ID: 933279128

View in Genome Browser
Species Human (GRCh38)
Location 2:80313187-80313209
Sequence CACTGAAGACCTGTTGCTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 128}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933279128 Original CRISPR CACTGAAGACCTGTTGCTTA TGG (reversed) Intronic
900159969 1:1218853-1218875 CCCTGCAGACCTGCTGCTGACGG - Exonic
902091108 1:13903947-13903969 TCCTGGAGACCTGTTGCTTCTGG - Intergenic
902136930 1:14315203-14315225 CACAGAAGAAATGTTCCTTAAGG + Intergenic
902168571 1:14592595-14592617 CACTGAAGACCAGAGGCTTGTGG + Intergenic
905317597 1:37093505-37093527 CACTGAAGCCCTGGGGCTGATGG + Intergenic
905708744 1:40082801-40082823 CACTGAAAATTTGTTGTTTATGG - Intronic
906736097 1:48130081-48130103 CAGTGAAGAGCTCTTACTTAGGG - Intergenic
907774188 1:57497160-57497182 CACTGAAGCACTTTTGTTTAGGG - Intronic
909062215 1:70892202-70892224 CACTTATGAGCTGTTGCTTTGGG + Intronic
910341277 1:86190875-86190897 CACTGTGGACCTTTGGCTTAAGG - Intergenic
911572167 1:99530879-99530901 GACTGAAGACCTCTTGTTTGAGG - Intergenic
916909164 1:169326274-169326296 AACTGAGGAACTGTTGCTTCTGG + Intronic
919104755 1:193135420-193135442 CGCTGAAGACCTATTTCTAAGGG - Exonic
920057568 1:203203879-203203901 CTCTGAAGAAGTGATGCTTAAGG + Intergenic
921932071 1:220762811-220762833 CACTGAAGAGGTTTTGCTTCTGG + Intronic
922091311 1:222398012-222398034 GACTGAACACCTGTTACTTGGGG - Intergenic
923776413 1:236982568-236982590 CACTGAACAGCTGTTGTTTTAGG + Intergenic
1066452222 10:35540629-35540651 CACTGAAGCCATGTTGGTCAGGG + Intronic
1067717162 10:48698524-48698546 CACTGAAGACCTCTTTCTCTTGG + Intronic
1072094740 10:92166886-92166908 CACTGAAAATCTGCTGTTTAGGG + Intronic
1076873499 10:133204937-133204959 CCCTGAAGACCTGCTGCTCAAGG + Intronic
1076923524 10:133467903-133467925 CACAGCAGACCTGTTTCTCAGGG + Intergenic
1079124514 11:17709204-17709226 CATTTAAGACCTGTTGCTTCAGG - Intergenic
1085361664 11:75893552-75893574 CATTGAAGACCTATTTCTTCTGG - Intronic
1085913874 11:80861681-80861703 CAATAAATACCTGTTGCATATGG - Intergenic
1086120555 11:83300832-83300854 GACTGAAGAACTGCTGGTTAGGG - Intergenic
1087962987 11:104375346-104375368 CATTGAAGAACTGTAGATTAAGG - Intergenic
1088743850 11:112788098-112788120 CACTAAATTCCTGTTGTTTATGG + Intergenic
1089282246 11:117382535-117382557 CACTGAACACCTGCTGTGTACGG + Intronic
1089314640 11:117583243-117583265 CACTGAAGACCCCTTGCCTCTGG + Intronic
1094391198 12:29952065-29952087 CACTGAAAACATGATGCTAATGG + Intergenic
1098693747 12:73524850-73524872 CACTTTAGCCCTCTTGCTTATGG - Intergenic
1101681445 12:106970945-106970967 CACTGAAGAGCTCTTCCTTCAGG - Intronic
1104988163 12:132609149-132609171 CCCTGAGGACCTGATGCTGAGGG + Intronic
1109491540 13:63107142-63107164 CAATGAAGACACATTGCTTAAGG - Intergenic
1110089628 13:71429869-71429891 CACTGAAGATCTGTTTCTAGAGG - Intergenic
1113881540 13:113629468-113629490 CACTGAATGCATGTTGCTTTTGG - Intronic
1116607135 14:47014467-47014489 CATTGAAAATCTGTTGTTTAGGG + Intronic
1121612073 14:95288166-95288188 CACAGAAGACCTGTATCCTAAGG + Intronic
1121896232 14:97650522-97650544 CAGAAAAGTCCTGTTGCTTAGGG + Intergenic
1122100162 14:99402137-99402159 GACTGAAGACCTTTAGCATAGGG - Intronic
1125342473 15:38688489-38688511 CACAGAAGACCTACAGCTTAGGG - Intergenic
1125425542 15:39544725-39544747 CACTGCAGAGCTGTTCCTTCTGG - Intergenic
1128250943 15:66164020-66164042 CACTCAACACCATTTGCTTAGGG - Intronic
1139640696 16:68289454-68289476 CCCTGAAGATCTGTTCCTTAGGG + Intronic
1149661735 17:58337799-58337821 CACAGAAGACCTGTTCTTTGGGG - Intergenic
1151077384 17:71289053-71289075 TCCTGAAGCCCTATTGCTTAAGG + Intergenic
1157168969 18:45384630-45384652 CACTGAATACCTTTTGGTTGGGG - Intronic
1157332097 18:46711555-46711577 CACTGAAGGGCTGTTGCCTTTGG - Intronic
1161817334 19:6507525-6507547 CACTGAAGACCAGGTGTTTAAGG + Intergenic
1164664705 19:30020084-30020106 CCTTGAAAACCTGTTTCTTATGG - Intergenic
926160036 2:10481423-10481445 CACTGAAGACCTGTGACCTGTGG + Intergenic
926414621 2:12636980-12637002 CACTTAAGGACTGTAGCTTATGG - Intergenic
929557151 2:42932520-42932542 GACTGAAGACCAGTTGCTGAGGG + Intergenic
930296227 2:49557769-49557791 CACTGGTTTCCTGTTGCTTATGG - Intergenic
930934807 2:56935749-56935771 CCCTGAAACTCTGTTGCTTAGGG - Intergenic
931785352 2:65613209-65613231 CAAGGCAGACCTCTTGCTTATGG + Intergenic
933120406 2:78529266-78529288 CACTGGAAACCTGTTTCTGAAGG + Intergenic
933279128 2:80313187-80313209 CACTGAAGACCTGTTGCTTATGG - Intronic
933601822 2:84339826-84339848 CACTCAAGACATGTTGAATAAGG + Intergenic
935877752 2:107529786-107529808 CACAGAGGACCAGTTTCTTAAGG - Intergenic
935963196 2:108447575-108447597 CGCTGATGACCTGGAGCTTAGGG + Intergenic
939590041 2:144053713-144053735 CACAGCAGACCTGCTGCTTCTGG + Intronic
940082298 2:149817288-149817310 CACTGGGGAGCTTTTGCTTAAGG + Intergenic
942877000 2:180812712-180812734 CATTGAAAATCTGTTGTTTAAGG - Intergenic
942999230 2:182303756-182303778 CACTGAAAATCTGTTGTTTAAGG + Intronic
945993391 2:216415103-216415125 AACTCAAGAGCTGTTGTTTAGGG - Exonic
948304891 2:236939435-236939457 CACTGAAGGCTTGTTGCATTGGG + Intergenic
1168840705 20:908321-908343 CACTGAATGCCTTTTGCTTTTGG + Intronic
1171146026 20:22783666-22783688 CACTGAAAATCTGTTGTCTAGGG - Intergenic
1171360108 20:24581586-24581608 CACTGAAAACATGTGGCTTCGGG - Intronic
1172084374 20:32368768-32368790 CACTGAAGAAGTGTTAGTTATGG + Intronic
1173580606 20:44144073-44144095 CTGTGAAGACCTGTTGCAAAGGG + Intronic
1176689694 21:9889951-9889973 CATTGAAAATCTGTTGTTTAGGG + Intergenic
1177619268 21:23565721-23565743 TACTGCAGAACTGTTGCTTCTGG + Intergenic
1178225606 21:30714398-30714420 CACAGAGGATCTGTTGCTTGAGG - Intergenic
1178738290 21:35172175-35172197 CACTGATGACCTTTTGTTGAGGG + Intronic
1178774124 21:35532984-35533006 CACTGATGACCTGTTTTTAATGG + Intronic
1182313776 22:29428144-29428166 CAATGAATCCCTGTTTCTTAGGG - Intergenic
1183674977 22:39294155-39294177 CACTGTCTACCTGCTGCTTAAGG - Intergenic
1184192533 22:42904505-42904527 CGCTGAAGACCTGAGGCTTTTGG + Intronic
951574703 3:24101693-24101715 CACTGCAGACCAATTGCTTCAGG + Intergenic
955942381 3:64158719-64158741 CACTGACCACCTGTACCTTAAGG + Intronic
957284672 3:78202995-78203017 CACTGAAGACTTGAAGCTTTTGG - Intergenic
959395578 3:105833847-105833869 CACTGAAGACCAGTATCCTAAGG + Intronic
960048725 3:113221125-113221147 CACTGAGAACCAGTTTCTTAGGG + Intronic
961403907 3:126665864-126665886 GTCTGAAGACCTGTCGCTTGAGG + Intergenic
962455911 3:135565438-135565460 CACAGAAGCCCTGTAGCTTCTGG - Intergenic
964546523 3:157839966-157839988 CATTGAAGACCTGGGGCTGAGGG - Intergenic
964874999 3:161357215-161357237 CAGTGAAAACATGTTGCTTTAGG + Intronic
965117647 3:164512809-164512831 CACTGAAGACCATTAGGTTAAGG - Intergenic
966447672 3:180021431-180021453 CACTGCAGCCCTGTTGAATAAGG - Intronic
971732278 4:30400103-30400125 AATTGAAGACCTATTACTTACGG - Intergenic
973706980 4:53590894-53590916 CCCTGAAAACCTGTTCCTCAGGG - Intronic
975882243 4:78924265-78924287 CACTGAAGACCAGGAACTTATGG + Intronic
976315643 4:83656127-83656149 CACTCAATAAATGTTGCTTATGG - Intergenic
979823290 4:125201120-125201142 CACTGAATATCTGTTGTTTAGGG - Intergenic
980065468 4:128183183-128183205 CACTGAAAATCTATTGTTTAAGG - Intronic
980353104 4:131707816-131707838 CATTGAAAATCTGTTGTTTAGGG + Intergenic
986561935 5:9069045-9069067 CACTGGAGACTTGGTGCTCAGGG + Intronic
987296465 5:16556594-16556616 CATTGAATATCTTTTGCTTAGGG + Intronic
988840844 5:35082130-35082152 CCCTGAAGAGCAGGTGCTTAGGG + Intronic
990817019 5:59797217-59797239 AATAGAAGACCTGTTGCTTGTGG + Intronic
991423323 5:66464072-66464094 CCCTGATGACCAGTTGCATAGGG + Intergenic
992935582 5:81700626-81700648 CACTGAAAATCTCTTGTTTAGGG + Intronic
993766598 5:91866614-91866636 CACTGCAGATATGTTTCTTAAGG + Intergenic
994451547 5:99950530-99950552 CACAGAAGACATGTTGATGATGG + Intergenic
994980470 5:106868799-106868821 CAATGAAGACTTTTTGCTAAAGG - Intergenic
995066979 5:107873526-107873548 CCCTGAAGACCTGCTGCTGCTGG + Intronic
997851893 5:137340326-137340348 CAGTGAAGACCTGTTTATTGGGG - Intronic
999866381 5:155704934-155704956 CAGTGAAGGCATGTTGCTTATGG - Intergenic
1000731031 5:164834465-164834487 CACAGATGCCCTTTTGCTTAGGG - Intergenic
1004926631 6:20422090-20422112 CATTGAAGATCTGTTGTTTAGGG + Intronic
1007237753 6:40403286-40403308 CACTCAGGCCCTGGTGCTTAGGG - Intronic
1010170274 6:72966897-72966919 CCTTGAAGACCTGTTGTTTCTGG + Intronic
1012855447 6:104495917-104495939 CACTGTAGACCTTTTTATTAAGG + Intergenic
1014946392 6:127503666-127503688 CAGGGAAGACCTGTTGTTTCTGG + Intronic
1027681382 7:81225848-81225870 CACTGTAAATCTGTTGCTTTTGG + Intergenic
1032467755 7:132157179-132157201 CACTGGAGACCTGTTTCCTCTGG + Intronic
1036380623 8:8234163-8234185 CTCTGAACACCTCTTGCTGAAGG + Intergenic
1036552932 8:9831203-9831225 CACTGCAGAGAAGTTGCTTAGGG + Intergenic
1037764232 8:21762127-21762149 CCCTGAAGATCTTTTGCTTATGG - Intronic
1038309918 8:26438616-26438638 CACTGAGCACCTGCTGCTTCTGG - Intronic
1040886475 8:52268862-52268884 CACAGCAGACCTGCTGCTTGGGG + Intronic
1041586477 8:59526192-59526214 CATCGAAAATCTGTTGCTTAGGG - Intergenic
1043463161 8:80480884-80480906 CACTGAAGAACTGTTTATAATGG + Intergenic
1043648746 8:82559922-82559944 GACACAAGACTTGTTGCTTACGG + Intergenic
1045746923 8:105433246-105433268 CACTGAAGATTTGATGCATAAGG - Intronic
1046784483 8:118251513-118251535 CACTGTAAACCTTTTGCTTTTGG + Intronic
1048582553 8:135741972-135741994 CACAGAAGATCTGTTCCTTTGGG - Intergenic
1048824235 8:138408255-138408277 CACTGAAAATCTGTTCCTTAGGG + Intronic
1049322536 8:142004493-142004515 CACAGAAGGGCTGTTGCTTTTGG - Intergenic
1053779565 9:41591525-41591547 CATTGAAAATCTGTTGTTTAGGG - Intergenic
1054167521 9:61801766-61801788 CATTGAAAATCTGTTGTTTAGGG - Intergenic
1057645953 9:96875620-96875642 CACTGAACACCTGTTCCTAAAGG + Intronic
1061042580 9:128148682-128148704 CTCTGGACACCTGTTGCTTTGGG - Intergenic
1062059145 9:134485619-134485641 CACTGACTACCTGGTGCTTCAGG + Intergenic
1186799143 X:13075774-13075796 CACTGAAGACCTATTGAATCTGG + Intergenic
1195861024 X:109383274-109383296 CCCTGAAGACCAGATGCTTGTGG - Intronic
1197677413 X:129345652-129345674 CACTGAACACCTGTTGGTGGGGG - Intergenic
1199273531 X:145914381-145914403 CACTGGAAACTGGTTGCTTAAGG - Intergenic