ID: 933279490

View in Genome Browser
Species Human (GRCh38)
Location 2:80317372-80317394
Sequence TTGTATATTCTGAAAGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 317}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933279490_933279494 26 Left 933279490 2:80317372-80317394 CCTTCCACTTTCAGAATATACAA 0: 1
1: 0
2: 3
3: 18
4: 317
Right 933279494 2:80317421-80317443 GCTACGTGCCTTAACACAGCTGG 0: 1
1: 0
2: 0
3: 2
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933279490 Original CRISPR TTGTATATTCTGAAAGTGGA AGG (reversed) Intronic
900512106 1:3065624-3065646 TTGTAGATTCCGGGAGTGGAGGG + Intergenic
900861293 1:5234276-5234298 GTGAATAGTCTGAAGGTGGAGGG - Intergenic
905935228 1:41818080-41818102 TTGTATATTCTAGAAATTGATGG - Intronic
906987408 1:50698682-50698704 TTGTATATTTTGCTGGTGGAAGG + Intronic
908298657 1:62738999-62739021 GTGTATATTCTAAAAAAGGAAGG - Intergenic
908481529 1:64544923-64544945 TTGTATATACTTAAAGTGTGAGG + Intronic
908506480 1:64806905-64806927 TTATATATTGTTAAAGTTGAGGG - Intronic
909787468 1:79633362-79633384 TTGTAAATTCCGAAAGGAGAGGG + Intergenic
909844787 1:80378579-80378601 ATGTATATTCTGAAAGTCTTTGG + Intergenic
911753664 1:101527839-101527861 TTTTAAATTTTGAAAGTAGAGGG - Intergenic
912197253 1:107412730-107412752 TAGTATATTTTGAAAGGGGGAGG - Intronic
912957064 1:114162315-114162337 TTGTATATGGTGAAAGAGAAGGG - Intergenic
913494998 1:119420343-119420365 TTGGGTAGTCTGAATGTGGAGGG - Intronic
913964802 1:143367346-143367368 TTGTATATGCTGTAAGGTGAGGG + Intergenic
914059175 1:144192949-144192971 TTGTATATGCTGTAAGGTGAGGG + Intergenic
914119974 1:144773422-144773444 TTGTATATGCTGTAAGGTGAGGG - Intergenic
914867671 1:151445796-151445818 TTATAGATGCTGAAAGTGAAAGG - Intronic
915645580 1:157269663-157269685 TTGTAAATTCTGTATGTGGCAGG + Intergenic
917221860 1:172740297-172740319 ATGTATAGACTGAAAGTGAAGGG - Intergenic
917562828 1:176177756-176177778 TTGTATTTTGTTAAGGTGGAGGG - Intronic
917800817 1:178568468-178568490 TTCTAATTTCTTAAAGTGGAAGG + Intergenic
917846117 1:179021933-179021955 CTGTGGATTCTGAAAGTGGTGGG - Intergenic
918675510 1:187280017-187280039 TTGTAAATTCTGGAAGGGAAGGG + Intergenic
919403682 1:197149763-197149785 TTTTATATTCTGGAAATGGGTGG - Intergenic
919447223 1:197722250-197722272 TTGTATTTTCTGAATGAGAAAGG + Intronic
921645530 1:217611544-217611566 TTGTTTTTTCTTAACGTGGAAGG - Intronic
921962126 1:221047102-221047124 TTGTACAGTCTGAATGTGGGAGG - Intergenic
922089971 1:222386744-222386766 TTTTATATTCTGAAACTGCCTGG + Intergenic
922664387 1:227456188-227456210 TTGGAAATTCTGAAGGAGGATGG - Intergenic
923941807 1:238835365-238835387 TAGTATATTCTAAAAGTGTTTGG - Intergenic
1063296100 10:4808249-4808271 TGGTTTATTCTGAAAATGAAAGG - Intronic
1063358966 10:5432742-5432764 TTATATATTTTAAAAGTGGAAGG - Intronic
1064700955 10:18021142-18021164 TTGTATATGGTGAAAGGGGAGGG + Intronic
1065556925 10:26925206-26925228 TTGTAAATTTTGAAATTGGGTGG - Intergenic
1066554012 10:36591228-36591250 TCCTATATTCTGAAGGAGGAAGG + Intergenic
1068503433 10:57868868-57868890 TTCTATATTCTGATAGTAAAAGG + Intergenic
1069453896 10:68538610-68538632 TTGTATCTTTTGCAAGTTGATGG + Intergenic
1069482252 10:68794378-68794400 TTGTATATTCATTCAGTGGATGG + Intergenic
1074314900 10:112352338-112352360 TTGTGTATTCTGAAAATGAACGG - Intergenic
1075011742 10:118876328-118876350 TTTTATATTCTGAAGGTCAATGG - Intergenic
1075132597 10:119752994-119753016 TTGTATATTCTGTATTTGGTAGG + Intronic
1078241151 11:9531660-9531682 TTGTATGATATAAAAGTGGAGGG + Intergenic
1078389130 11:10920527-10920549 ATTTCTATTCTGAAAATGGAGGG - Intergenic
1078657908 11:13259601-13259623 TTGTTTAAGCTGAAAGTTGAAGG + Intergenic
1080224272 11:29943154-29943176 TAGCCTATTCTAAAAGTGGAGGG - Intergenic
1081160913 11:39747208-39747230 TTCTTTATTTTGAAAGTGGTGGG - Intergenic
1081780567 11:45708415-45708437 TTGTATGTTCTGTATGAGGAAGG - Intergenic
1082886052 11:58083631-58083653 TTGTATATGCTGAAAGGTAAGGG + Intronic
1083401735 11:62428123-62428145 TGGTGTATTCTGAAAGTGCTTGG - Intergenic
1087537680 11:99471247-99471269 TTTTATATTCTGGAAGCAGATGG - Intronic
1089894014 11:121909166-121909188 TTATCTTTTCTGAAAGAGGAGGG + Intergenic
1090636056 11:128691282-128691304 TTTTAAATCCTGAAAGGGGATGG - Intronic
1092118676 12:6028054-6028076 TTGTACAAGCTGAAAATGGATGG + Intronic
1093096356 12:14976199-14976221 TTGTAGGTTCTGAGACTGGAAGG + Intronic
1093490555 12:19700172-19700194 TTTTATCTCCTGAAACTGGACGG - Intronic
1093854847 12:24089116-24089138 TTTTATCTTCTGAAAATGTATGG - Intergenic
1093888981 12:24496857-24496879 TTGTATATTCATAAAGAGCAAGG - Intergenic
1094105167 12:26803554-26803576 TTACATATTCTACAAGTGGATGG + Intronic
1097907614 12:64936551-64936573 TTCTATGTTCTGAAAGAGAAAGG + Intergenic
1098285137 12:68899162-68899184 GTGTGGATTCAGAAAGTGGAAGG + Intronic
1098371418 12:69764311-69764333 TTGTATATGGTGAAGGGGGATGG + Intronic
1098404701 12:70111549-70111571 ATGTATAGACTGAAAGTAGATGG + Intergenic
1099294361 12:80811673-80811695 TTGTATTTTCAGAGTGTGGAAGG - Exonic
1100686167 12:96988228-96988250 TTGTATCTTCTAAAATGGGAAGG + Intergenic
1100851382 12:98715762-98715784 TTGTTTATTTTGAAAATGAAGGG + Intronic
1101970891 12:109311149-109311171 TTGTCTCTTCTGAAAGCTGATGG + Intergenic
1103315148 12:120047952-120047974 TTGTATATTTCCAAAATGGAAGG + Intronic
1105821375 13:24084013-24084035 TTGCCTATTCTGAAAGTGGAAGG + Intronic
1105856538 13:24377725-24377747 TTCTACTTTCTGAAATTGGAAGG - Intergenic
1106687118 13:32072126-32072148 ATGTAGATTCTGAAACTTGAAGG + Intronic
1107004180 13:35588823-35588845 TTGAATATACTGAATTTGGAAGG - Intronic
1107020881 13:35749902-35749924 TTGTATATGGTGAAAGAGGGGGG + Intergenic
1107167812 13:37303260-37303282 TTTTATATTCTAAGAGTGAAGGG + Intergenic
1107201921 13:37731261-37731283 TTGTCTTTTCTGAAAACGGATGG + Intronic
1107296472 13:38914436-38914458 TTAGATATTCTGAAAAAGGAGGG + Intergenic
1107761812 13:43687722-43687744 CTGTAAATTCTGCAAGAGGAAGG - Intronic
1111131652 13:83984511-83984533 TTTTATATTCTGGAAGTTTAAGG - Intergenic
1111382460 13:87477021-87477043 TATTATTTTCTGAAAGTTGAAGG + Intergenic
1112080994 13:95970236-95970258 TTGGATATGCTGAAATTAGAAGG - Exonic
1113330889 13:109326504-109326526 TTGCATATTCTGTTAGTAGAAGG + Intergenic
1114005762 14:18311703-18311725 TTAAATATTCTAAAAGTGGCCGG + Intergenic
1114006779 14:18322261-18322283 TTGTATATTATGTAAGTTAAGGG - Intergenic
1115053844 14:29098118-29098140 ATGTATATGCTGAGAGTTGATGG - Intergenic
1116283656 14:42944629-42944651 TTGTATATCTTGAATGTGGCAGG - Intergenic
1122193125 14:100063738-100063760 ATGTGTATTCTGAAACTGGTCGG - Intronic
1122605184 14:102943416-102943438 AAGTATTTTCTGAAAGTGGTAGG - Intronic
1123390714 15:19868929-19868951 TTGTATATTATGTAAGTTAAGGG - Intergenic
1123929134 15:25150713-25150735 TTGGATACTCTGAAAGTAAAGGG + Intergenic
1125466978 15:39963011-39963033 TTGTATCTCCTTAAAGAGGAAGG - Intronic
1126138768 15:45418997-45419019 ATGTATAAACTGAAATTGGAAGG + Intronic
1127661132 15:61101359-61101381 TTGTTTATTTTGAGACTGGAAGG + Intronic
1129320410 15:74771619-74771641 TTCTAGATTCTGAAAGAGGCAGG + Intergenic
1130748533 15:86683764-86683786 TTGTCAATTCTAAAAATGGAAGG + Intronic
1131463021 15:92633069-92633091 TTAAATATTCTGAAAAAGGAGGG - Intronic
1133488940 16:6248489-6248511 GAGTATATTCTGAAAGGAGAGGG + Intronic
1134236531 16:12470629-12470651 TTGAGTTTTCTGAAAGCGGAGGG + Intronic
1134318909 16:13144852-13144874 TTGTATAATGTGAAAGTTGATGG - Intronic
1135580517 16:23622082-23622104 ATGTATCTTCTAAAAATGGAGGG - Intronic
1135907895 16:26530202-26530224 TTGTCTAGTCTGAAAGTACATGG - Intergenic
1135945955 16:26865179-26865201 TGGTATATGCTGAAAATAGAAGG + Intergenic
1140171187 16:72606642-72606664 TTGTAAGTTTTGAAATTGGAAGG - Intergenic
1140465473 16:75178004-75178026 ATATATATACTGAAAGTGAAAGG + Intergenic
1142231479 16:88902161-88902183 TTCTAGCATCTGAAAGTGGAAGG - Intronic
1203098768 16_KI270728v1_random:1287769-1287791 TCCTTTATTCTGAAAATGGAGGG - Intergenic
1146226611 17:31072210-31072232 TTGTTTTATCTGAAAGGGGAAGG + Intergenic
1146634270 17:34492545-34492567 TTTTTTATTCTGAAAATTGATGG - Intergenic
1147344966 17:39784706-39784728 TTGTAAATCCTTAAAGTGTAGGG + Intronic
1147503489 17:40989527-40989549 ATGTATATTCTGCAATTGTAGGG + Intergenic
1148318598 17:46728040-46728062 GTGGATAGTCTGAAAATGGAGGG + Intronic
1148555178 17:48574524-48574546 TTTTATTTTCTGAAAGGAGATGG + Intronic
1149623123 17:58060865-58060887 TTGTTTATCCTGAAATTGAAAGG + Intergenic
1152771506 17:82172414-82172436 TTTTATATTTGTAAAGTGGAAGG - Intronic
1154531666 18:15352178-15352200 TTAAATATTCTAAAAGTGGCCGG - Intergenic
1156048713 18:32906605-32906627 TTGACAATTCTGAAAGTGGATGG - Intergenic
1158731511 18:60029409-60029431 TGGTATATTCATAAAATGGATGG - Intergenic
1159469222 18:68828253-68828275 ATGTATATTCTGCAATTGTATGG - Intronic
1159753617 18:72335249-72335271 TTGGAGTTTCTGAAAGTGAATGG - Intergenic
1159958993 18:74541109-74541131 TTGTAGGTTCTGAAAGTGGAGGG + Intronic
1160440057 18:78882931-78882953 TTGTAGATTGTGAAAATGGTCGG - Intergenic
1162330141 19:10023031-10023053 TTGTATATTCTTAAAGAGGAAGG + Intergenic
1163949882 19:20573946-20573968 TTGTATATTCTGCAGGTGTTGGG + Intronic
1164342007 19:24412053-24412075 TTGTAGAATCTGCAAGAGGATGG + Intergenic
1164685935 19:30166752-30166774 TTGTTAAGTCTGAAATTGGATGG + Intergenic
1202698578 1_KI270712v1_random:144836-144858 TTGTATATGCTGTAAGGTGAGGG + Intergenic
925424415 2:3736711-3736733 TTGTATATTTTCCAAATGGACGG + Intronic
928020289 2:27699302-27699324 TTGAAAATTCTTAAAGTGGTTGG - Intergenic
928044824 2:27919159-27919181 TTTTATTTTCTGACAGTTGATGG + Intronic
928216651 2:29367043-29367065 TTGTATTTTCAAAAAGAGGACGG - Intronic
930687720 2:54326933-54326955 TTGTATTTTATGAATTTGGAGGG - Intergenic
931571775 2:63676265-63676287 TTGCTAATTCTGAAAGTGAAAGG + Intronic
931974535 2:67628868-67628890 TTGTGTATTCTTAAAGTGGGAGG + Intergenic
932172430 2:69569288-69569310 TTGTAGATTCTACAAGTGGTGGG - Intronic
932718551 2:74121282-74121304 TTGTATTTTCTGGAAGTTGTTGG - Intergenic
933049406 2:77584376-77584398 TTGTGGCTTATGAAAGTGGAAGG + Intronic
933279490 2:80317372-80317394 TTGTATATTCTGAAAGTGGAAGG - Intronic
934279825 2:91602617-91602639 TTGTATATGCTGTAAGGTGAGGG + Intergenic
934368196 2:92698179-92698201 TTGTGGAATCTGCAAGTGGATGG + Intergenic
934378244 2:92859088-92859110 TTGTGGAATCTGCAAGTGGATGG + Intergenic
934437987 2:93821716-93821738 TTGTGGAATCTGCAAGTGGATGG + Intergenic
934441542 2:93878788-93878810 TTGTGGAATCTGCAAGTGGATGG + Intergenic
935253461 2:101286666-101286688 TTTTTTATTCTGAAAGTGATAGG - Intronic
936058106 2:109276576-109276598 TTGTATATTGTGAAACTAAATGG + Intronic
936548362 2:113412573-113412595 ATTTCTATTCTGAAAGAGGATGG - Intergenic
936596819 2:113856012-113856034 ATGAAGATTCAGAAAGTGGAAGG + Intergenic
936715909 2:115187507-115187529 GTGAAAATTGTGAAAGTGGATGG + Intronic
936971010 2:118176121-118176143 TTGCCTAGTCTGAAAGGGGAAGG - Intergenic
937565300 2:123278606-123278628 TTGTATATCCTAGAAGTTGATGG - Intergenic
938203814 2:129400209-129400231 TGATATATTCTGAGAGAGGACGG - Intergenic
938529784 2:132173205-132173227 TTGTATATTATGTAAGTTAAGGG + Intronic
938530760 2:132183423-132183445 TTAAATATTCTAAAAGTGGCCGG - Intronic
938744226 2:134261710-134261732 ATGTAAGTTCTGAAAGAGGAGGG + Intronic
939532121 2:143376149-143376171 TTTAGTATTCTAAAAGTGGAAGG + Intronic
940023995 2:149185688-149185710 TTGCATTTTCTGCAAATGGAAGG + Intronic
940197630 2:151113563-151113585 CTGTATAATCTGAAAGGGGGAGG + Intergenic
940645039 2:156382736-156382758 TTTGATATTCTGAAATAGGAAGG - Intergenic
941292445 2:163694125-163694147 CTTTTTATTCTGATAGTGGAAGG + Intronic
941399804 2:165016735-165016757 ATGTATATTTAGAAAGAGGAAGG - Intergenic
942442974 2:176055187-176055209 TTGTATCTTCACATAGTGGAGGG + Intergenic
943252243 2:185540962-185540984 TGTTATATTCTGAAAGTGTTAGG - Intergenic
943510340 2:188818560-188818582 TTCTAGATTCTGAAAGTAAATGG - Intergenic
944092597 2:195929691-195929713 TTGTATATGATGAAAGTTGGGGG - Intronic
945190743 2:207184972-207184994 TTCTACATGCTGACAGTGGAAGG - Intergenic
947275247 2:228384171-228384193 TTGTATATTATATTAGTGGAAGG + Intergenic
1170263061 20:14433740-14433762 TTTAATATTCTGCAAGTGGCTGG + Intronic
1170812056 20:19681691-19681713 TTGTATATTCTGAGGGGGAATGG + Intronic
1171254415 20:23678085-23678107 CTGTATATTCTGAAGTTGTAGGG + Intergenic
1171576971 20:26339867-26339889 TTGTAGAATCTGCAAGTGGATGG + Intergenic
1172813000 20:37663747-37663769 TTATATGGTCTGAAAATGGAGGG - Intergenic
1173357532 20:42308050-42308072 CTATATGTTCTGAAAGTGGGAGG + Intronic
1174086440 20:48011629-48011651 TTTTATATGTTCAAAGTGGATGG + Intergenic
1174289945 20:49501065-49501087 TTGTATATTTTGATAGAGGGGGG - Intergenic
1176730339 21:10488624-10488646 TTGAATTTTCTGTAAGTGGTTGG + Intergenic
1176765691 21:13015990-13016012 TTAAATATTCTAAAAGTGGCCGG + Intergenic
1178742819 21:35218723-35218745 TTGTATACTTTGAAGGGGGATGG - Intronic
1179145950 21:38767577-38767599 CTGTGGAGTCTGAAAGTGGAGGG - Intergenic
1180012494 21:45060035-45060057 TTGTAAATTCTAACAGTGGTGGG - Intergenic
1180430270 22:15242510-15242532 TTAAATATTCTAAAAGTGGCCGG + Intergenic
1180431288 22:15253073-15253095 TTGTATATTATGTAAGTTAAGGG - Intergenic
1180513852 22:16121006-16121028 TTGTATATTATGTAAGTTAAGGG - Intergenic
1180939636 22:19650096-19650118 ATGTATATTCTGCTAGTGGGTGG - Intergenic
1184327603 22:43801991-43802013 TCGTATAGACTGAAAGTGAAGGG + Intronic
1184552357 22:45211061-45211083 ATGGATTTTCTGCAAGTGGAAGG - Intronic
949269896 3:2202636-2202658 TTCTATAGTCTGCAAATGGAAGG - Intronic
949595709 3:5544734-5544756 ATGTATAGGCTGAAAGTGAAGGG - Intergenic
949745550 3:7288160-7288182 TTGTATATCCTTAAAGGAGAAGG - Intronic
950482352 3:13252230-13252252 TTGTAGAGACAGAAAGTGGAAGG - Intergenic
951732449 3:25825195-25825217 TTGTATATGGTGAAAGGGAAGGG - Intergenic
951769301 3:26237690-26237712 TTGTATATTCTGAGAGTATAGGG + Intergenic
953121525 3:40047432-40047454 TTTTATTTTAAGAAAGTGGAGGG + Intronic
953196449 3:40738753-40738775 TAGGGTATTCTGAAAGTTGAGGG + Intergenic
953445051 3:42956315-42956337 CTGTGTACTCAGAAAGTGGAAGG + Intronic
955374651 3:58385045-58385067 TTGTCTATTCTGACAGTTGTTGG + Intronic
955504804 3:59621152-59621174 TTGTTTATTTTGAGCGTGGAGGG - Intergenic
956007205 3:64792929-64792951 TTTTATATTCTGGAAGTCAATGG - Intergenic
956314503 3:67919515-67919537 TTGGAGACTCTGAAAGTGGGAGG - Intergenic
956796573 3:72723462-72723484 TGGTGAATTCTGAAAGTAGAGGG - Intergenic
957975501 3:87438478-87438500 TTGTATATGCACAAAGTGCAAGG - Intergenic
958472602 3:94540284-94540306 TTGGATTTTCTGAAAGGGGTTGG - Intergenic
958729119 3:97941678-97941700 TTGTATACTTTGAAAATGAAAGG - Intronic
959083046 3:101822738-101822760 TTTTATGTTCTGAAATTTGAGGG + Exonic
959204337 3:103285242-103285264 TTGTTTTATCTGAACGTGGATGG + Intergenic
961337836 3:126194225-126194247 ATGTATATTCTAAAATTGTATGG - Intronic
962502688 3:136011026-136011048 TGGTATATTTAGAAAGAGGAGGG - Intronic
962766819 3:138572556-138572578 TTGTAAATTCTGAAAATAGTTGG + Intronic
963985112 3:151583920-151583942 TTGTATATTCTGTCATTCGATGG + Intergenic
964095390 3:152925732-152925754 TTGTTTATATTAAAAGTGGAGGG + Intergenic
964469266 3:157035018-157035040 TTGTATCTTCTGCTGGTGGAGGG - Intronic
964597258 3:158448152-158448174 ATGTATATGCTGTAAGTCGAAGG + Intronic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
964688290 3:159421998-159422020 TGTTATCTTCTGAAAGTGAATGG + Intronic
965883190 3:173411936-173411958 TTGTATTTTCTGAAAGAGAATGG + Intronic
967216852 3:187218480-187218502 CTGTTTATTCTGTAAGGGGAAGG - Intronic
967344614 3:188440759-188440781 TTGTTTATTCTGACTGTGAATGG + Intronic
967673907 3:192272899-192272921 TTTTTTCTTCTGAAACTGGAAGG - Intronic
968327802 3:197835548-197835570 TTTTCTATTTTGAAAGTGGGAGG - Intronic
970247430 4:14078032-14078054 TTGTATCATCTGAAAGTTGATGG - Intergenic
971044394 4:22789156-22789178 TTGTGTATTTTGAAAGGGTAAGG + Intergenic
971696602 4:29912350-29912372 TTGTATATGGTGAAAGGAGAGGG - Intergenic
973545831 4:51981021-51981043 TTTAAAAATCTGAAAGTGGAAGG + Intergenic
973657949 4:53069877-53069899 ATGTATATTATTAAAGTGGAAGG - Intronic
974206898 4:58715816-58715838 TTGTTTATTCAAAAAATGGAGGG - Intergenic
974788437 4:66653349-66653371 TTTTATTTTCTGCAAGTGCATGG + Intergenic
975454570 4:74575130-74575152 TTGTCTTTGCTGCAAGTGGATGG - Intergenic
976180835 4:82397177-82397199 TTGTATTTTCTGATAGAGGCGGG - Intergenic
976670199 4:87643914-87643936 TTGTATTTCCTGAAACTTGATGG + Intergenic
977972643 4:103229494-103229516 TTTCCTTTTCTGAAAGTGGATGG - Intergenic
978653045 4:111031082-111031104 GTATATATTCTGCAAGTGGGAGG + Intergenic
979059014 4:116030959-116030981 TTGTATATTGGGTGAGTGGAGGG - Intergenic
980238041 4:130133727-130133749 TCGTATAGTCTGAAGGTGGTTGG - Intergenic
980806236 4:137818090-137818112 TTGCATAGACTGAAAGTGAATGG - Intergenic
980945662 4:139318020-139318042 TATAATATTCAGAAAGTGGATGG + Intronic
981223882 4:142268974-142268996 TTATATATTCTGAAAGAGTTGGG - Intronic
982040797 4:151394254-151394276 TTGTATATTGTGAAAGTTAGGGG - Intergenic
982079996 4:151779987-151780009 TTCTATCTTCTAAAAATGGAAGG + Intergenic
983407648 4:167350203-167350225 TTGTATATGGTGAAAGGGAAGGG + Intergenic
984033208 4:174630924-174630946 TAGATTATTCTGAAATTGGAGGG + Intergenic
986071704 5:4291360-4291382 CAGTATCTTCTAAAAGTGGATGG + Intergenic
986616440 5:9622250-9622272 TTGTGTACTCTGAAAGGAGAAGG + Intergenic
986678356 5:10210279-10210301 TAGTACATTTTGAAATTGGATGG - Intergenic
986995184 5:13599387-13599409 TTGTATATTCTGTACCTAGAAGG + Intergenic
987889067 5:23852795-23852817 TTGTATATGCTGAAAGTTAGTGG + Intergenic
988651474 5:33156718-33156740 TTGTATATGGTGAAAGGGAAGGG + Intergenic
988667608 5:33346838-33346860 TTGTATATTGTGAAAGTAAGGGG - Intergenic
988859783 5:35265629-35265651 TTGGCTAGTCTGAAAGTGGCTGG + Intergenic
989285461 5:39693846-39693868 TTTAATATTCTGAAAGTCTATGG - Intergenic
989954761 5:50344673-50344695 TTGTCTATTTGGAAAGTTGAGGG - Intergenic
990131378 5:52589934-52589956 TTGTATATTGTGAAAATGCATGG - Intergenic
990649788 5:57885354-57885376 TTGAATATGGGGAAAGTGGAAGG + Intergenic
991561289 5:67956195-67956217 TTATATGTTCTGAGAGAGGAAGG - Intergenic
992217543 5:74540767-74540789 TTATAGATCCTGAAAGTGGGTGG + Intergenic
994446575 5:99881529-99881551 ATGTATATTCTGCAGCTGGATGG - Intergenic
994944755 5:106372499-106372521 TTGTATATTCTGTTAGGGAATGG - Intergenic
995684498 5:114757414-114757436 TAGTATATTCTACATGTGGAAGG + Intergenic
995728838 5:115214001-115214023 TTTTATAGTCTGAAAGTCAAAGG - Intronic
995768193 5:115641153-115641175 TTATATATTTTGTAAGTAGATGG + Intergenic
997639907 5:135442362-135442384 TTCTGGATTCTGTAAGTGGAAGG + Intergenic
997935566 5:138107754-138107776 TTGTATAAACAGAAAGAGGAGGG + Intergenic
997973902 5:138427210-138427232 TGGTATATTCTGGCAGAGGAAGG - Exonic
998796622 5:145826776-145826798 TTGAATATTCTGTAATTAGATGG - Intronic
999870266 5:155742578-155742600 TTGTAACGTCTGAACGTGGAAGG - Intergenic
1000134413 5:158332516-158332538 TTGTATATGGTGAAAGAAGAGGG + Intergenic
1003329617 6:5119134-5119156 TGGGATATTCTTAATGTGGAGGG + Intronic
1003634917 6:7823249-7823271 TACAATATTCTGTAAGTGGAAGG - Intronic
1005075739 6:21904784-21904806 TTGTTAATTCTGAAAGTTGTTGG + Intergenic
1005391526 6:25338876-25338898 TTTTATATGCTGAGAGTTGAAGG + Intronic
1006279163 6:33033520-33033542 TTCTAATTTCTTAAAGTGGAAGG + Intergenic
1007617557 6:43189482-43189504 TTGTATAATTTAAAAGTAGAGGG - Intronic
1008385074 6:50879969-50879991 TAGTATACCCTGAAGGTGGAGGG - Intergenic
1008870821 6:56270594-56270616 TTGTATATTCTGTGACTGGTGGG - Intronic
1010394596 6:75376037-75376059 TTATATATTTTTTAAGTGGAGGG - Intronic
1010457518 6:76075364-76075386 TTGTATATTCTTAAAGAGATAGG + Intergenic
1010531261 6:76970177-76970199 TTGTATATTTTGAAGGGGAATGG - Intergenic
1010785804 6:79999708-79999730 TTGTATATTTAGAAAAGGGAAGG - Intergenic
1011636573 6:89380264-89380286 GTGTTTATTCATAAAGTGGATGG - Exonic
1012509757 6:99989772-99989794 TTATATTTTCAAAAAGTGGAAGG - Intronic
1014031560 6:116711395-116711417 TTGTAATTTCTGAAGGTGGAAGG + Intronic
1016089365 6:139957071-139957093 TTCTATATTCAGAAATTGGATGG + Intergenic
1016305132 6:142676128-142676150 TTTTATAGTCTGTAAATGGATGG - Intergenic
1016572072 6:145524941-145524963 TTGTATATGGTGAAAGTTAAGGG + Intronic
1016983815 6:149879033-149879055 TTGTATATAGTGAAAGTTAAGGG - Intergenic
1018407597 6:163504051-163504073 TTGTATATTGTGAAATTTGTGGG + Intronic
1020506619 7:8997721-8997743 TTGTTTATTCTGAAATGTGAAGG - Intergenic
1024489860 7:49967864-49967886 GAGTATATTTTGCAAGTGGATGG + Intronic
1027535361 7:79392969-79392991 TTGGAATTTCTGAGAGTGGAGGG - Intronic
1028737051 7:94226566-94226588 TTGTTTATACTGAAAATGGTGGG + Intergenic
1028765194 7:94548791-94548813 TTCTTTATTCTGAAAATTGAGGG + Intronic
1028778768 7:94710268-94710290 TAGTACATTCTGAAGCTGGAGGG + Intergenic
1030908579 7:115217227-115217249 TTATATATTCCCAGAGTGGAAGG + Intergenic
1031015794 7:116575119-116575141 TTGTAAGTTCTCAAAATGGAGGG + Intergenic
1031539763 7:122979238-122979260 TAATAAATTCTGAAAGTGGGGGG - Intergenic
1031563607 7:123267248-123267270 ACCTATATTCTGAAAGTGCATGG - Intergenic
1031611368 7:123831788-123831810 CTGTAGATTCTGAAAGTGGTTGG + Intronic
1031908891 7:127492686-127492708 TTATATAATCTTGAAGTGGAAGG + Intergenic
1033880982 7:145883541-145883563 TAGTAGTTTCTGAAATTGGAAGG - Intergenic
1034013748 7:147559202-147559224 TTGTAGATTGAGAAAGTGGCTGG + Intronic
1037307493 8:17521190-17521212 TTGTATATTTTGATAGAGGGAGG + Intronic
1039223796 8:35365340-35365362 TTGTACATTCTCACAATGGAGGG + Intronic
1039376454 8:37039247-37039269 TGGGAAATTCTGAGAGTGGAAGG + Intergenic
1039420467 8:37433921-37433943 TTATATATTCTGGAGCTGGATGG + Intergenic
1040812404 8:51469748-51469770 ATATATATCCTGAAAGTGCATGG - Intronic
1041289611 8:56296534-56296556 TTGTATAGTCTCAAACTAGAGGG - Intergenic
1043023565 8:75037484-75037506 ATGGATATCCTGAAAGTGGATGG + Intergenic
1043140440 8:76581998-76582020 TTGTATTTGCTTAAAGGGGAAGG + Intergenic
1043631703 8:82343329-82343351 TTGTCTATTAGGAAAGTAGAGGG + Intergenic
1043768782 8:84170388-84170410 TTGTATATGGTGAAAGTAAAGGG + Intergenic
1045998372 8:108390195-108390217 TTGTCTATTCAGAAAGAGTATGG - Intronic
1046349114 8:112983113-112983135 TTGTTTATTTTGAAAGAGAAAGG + Intronic
1048483737 8:134828271-134828293 TTGAATATTATAAAAATGGAAGG - Intergenic
1048556870 8:135486919-135486941 TTTTATTTTCTTAAAGAGGATGG + Intronic
1050184172 9:2954807-2954829 TTTTATATTGTCAAAGTGTAAGG - Intergenic
1050500619 9:6294298-6294320 TTGGAGATTCAGAAAGAGGAAGG - Intergenic
1052322388 9:27182299-27182321 TTGTATTTTCTGAAGCTGGGTGG - Intronic
1053709366 9:40789937-40789959 TTAAATATTCTAAAAGTGGTCGG - Intergenic
1053727202 9:41016174-41016196 ATTTCTATTCTGAAAGAGGATGG + Intergenic
1054418298 9:64900263-64900285 TTGTATATTATGTAAGTTAAGGG + Intergenic
1054419274 9:64910740-64910762 TTAAATATTCTAAAAGTGGTCGG - Intergenic
1054701315 9:68415914-68415936 ATTTCTATTCTGAAAGAGGATGG - Intronic
1058176308 9:101739325-101739347 TTGAATAATCTGAAACTAGAAGG + Intergenic
1059963088 9:119586690-119586712 TTGTATATTGTGGGAGTAGATGG + Intergenic
1060257457 9:122045162-122045184 TTCTATATTCTTAATGTGCAAGG - Intronic
1203417718 Un_KI270364v1:1653-1675 TTGTAGAATCTGCAAGAGGATGG - Intergenic
1203583944 Un_KI270746v1:45443-45465 TTGAATTTTCTGTAAGTGGTTGG - Intergenic
1185931162 X:4205010-4205032 TGGTATATTTGGCAAGTGGATGG + Intergenic
1186820907 X:13286389-13286411 TTCTTTTTCCTGAAAGTGGAAGG + Intergenic
1187990200 X:24862460-24862482 TTGTTTATTTTGGATGTGGAAGG + Intronic
1188047470 X:25443251-25443273 TTGTGAATTCTGAATGTAGATGG + Intergenic
1188629883 X:32341964-32341986 ATGTACATTCTGAAAGTGAGTGG - Intronic
1192546789 X:72020984-72021006 TTGTCTTCTCTGAAAGTGAAAGG + Intergenic
1193036905 X:76961057-76961079 TTGTGCTTTCTGCAAGTGGATGG - Intergenic
1193610247 X:83622859-83622881 TTGTATATTCTGAGAGATAAGGG + Intergenic
1193892015 X:87059752-87059774 TTGTATATTCTAAATGTATATGG + Intergenic
1194269102 X:91787939-91787961 TTATAGACTCTGAGAGTGGAAGG + Intronic
1196557243 X:117102199-117102221 TTGTATATGGTGAAAGATGAGGG + Intergenic
1196562080 X:117161637-117161659 TTGTATGTTCTCAAAATTGATGG + Intergenic
1196769031 X:119274390-119274412 TTATATCTTTTGAAAGTGGAAGG + Intergenic
1198634925 X:138686973-138686995 TTGTATATGTTGAATGTGGTAGG - Intronic
1199158362 X:144576823-144576845 TTAAATATTCTGAAATTGTATGG + Intergenic
1200450501 Y:3321720-3321742 ATTTATATTCTAAAAGAGGAGGG - Intergenic
1200586318 Y:5008948-5008970 TTATAGACTCTGAAAGTGGAAGG + Intronic