ID: 933272602

View in Genome Browser
Species Human (GRCh38)
Location 2:80249242-80249264
Sequence TAGAGTTCTAAAGAACCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 113}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933272599_933272602 -3 Left 933272599 2:80249222-80249244 CCTTCCTCTGACCATTATGATAG 0: 1
1: 0
2: 0
3: 8
4: 124
Right 933272602 2:80249242-80249264 TAGAGTTCTAAAGAACCTGCAGG 0: 1
1: 0
2: 0
3: 15
4: 113
933272598_933272602 9 Left 933272598 2:80249210-80249232 CCTTTTATTTATCCTTCCTCTGA 0: 1
1: 0
2: 5
3: 64
4: 683
Right 933272602 2:80249242-80249264 TAGAGTTCTAAAGAACCTGCAGG 0: 1
1: 0
2: 0
3: 15
4: 113
933272600_933272602 -7 Left 933272600 2:80249226-80249248 CCTCTGACCATTATGATAGAGTT 0: 1
1: 0
2: 1
3: 7
4: 117
Right 933272602 2:80249242-80249264 TAGAGTTCTAAAGAACCTGCAGG 0: 1
1: 0
2: 0
3: 15
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933272602 Original CRISPR TAGAGTTCTAAAGAACCTGC AGG Intronic
900657199 1:3764370-3764392 TAGATTCATAAAGAACGTGCTGG - Intronic
905243944 1:36599403-36599425 TACATTTTTTAAGAACCTGCTGG + Intergenic
906354924 1:45096764-45096786 TACAGTTCTAAACAATCTACAGG - Intronic
908215012 1:61942847-61942869 CAGACTTTTAAAGAAACTGCTGG - Intronic
910412037 1:86956310-86956332 AAGAGTAATAGAGAACCTGCAGG + Intronic
910710409 1:90173969-90173991 TAGAGTTGTGAAAAATCTGCTGG + Intergenic
911033883 1:93518121-93518143 TAGAACTCTAAAGAAACTTCTGG - Intronic
911785880 1:101946724-101946746 TAGAGTTCAGTAGAACCTCCTGG - Intronic
912739918 1:112184740-112184762 TAGACTTCTAAGAAACCTGGAGG - Intergenic
913158397 1:116122991-116123013 TAGAGTTAGACAGAACCAGCTGG + Intronic
919628384 1:199935123-199935145 TAGAGTTCTCAAGAACCTAGAGG - Intergenic
920049997 1:203158313-203158335 TATAGTTGTAAAGAACTTGGTGG - Intronic
923279321 1:232427278-232427300 TCAAGTTCTGAAGAACCTGCTGG - Intronic
1063050304 10:2439917-2439939 TAGAGTTAGCAGGAACCTGCTGG + Intergenic
1063716570 10:8533400-8533422 TCACGTTGTAAAGAACCTGCTGG - Intergenic
1064953307 10:20878939-20878961 TAGAGTTGGAAAGAGCCTCCCGG + Intronic
1068593621 10:58876923-58876945 TAGTGTTCTATAGAACTGGCAGG - Intergenic
1076484834 10:130809270-130809292 GAAAGTGCTAGAGAACCTGCGGG - Intergenic
1079899097 11:26159025-26159047 TAGATTTCTGAAGAATCTTCTGG + Intergenic
1081361977 11:42191047-42191069 TACAGTGCTGAAGAACCTGCTGG + Intergenic
1081559919 11:44204251-44204273 TAGAGTTCTCCAGAATCTACAGG + Intronic
1085191495 11:74628982-74629004 TAGAGTTCTCTAGAGACTGCTGG - Intronic
1090250606 11:125248235-125248257 CAGGGTTCTAATGAACCTGAAGG + Intronic
1090462461 11:126904077-126904099 TAGAGTTGGAAAGGACCTTCAGG - Intronic
1091112667 11:132984662-132984684 TAGAGTTCTAAGAAAGATGCTGG - Intronic
1094093871 12:26681530-26681552 TAGAGTTCTAAAGGACCTAAAGG - Intronic
1098767666 12:74510065-74510087 GAGAGTTCTAAATAAACTGCAGG + Intergenic
1099097947 12:78399234-78399256 TAGAGATGTAAAGAACCTGAGGG - Intergenic
1101869430 12:108551831-108551853 TACACTTCTAAATAATCTGCAGG + Intronic
1106341325 13:28829966-28829988 AAGAGTTGTAAACTACCTGCTGG + Intronic
1109721736 13:66283951-66283973 TAGAGTTGCAAAGAACATGATGG - Intergenic
1109721739 13:66283998-66284020 TAGAGTTGCAAAGAACATGATGG - Intergenic
1110733978 13:78912913-78912935 TACAGGTATAAAAAACCTGCAGG + Intergenic
1110781691 13:79473507-79473529 CTGAGTTCTAAAGAACTTACAGG + Intergenic
1115235744 14:31207466-31207488 TAGAGTTCCCAAGAAGCCGCAGG + Exonic
1115595378 14:34904034-34904056 CAAATTTCTAAAGAATCTGCAGG - Intergenic
1116872645 14:50082867-50082889 TAGATTATTAAAGTACCTGCTGG + Intergenic
1119109821 14:71961059-71961081 ATGAGTTCCAAAGAACCTGAGGG + Intronic
1120213470 14:81657389-81657411 TGGAGTTCCAAAGAAACTGAAGG + Intergenic
1125549830 15:40537108-40537130 TAGAATTCTAAAGGACCACCAGG + Intronic
1126288291 15:47041994-47042016 TAGAGTTCTAAAGTACATCATGG - Intergenic
1126471443 15:49015877-49015899 CAGAGATCTAAAGAACCTGAGGG + Intronic
1131888094 15:96941931-96941953 TATACTTCTAAAGAATCTGTGGG + Intergenic
1133318086 16:4896291-4896313 GAGAGTTCTTAAGAAGCTGCGGG - Intronic
1134056852 16:11175417-11175439 TAGAGTTCAAAAACACCAGCAGG + Intronic
1135178051 16:20248642-20248664 TTAAGTTCTAAACGACCTGCAGG + Intergenic
1139096628 16:63712161-63712183 TAAAGTCCTAAATAACCTCCTGG - Intergenic
1140207015 16:72941398-72941420 TACACTTCTATAGAGCCTGCTGG + Intronic
1144457079 17:15427716-15427738 TAGGTTTCTAAAGAACCTACAGG + Intergenic
1145734633 17:27218990-27219012 GAGTGTGCTCAAGAACCTGCAGG - Intergenic
1146225333 17:31061235-31061257 TAGTGTGCTCAGGAACCTGCAGG + Intergenic
1147951082 17:44108444-44108466 TAGGGTTCTAAAGATGCTGCTGG + Intronic
1157793881 18:50558039-50558061 AAGACTTCTAAAGAAACAGCTGG - Intergenic
929501786 2:42496564-42496586 TAGAGTTTGAAAGAACCTAGAGG + Intronic
931764527 2:65443076-65443098 TAGAGTTCTAAAGGACATTAAGG + Intergenic
933272602 2:80249242-80249264 TAGAGTTCTAAAGAACCTGCAGG + Intronic
933273831 2:80262827-80262849 TTTAGTTCTTAAGAACCTTCTGG - Intronic
934323969 2:91992749-91992771 TAGTGTTGTAATGAACATGCGGG - Intergenic
935556915 2:104519969-104519991 AAGAGTCCTTAAGTACCTGCTGG - Intergenic
935818883 2:106874050-106874072 TAGATTTATGAAGAACCTCCAGG + Intronic
943830648 2:192456502-192456524 TAGAGATCTAAAGTACATGATGG + Intergenic
944438378 2:199715967-199715989 TATATTTCTAAAGAACTTACCGG - Intergenic
947463938 2:230325094-230325116 TGAAGTTCTAAAAATCCTGCTGG - Intergenic
1172525116 20:35596052-35596074 TACAGTTTTAAATAGCCTGCAGG - Intergenic
1178126143 21:29517607-29517629 TAGTGTTTTACAGAACTTGCTGG - Intronic
1181976417 22:26733871-26733893 GAGAGATCTAAAGAGCCAGCTGG - Intergenic
1183159227 22:36100273-36100295 CAGAGTTCTAGAGTGCCTGCTGG - Intergenic
952775897 3:37046200-37046222 CACAGTTCTAAAAAACCTGTAGG - Intronic
958590018 3:96144612-96144634 TAGAATTCTATAAAACCTGAAGG + Intergenic
960206907 3:114913137-114913159 TAGTTTTCTGAAGAACCTCCAGG + Intronic
963577385 3:147078079-147078101 GAGAATTCTAAAGAACATTCTGG - Intergenic
965349984 3:167599910-167599932 TTGAGCTCTAAATAACCAGCAGG - Intronic
967038420 3:185665664-185665686 TAGAGTTCTAAAGGAGCTATGGG + Intronic
967185027 3:186937363-186937385 TAGACTTCTAAAGAACCGACGGG - Intronic
970617079 4:17778131-17778153 GACAGTTCTAGAAAACCTGCTGG + Intronic
970916273 4:21338948-21338970 TAGATTCCTATAGAACCTACAGG - Intronic
973318639 4:48787286-48787308 TTGTGTTCAAAAGCACCTGCAGG - Intergenic
977402905 4:96556385-96556407 TAGAGTTTTAAAAAGTCTGCAGG + Intergenic
978119771 4:105064726-105064748 TAGAGGTCCAAAGAAGCTCCTGG - Intergenic
978276238 4:106954130-106954152 TAGAGTAGAAAATAACCTGCAGG + Intronic
982912426 4:161161193-161161215 CAGAGTTCTGAAGAATATGCAGG + Intergenic
982980627 4:162130004-162130026 TAGAATTCTAAAGAGCCTAGAGG + Intronic
983803094 4:171960725-171960747 TAAGGTTCTAAAAATCCTGCTGG - Intronic
985113741 4:186571606-186571628 TAGTGTCCTAAAGAACCATCTGG + Intergenic
986449773 5:7852315-7852337 CAGAGTTCTAGAGATCCTTCTGG + Intronic
986585325 5:9310751-9310773 GCCAGTTCTAAAGAAGCTGCTGG - Intronic
986823350 5:11493450-11493472 TACAGCTCTAAGGAACCTTCAGG - Intronic
990121986 5:52466076-52466098 TAGATTTCTCAAAAACCTGCTGG + Intergenic
992843599 5:80721376-80721398 TAGAGTTCTCAAGCCCCTTCAGG + Intronic
993085629 5:83360236-83360258 TAGAGTTCTAGATAATCTACTGG + Intergenic
993421314 5:87704333-87704355 TATAGTAGTAATGAACCTGCTGG + Intergenic
994011914 5:94914701-94914723 TGGAGTTCTGCAGAACTTGCAGG - Intronic
996109269 5:119545629-119545651 AAGAGAGCTAAAGAACCTGTGGG - Intronic
1000514758 5:162226394-162226416 TAGATTTCAAAAGACCCTGAAGG - Intergenic
1002973957 6:2055192-2055214 AAGAGATCTTAAGAACCTGTGGG + Intronic
1004381581 6:15137368-15137390 TTGTGTTGTAAAGAAGCTGCTGG + Intergenic
1004708172 6:18143847-18143869 TAGGGTTTCAAAGAACATGCAGG + Intronic
1006563528 6:34934449-34934471 TAGTGTTATAAAGTACCTGGGGG - Intronic
1011469597 6:87694939-87694961 TAGAATTTTAAATTACCTGCAGG + Intronic
1013563889 6:111335988-111336010 TAGATTTTTAAAGAACATGAAGG + Intronic
1015747941 6:136530566-136530588 TAGAGTGGCAAAGAACCAGCTGG - Intronic
1016030508 6:139332730-139332752 TAGAGTTATGAAGAAGCTGCAGG - Intergenic
1016079566 6:139839295-139839317 TAGACTACTAAAGAACATGGTGG + Intergenic
1017224363 6:152003033-152003055 AAGAGTTCTGAAGAAGCTGATGG - Intronic
1018424112 6:163664453-163664475 TGGAGTTCAAGAGAACCTTCTGG - Intergenic
1020347462 7:7181711-7181733 TAGAGTACTAAAGAACCGCTTGG + Intronic
1028258953 7:88637077-88637099 TACAGTTCAAAAGAAACTCCAGG + Intergenic
1028479099 7:91285020-91285042 TAGAGTTCTATAGAAGTTTCAGG - Intergenic
1028871783 7:95778338-95778360 TGGCTTTCTAAAGAGCCTGCAGG - Intronic
1030846398 7:114418632-114418654 TAGTGTTTTAAAGAACTTTCTGG + Intronic
1033233825 7:139622728-139622750 TAAAGTTCTCTAGAACTTGCTGG - Intronic
1036055271 8:5245293-5245315 TGGAGTTCTTAAGAACATGATGG - Intergenic
1037850622 8:22324581-22324603 TAGAGTTCCTAAGGACCTGATGG - Intronic
1039118912 8:34124004-34124026 TAGAGACCTAAAGAAACTGAGGG + Intergenic
1039216182 8:35274119-35274141 TAAAGTTCAAAAGAGCTTGCTGG + Intronic
1039820063 8:41127104-41127126 TAGGGTTGTAAACAACCTGCAGG + Intergenic
1048421299 8:134280876-134280898 CAGAGTTCTAAAAATCCTTCTGG - Intergenic
1048421905 8:134285049-134285071 CAGAGTTCTAAAAATCCTTCTGG + Intergenic
1048531871 8:135257134-135257156 AAGAGTTCTAAGGAACATTCGGG - Intergenic
1048793087 8:138122406-138122428 TAGGGATCTAAGGAAGCTGCAGG + Intergenic
1049598129 8:143494029-143494051 TAAAACTCTAAAAAACCTGCCGG + Intronic
1050883165 9:10729688-10729710 TAGAGTTCTAAAGTACTTGGTGG + Intergenic
1057248939 9:93483977-93483999 TAGAATTCTGAGGAATCTGCTGG + Intronic
1058431083 9:104919978-104920000 TAGAGATCTGAGGAACATGCTGG - Intronic
1060259204 9:122058999-122059021 CAGAGTGCTTAAGGACCTGCAGG - Intronic
1188777598 X:34240159-34240181 GAGAATCCTAAAGAATCTGCTGG - Intergenic
1189158974 X:38791041-38791063 TAGAGAACCAAAGAAGCTGCAGG + Intergenic
1189248058 X:39578781-39578803 TAGAGTTCTAAAAAGCCTTGTGG - Intergenic
1200276945 X:154742131-154742153 TACATTTCTAAATAACCCGCAGG + Intronic