ID: 933279971

View in Genome Browser
Species Human (GRCh38)
Location 2:80322623-80322645
Sequence GCGGCGGCTGGGCTGCGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 711
Summary {0: 1, 1: 1, 2: 6, 3: 76, 4: 627}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933279971_933279979 -2 Left 933279971 2:80322623-80322645 CCCGGCCGCAGCCCAGCCGCCGC 0: 1
1: 1
2: 6
3: 76
4: 627
Right 933279979 2:80322644-80322666 GCGTGTGTTGTCAGGACGATCGG 0: 1
1: 0
2: 0
3: 3
4: 25
933279971_933279980 12 Left 933279971 2:80322623-80322645 CCCGGCCGCAGCCCAGCCGCCGC 0: 1
1: 1
2: 6
3: 76
4: 627
Right 933279980 2:80322658-80322680 GACGATCGGAAACGCGTGTGTGG 0: 1
1: 0
2: 0
3: 0
4: 14
933279971_933279983 20 Left 933279971 2:80322623-80322645 CCCGGCCGCAGCCCAGCCGCCGC 0: 1
1: 1
2: 6
3: 76
4: 627
Right 933279983 2:80322666-80322688 GAAACGCGTGTGTGGGGAGATGG 0: 1
1: 0
2: 1
3: 19
4: 198
933279971_933279984 21 Left 933279971 2:80322623-80322645 CCCGGCCGCAGCCCAGCCGCCGC 0: 1
1: 1
2: 6
3: 76
4: 627
Right 933279984 2:80322667-80322689 AAACGCGTGTGTGGGGAGATGGG 0: 1
1: 0
2: 1
3: 8
4: 119
933279971_933279981 13 Left 933279971 2:80322623-80322645 CCCGGCCGCAGCCCAGCCGCCGC 0: 1
1: 1
2: 6
3: 76
4: 627
Right 933279981 2:80322659-80322681 ACGATCGGAAACGCGTGTGTGGG 0: 1
1: 0
2: 0
3: 1
4: 7
933279971_933279976 -10 Left 933279971 2:80322623-80322645 CCCGGCCGCAGCCCAGCCGCCGC 0: 1
1: 1
2: 6
3: 76
4: 627
Right 933279976 2:80322636-80322658 CAGCCGCCGCGTGTGTTGTCAGG 0: 1
1: 0
2: 0
3: 0
4: 53
933279971_933279982 14 Left 933279971 2:80322623-80322645 CCCGGCCGCAGCCCAGCCGCCGC 0: 1
1: 1
2: 6
3: 76
4: 627
Right 933279982 2:80322660-80322682 CGATCGGAAACGCGTGTGTGGGG 0: 1
1: 0
2: 0
3: 0
4: 16

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933279971 Original CRISPR GCGGCGGCTGGGCTGCGGCC GGG (reversed) Intronic