240-68775262 CTGTCCTATTTGGAAGAGGGTGG + Intergenic
994111887 5:96015617-96015639 CCTCACTATCTGGATAAGGTTGG - Intergenic
996467138 5:123816170-123816192 CTAGCCTCCCTGGATAAGGGAGG - Intergenic
998225808 5:140325394-140325416 CTCTCCTCTCTGGATAATGGTGG + Intergenic
1000512810 5:162204638-162204660 TTGCCCTGTCTGGAGAAGGGTGG - Intergenic
1002434473 5:179222297-179222319 CAGCCCTATTTCGAGAAGGGAGG + Intronic
1003771002 6:9300492-9300514 CTGCAACACCTGGATAAGGGTGG + Intergenic
1004507270 6:16257101-16257123 CTCCCCTCTCTGGAAAATGGAGG - Intronic
1006931969 6:37694081-37694103 CAGACCTGTGTGGATAAGGGAGG - Intronic
1008344227 6:50406487-50406509 ATGCCCTATATGGATCAGGAGGG + Intergenic
1008385215 6:50881239-50881261 CTGGCCTATCTGGGGGAGGGGGG + Intergenic
1008880404 6:56375527-56375549 TTGCCCTGTCAGGATGAGGGTGG + Intronic
1011690446 6:89862292-89862314 CTGCCAAATCTGGAAAAGGAAGG + Exonic
1011747077 6:90416790-90416812 CTGCCCCATCTTGAGAAAGGTGG + Intergenic
1014320918 6:119927109-119927131 CTGCCCTATATGGATGGGAGTGG - Intergenic
1021498296 7:21300848-21300870 CTGCCCCTTCTGGATATGGTGGG - Intergenic
1026979212 7:74516791-74516813 CTGCCCAAAGTGGACAAGGGGGG - Intronic
1027173849 7:75890872-75890894 CTGCCCTGTCTGGGGATGGGAGG - Intergenic
1027306746 7:76906405-76906427 ATTCCCTTTCTGGAGAAGGGAGG + Intergenic
1027735475 7:81927404-81927426 CTGCCATATATGAATAAGAGTGG - Intergenic
1032793036 7:135256453-135256475 CTGCCATATATGGAGAAGGAGGG - Intronic
1034188838 7:149198380-149198402 GTGCCCTATCTGGAAAGGGTGGG - Exonic
1035194515 7:157205537-157205559 CTGCCTTAACTGGACAGGGGTGG - Intronic
1056074523 9:83024848-83024870 CTGCCCTGTCTACATAGGGGCGG - Intronic
1056338958 9:85604418-85604440 CAGCCATATCTGCATTAGGGGGG - Intronic
1061485969 9:130920686-130920708 CTGGCCTATCTGGTTTAAGGAGG - Intronic
1187611807 X:20951547-20951569 CTGCCCCATGTGGAAGAGGGAGG - Intergenic
1189682477 X:43530794-43530816 CTGCTCTATTTGGAGAGGGGAGG + Intergenic
1190874094 X:54447387-54447409 CTGCACTACATGGAGAAGGGTGG - Exonic
1191896190 X:65995865-65995887 CTGCCCTTCCTGGCAAAGGGAGG - Intergenic
1194711847 X:97245176-97245198 TTGCCCTGTCTGGAGAAGAGTGG + Intronic
1200063724 X:153495100-153495122 CAGCCCTACCTGGAGAGGGGAGG - Exonic
1200332939 X:155316912-155316934 CTGCCCAATCAGATTAAGGGTGG + Intronic