ID: 933282816

View in Genome Browser
Species Human (GRCh38)
Location 2:80351242-80351264
Sequence CTCTGCCTATGTGGGGAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 289}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933282816_933282821 -6 Left 933282816 2:80351242-80351264 CCTCTTTCCCCACATAGGCAGAG 0: 1
1: 0
2: 3
3: 32
4: 289
Right 933282821 2:80351259-80351281 GCAGAGTGGCTTTTTGAACTAGG 0: 1
1: 0
2: 1
3: 13
4: 164
933282816_933282822 12 Left 933282816 2:80351242-80351264 CCTCTTTCCCCACATAGGCAGAG 0: 1
1: 0
2: 3
3: 32
4: 289
Right 933282822 2:80351277-80351299 CTAGGAAGCATTTTGTTGTCTGG 0: 1
1: 0
2: 1
3: 13
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933282816 Original CRISPR CTCTGCCTATGTGGGGAAAG AGG (reversed) Intronic
900246479 1:1638466-1638488 CCCTGCCTTTGTGGGGTGAGGGG + Intronic
900257707 1:1705608-1705630 CCCTGCCTTTGTGGGGTGAGGGG + Intronic
900696860 1:4017644-4017666 CTCAGCCTATGTGGGGACACAGG - Intergenic
902374197 1:16022688-16022710 CTCGGCGGATGTGGGGACAGGGG - Exonic
902897434 1:19488638-19488660 CTCTGCATATGTGGGGCAGGGGG - Intergenic
902979382 1:20112335-20112357 CTGTGCCTGTGTGGGGGAACAGG - Exonic
903265165 1:22153821-22153843 GTCTGCCTCTGTGGGGATACCGG - Intergenic
903438530 1:23369955-23369977 CTCTGCCTGGGCTGGGAAAGGGG + Exonic
903986250 1:27231284-27231306 CTCTGCCTATATGGAGAGAGAGG + Intergenic
905784706 1:40745187-40745209 CTCTTTCAATTTGGGGAAAGAGG + Intronic
906385316 1:45363572-45363594 CCAGGCCTAGGTGGGGAAAGGGG - Intronic
909069405 1:70976424-70976446 CTATGCATATGTGGGGCCAGGGG + Intronic
913026670 1:114850170-114850192 ATGTGACTATCTGGGGAAAGAGG - Intergenic
915007355 1:152651668-152651690 CTCTGCATGTATGGGCAAAGTGG + Intergenic
916720892 1:167484140-167484162 CTCTGCCTGTGTGGGGCACGAGG - Intronic
918534835 1:185562283-185562305 CTGTGCATATGTGGGGAAGGGGG + Intergenic
920172704 1:204081730-204081752 CTCAGCCTGTGTGGGGTATGAGG + Intronic
921079265 1:211725605-211725627 CTCTGCTTCTGTGGAGCAAGAGG - Intergenic
922190548 1:223314965-223314987 CTCTGCCTCAGATGGGAAAGAGG + Intronic
924045493 1:240025195-240025217 CACCGGCTAAGTGGGGAAAGTGG + Intronic
924276705 1:242395961-242395983 CTCTGCCTATGGGGTTCAAGCGG - Intronic
924378800 1:243441272-243441294 CTCTGCAAATGTGGGTACAGGGG + Intronic
1063163837 10:3442062-3442084 CTGGGCCTGTGTGGGGACAGGGG - Intergenic
1063464488 10:6233904-6233926 CTCTTCCCAGGTGGGGACAGTGG + Exonic
1065469068 10:26057893-26057915 CTGTGCCTACCTGGGGGAAGGGG - Intronic
1065482876 10:26212698-26212720 CTCTGCGTTTGTGTGGCAAGGGG - Intergenic
1067835332 10:49634800-49634822 CTCTGCCTTTGTGGGAAGAGTGG + Intronic
1069534102 10:69240575-69240597 TGCTGCCTCTGTGGGGAAGGAGG + Intronic
1069753790 10:70761267-70761289 CTTTGCCTTTCTGGGGAGAGGGG - Exonic
1069886281 10:71625782-71625804 CTCAGCCCATCTGGGGAAGGGGG + Intronic
1072830074 10:98648188-98648210 CTCTGGATATATGGGGAAAAGGG - Intronic
1072905468 10:99449276-99449298 CTCTGCCTCCCAGGGGAAAGTGG + Intergenic
1073310126 10:102534459-102534481 GACTTCCTAGGTGGGGAAAGAGG - Intronic
1074583581 10:114744988-114745010 TTCTCCCTATCTGGGGAGAGGGG - Intergenic
1074764300 10:116689295-116689317 CTCTGCTTGTGTGGGGAAAATGG - Intronic
1075012625 10:118887606-118887628 GTCTGTCTATATTGGGAAAGAGG - Intergenic
1075153487 10:119955656-119955678 TTCTGGCTGTGTGGGGAGAGAGG + Intergenic
1075399260 10:122149737-122149759 CTCTGCCTCACTAGGGAAAGGGG + Intronic
1076196615 10:128523102-128523124 CTCTGCCTGTGTGGGGGCGGGGG - Intergenic
1077420793 11:2448986-2449008 CCCAGCCTGTGTGGGGACAGGGG + Intronic
1077620210 11:3715121-3715143 GTCTGCCAATGTGGAGAAATTGG - Intronic
1078171461 11:8932111-8932133 CTCTGCCCCTCTGGGGGAAGTGG - Intronic
1078197327 11:9146888-9146910 TTTTGCCTCTGTGGGGAGAGAGG - Intronic
1078581391 11:12542162-12542184 CTCTGGCTGTTTTGGGAAAGAGG + Intergenic
1079028838 11:16970084-16970106 CTTTTTCTATGTGGGGACAGAGG + Intronic
1080671172 11:34379496-34379518 CTCTGCTTGTCTGGGGAATGAGG + Intergenic
1085259209 11:75194580-75194602 GCCTCCCTATGTGGGAAAAGAGG - Intronic
1085462127 11:76700545-76700567 CCCTCCAGATGTGGGGAAAGAGG - Intergenic
1085610703 11:77945970-77945992 CTGTGGCTATGTAGGGAAATGGG - Intronic
1086245126 11:84742557-84742579 CTATGCATTTGTGGGGACAGAGG - Intronic
1087407959 11:97752814-97752836 CAAAGCCTATGTGGGGAAGGGGG + Intergenic
1087566799 11:99870113-99870135 CTGTGCCTATATTTGGAAAGAGG + Intronic
1087790988 11:102406276-102406298 CTCTGTCTATGGGGGTAAAGAGG + Intronic
1087825778 11:102763362-102763384 CTCTATCTAAGTGGGGAAGGGGG - Intergenic
1088546525 11:110965088-110965110 CTCTACCAATGTGGGCCAAGTGG + Intergenic
1088895795 11:114077384-114077406 ATCTGCCTTTGCTGGGAAAGAGG - Intronic
1090847245 11:130540592-130540614 CTGTGCATGTGTGGGGACAGGGG - Intergenic
1091224977 11:133951689-133951711 CTCTGCCCAGGTGGGGAGAGGGG - Intronic
1091852124 12:3708152-3708174 CTCTGTCCATGTGGACAAAGTGG - Intronic
1091907326 12:4199762-4199784 CTTTGCCTCTCTGGTGAAAGGGG + Intergenic
1092729311 12:11513422-11513444 CTCTGCCTCTGTGGCCAATGAGG - Intergenic
1093399025 12:18720554-18720576 CTCTCCCTATCTGTGGAATGGGG + Intronic
1095719106 12:45381010-45381032 CTCTGCCTCTGTGGGTTACGAGG + Intronic
1096902167 12:54895524-54895546 CTGTGCATGTGTGGGGACAGAGG + Intergenic
1096993531 12:55824449-55824471 CTCTGCATTTTTGGGGAATGGGG - Intronic
1097398344 12:59102657-59102679 CTCTGCTTTTCTGGGGAAGGGGG + Intergenic
1102811629 12:115829299-115829321 CTGTGCATGTGTGGGGGAAGAGG - Intergenic
1102983681 12:117262267-117262289 CACTGTCTCTGGGGGGAAAGGGG - Intronic
1103404472 12:120665640-120665662 CTATGCGTATGCGGGGACAGGGG + Intronic
1104326006 12:127799414-127799436 CTATGCCTATGTGAGTAGAGGGG - Intergenic
1104610122 12:130220824-130220846 CTGTGCCTGTGTGGGGCAGGGGG - Intergenic
1104773233 12:131377848-131377870 CCCGGCCTATGTGCGGGAAGGGG + Intergenic
1105471092 13:20695262-20695284 CTCTGCCTAAGAGAGGAAAGAGG + Intergenic
1105948774 13:25211599-25211621 CTCTGCTTATTTGGGGGAAGGGG - Intergenic
1106926067 13:34614469-34614491 CTATGCATATGTAGGGACAGGGG - Intergenic
1107442514 13:40440723-40440745 CATTGCCTATGGGGGCAAAGAGG - Intergenic
1107571967 13:41671279-41671301 ACCTGCCTATGTGGTGACAGAGG - Intronic
1110783979 13:79501390-79501412 CTTTGCCTGTGTTGGGGAAGGGG + Intronic
1111237716 13:85431042-85431064 CTGAGCCTCTGTGGGGAGAGGGG - Intergenic
1112990736 13:105510571-105510593 CTCTGCTTATGTGGGAGGAGAGG + Intergenic
1113486593 13:110657360-110657382 CCCTGCCTTTGAGGGGAAATGGG - Intronic
1113657162 13:112074021-112074043 CTCTGCCCGGGTGGAGAAAGCGG - Intergenic
1115490374 14:33952501-33952523 CTCTGCCTCTGAGGGGAGAAAGG + Intronic
1115566966 14:34632560-34632582 CTCTTCCTAGGTGGAGAGAGAGG + Intergenic
1116469626 14:45271991-45272013 CTATGCATGTGTGGGGACAGGGG - Intergenic
1117914875 14:60667172-60667194 CTCTGGGTAGGTGGGTAAAGTGG - Intergenic
1118318326 14:64738728-64738750 CTCTACCTCTGCAGGGAAAGGGG + Exonic
1118494147 14:66291510-66291532 CTCTGGCTATTAAGGGAAAGGGG + Intergenic
1118931554 14:70246576-70246598 TTCTGTTTTTGTGGGGAAAGAGG - Intergenic
1118953610 14:70458562-70458584 TTCTGTTTTTGTGGGGAAAGAGG + Exonic
1120725392 14:87933844-87933866 CTCTCCTTATGTGTGGAAGGAGG - Exonic
1121319199 14:92981288-92981310 CTTAGCCTATGCGGGGAGAGAGG - Intronic
1202922448 14_KI270723v1_random:37718-37740 ATCTGCCTATGGGGGCATAGTGG - Intergenic
1124407334 15:29404404-29404426 CTGTGCCAGTGAGGGGAAAGGGG - Intronic
1124555884 15:30725442-30725464 CTCTGCTTATGTGTACAAAGAGG - Intronic
1125956992 15:43797351-43797373 GTCTGCCTAAGGGTGGAAAGTGG + Exonic
1126913778 15:53442850-53442872 CTTTGGCTAGTTGGGGAAAGAGG - Intergenic
1127273419 15:57421617-57421639 CTCAGAATATTTGGGGAAAGGGG - Intronic
1127353190 15:58172942-58172964 TACTGCCTATGAGGAGAAAGAGG - Intronic
1127586980 15:60387812-60387834 CTATGCGTATGTGGGAACAGGGG + Intronic
1127793066 15:62415531-62415553 CTTTGACTTTGAGGGGAAAGAGG + Intronic
1128977720 15:72165632-72165654 CTCTGCCTATGGTGAGGAAGAGG - Intronic
1129161655 15:73751303-73751325 CTCTGCCTCTGGGTGGAGAGTGG + Exonic
1129247231 15:74286904-74286926 CTCTCCCTATGAGGGGAAGAGGG - Intronic
1130193964 15:81761701-81761723 CTCTGACTGTGTGGGCCAAGTGG - Intergenic
1131860335 15:96646471-96646493 ATCTTGCTATGGGGGGAAAGGGG - Intergenic
1132336642 15:101052228-101052250 CTCTGGCTACGAGGGGAAGGGGG - Intronic
1133233973 16:4379178-4379200 CACAGCCTGTGTGGGGGAAGGGG + Intronic
1133468329 16:6049773-6049795 CTATGCAAATGTGGGGCAAGGGG - Intronic
1135159432 16:20080601-20080623 CTATGCCTGTGTGGGGATGGAGG - Intergenic
1136108088 16:28045300-28045322 CTATGCATATGTGAAGAAAGGGG + Intronic
1137043219 16:35632934-35632956 CTATGCATATGTGTGGGAAGGGG - Intergenic
1137384732 16:48030764-48030786 CTCTGCCTCTGTGTTGAAAGGGG + Intergenic
1137741145 16:50776071-50776093 TTCTGCCTTTTTGTGGAAAGAGG + Intronic
1140837575 16:78809535-78809557 TTCTACCTATTTGGGGCAAGTGG - Intronic
1141162040 16:81635771-81635793 CTCTGCCCATTTGGGGGAGGGGG + Intronic
1147557656 17:41489621-41489643 CTCTGGCTTTGTGGGGAGCGGGG - Exonic
1148557966 17:48589887-48589909 GTCTGACTTTGTGGGGAAAAGGG - Intronic
1148647362 17:49226639-49226661 CGCTGCCTATCTAGGGTAAGTGG - Exonic
1150153153 17:62827614-62827636 CTCTGGTTATTTGGGGACAGTGG - Intergenic
1150779889 17:68113055-68113077 CTCTTACTATGTGATGAAAGAGG + Intergenic
1153029596 18:701365-701387 CTGTGCCTGTGTGGGGACAGGGG + Intronic
1153324421 18:3803536-3803558 CTCTGCCTTTTCTGGGAAAGAGG + Intronic
1153880099 18:9414866-9414888 CACAGCCTCTGTGGGGAGAGGGG + Intergenic
1155215510 18:23640148-23640170 CTCTGCCTATGTGGTCACATTGG - Intronic
1157746210 18:50138338-50138360 CGTTTCCTGTGTGGGGAAAGAGG - Intronic
1158051120 18:53221322-53221344 CTATGACTGTGTGGGGAAATGGG - Intronic
1158710579 18:59833944-59833966 CTCTGCCTCTGTGGGTAGAAGGG - Intergenic
1160196012 18:76756010-76756032 CACTGCACATGTGGGGACAGGGG + Intergenic
1163395150 19:17055744-17055766 CTCTGCCTTAGTTGGGGAAGAGG + Intronic
1163452422 19:17386221-17386243 CTCTGCCTATGGGGAAAATGAGG - Intergenic
1163890348 19:20006882-20006904 CTCTGCATATGTGAGGAATGTGG - Exonic
1164807168 19:31125936-31125958 CTCTGCCTCCGTGGGAGAAGAGG - Intergenic
1167380749 19:49136701-49136723 CTATCCCTGTGTGGGGACAGAGG - Intronic
1168638834 19:58017202-58017224 CTATGCCTATGTGGACAAAGTGG + Intergenic
926794255 2:16606042-16606064 ATCTGCCTATGGGTGGAAATTGG - Intronic
926947655 2:18205719-18205741 CTGTGCTTGTGTGGGGAAAAGGG - Intronic
926979256 2:18549786-18549808 CTCTGCCTATGTGCTATAAGGGG + Intergenic
927138867 2:20116183-20116205 CTCTGCCTATGTGGTGCAGGAGG - Intergenic
928366791 2:30709126-30709148 CTGTGCATATGTGGGGGCAGAGG - Intergenic
929369963 2:41211088-41211110 ATCTGCCTATCTGAGGGAAGAGG - Intergenic
930291584 2:49500381-49500403 CTCTGCACATGTTGTGAAAGTGG + Intergenic
931145245 2:59509421-59509443 CTCTGCATATGTGGGGATGGGGG + Intergenic
931697020 2:64879014-64879036 CTCTGCCTCTGGTGGGAAATGGG - Intergenic
931751087 2:65330534-65330556 CTTTGCATGTGTGGGGACAGGGG - Intronic
931928500 2:67101781-67101803 CTGTACCTATTTGGTGAAAGTGG - Intergenic
933282816 2:80351242-80351264 CTCTGCCTATGTGGGGAAAGAGG - Intronic
935433522 2:103003609-103003631 ATCTGGCTATGTGGGCACAGTGG - Intergenic
936687507 2:114845320-114845342 ATATGCATATGTGGGGACAGGGG + Intronic
938000951 2:127736555-127736577 CTTTGCCTATGTAGGTAAAATGG + Intronic
938099979 2:128492113-128492135 CTCTGCCTGTCTGTGGACAGTGG + Intergenic
938825657 2:135003080-135003102 CTCTGCCTCTGTGTGCACAGAGG + Intronic
941067861 2:160923733-160923755 CACTGTCTAGGTGGGGAAACTGG + Intergenic
941095516 2:161237124-161237146 CTGTACCTATCTGGTGAAAGGGG + Intergenic
941485707 2:166078477-166078499 CTCTGCGTGTGTAGAGAAAGGGG + Intronic
942204000 2:173601154-173601176 CTCTTCCAATGTGGAGAAATAGG - Intergenic
944356338 2:198792858-198792880 CTCTGCATATGGGAGGCAAGTGG + Intergenic
944482679 2:200174235-200174257 CTATGCATGTGTGGGGGAAGAGG - Intergenic
945735793 2:213598712-213598734 TTCTCCTTTTGTGGGGAAAGAGG + Intronic
945798491 2:214394643-214394665 CTGTGCATGTGTGGGGATAGGGG - Intronic
946398894 2:219458284-219458306 CTCTGCCTATGAGGGGAGCTTGG + Intronic
946750195 2:222886825-222886847 CTATGCCTGTGTAGGGGAAGGGG - Intronic
947853422 2:233306856-233306878 CTCTGCCTCTGTGTGGAAAAGGG + Intergenic
947921212 2:233876039-233876061 CTGTGCATGTGTGGGGACAGGGG - Intergenic
948035114 2:234852233-234852255 CTTTGCCCAAGTTGGGAAAGGGG - Intergenic
948188382 2:236039433-236039455 CTCTCTCTAGGTGGGGAAAAAGG + Intronic
948383550 2:237567692-237567714 CTGTGCGGATGTGGGGGAAGGGG - Intergenic
1168848189 20:959403-959425 TCCTGCCCATGTGGGGAAACAGG - Exonic
1169833965 20:9856845-9856867 CTGTGCATATGTTGGGGAAGTGG + Intergenic
1170997545 20:21377828-21377850 CTCTGGCTATGAGGGCAGAGAGG + Intronic
1171823563 20:29876019-29876041 CTCTGGGTGTGTGGGGCAAGAGG + Intergenic
1171896527 20:30814326-30814348 CTCTGGGTGTGTGGGGCAAGAGG - Intergenic
1172616351 20:36288054-36288076 CTCTGCGTATGTAGGGATGGGGG - Intergenic
1172952367 20:38730288-38730310 CTCTGCCTCCGTGGTGACAGCGG - Intergenic
1173008682 20:39160804-39160826 CTCTGGTGATGGGGGGAAAGTGG - Intergenic
1173457499 20:43215344-43215366 CTCTGTGTGTGTGGGCAAAGTGG - Intergenic
1173846044 20:46189396-46189418 CTCTGCCTCTGCTGGGAAAGAGG - Intronic
1174504080 20:51005367-51005389 CTCTGGCTATGTGTGGAAAATGG - Intronic
1175993937 20:62804201-62804223 CACTGCCTATGGAGGGACAGGGG + Intergenic
1177667793 21:24184099-24184121 TTCTGCCCCAGTGGGGAAAGTGG - Intergenic
1177683287 21:24403106-24403128 CTGTGCATGTGTGGGGACAGGGG + Intergenic
1177846369 21:26292361-26292383 CTCTGGATATTTGGAGAAAGAGG + Intergenic
1178496515 21:33090711-33090733 CTCTGCCTAAGTGGTCAGAGAGG - Intergenic
1178811694 21:35888585-35888607 GTGTGCCTATGTGAGGAAAGGGG - Intronic
1179017218 21:37604431-37604453 CCCTGCCTAGGTGGTGAATGTGG + Intergenic
1179227639 21:39469175-39469197 CTCTGCATGTGTGGGAACAGGGG - Intronic
1179610059 21:42544608-42544630 CTCTGCAGAAGCGGGGAAAGGGG - Intronic
1179677931 21:42997298-42997320 CGCTGCCTGTGTGGGGATGGAGG + Intronic
1179953466 21:44724460-44724482 CTCTGGCTCTGTGGGGAAGGTGG + Intergenic
1180019323 21:45111373-45111395 CTGTGCCTGTGTGGGGGCAGGGG - Intronic
1180338301 22:11598945-11598967 CTCTGGGTGTGTGGGGCAAGAGG + Intergenic
1182515723 22:30857842-30857864 ATCTGCCTGTGTGGAGTAAGAGG + Intronic
1183318940 22:37153280-37153302 CTCTGCAAATGTGAGAAAAGTGG + Intronic
1183606440 22:38869109-38869131 CCCTGCCTTTGTGTGGGAAGGGG - Intronic
1183777861 22:39979359-39979381 CTATGCGTGTGTGGGGACAGGGG + Intergenic
1184189996 22:42888062-42888084 CTCTGCTTGTGTAGGGAGAGGGG - Intronic
1184359642 22:44007257-44007279 CTCCGCCTATGGGAGGAAGGTGG + Intronic
949226043 3:1697578-1697600 CTCTGGATATGAAGGGAAAGAGG + Intergenic
950221927 3:11202671-11202693 CTGTGCATATGTGAGGACAGAGG - Intronic
951412376 3:22380429-22380451 CTCTGCATAGGAGGGCAAAGTGG + Intergenic
952685773 3:36146754-36146776 CTGTGTCTATGTGGAGAAATTGG + Intergenic
953743860 3:45558159-45558181 CTCTGCCCATGTGCAGAAGGTGG + Intronic
954220710 3:49151952-49151974 GTCTGCCTATGGTGGGAAAAGGG + Intergenic
954680578 3:52343902-52343924 GTCTGCCTATGTGAGGACGGGGG + Intronic
959500080 3:107096778-107096800 CTATGCATATGTCGGGATAGGGG + Intergenic
959544307 3:107576184-107576206 CTTTGCAGATGTGGGGAAACTGG + Intronic
961591716 3:127986239-127986261 CTCTGCATATGAGGGAAATGAGG - Exonic
963959464 3:151292828-151292850 CTGTGACTTTCTGGGGAAAGTGG + Intronic
966497565 3:180598529-180598551 CTATGCATATGTGGGGGCAGGGG + Intergenic
966525594 3:180915659-180915681 TTCTGCCTATACGGGGTAAGAGG - Intronic
966880307 3:184346325-184346347 CTCCCCCTTTGAGGGGAAAGGGG - Exonic
966913925 3:184574715-184574737 CTCTTCCTAAGTGGAGAAAGGGG + Intronic
967899624 3:194436158-194436180 TTCTGCCTATTTGGGGGAGGTGG - Intronic
968488878 4:879226-879248 CTCTGCCTCCGTGCTGAAAGAGG + Intronic
970325796 4:14924471-14924493 CTGTACCTATGTAGGGCAAGGGG + Intergenic
970523383 4:16908000-16908022 CTCTGCCCATGTGGTGACCGTGG + Intergenic
971298788 4:25424915-25424937 CTCTGGCCATTTGGGGAATGAGG + Intergenic
972087305 4:35235129-35235151 ATATGTCTATGTGGGGAAGGTGG - Intergenic
974027968 4:56750751-56750773 GTTTGCCAAAGTGGGGAAAGAGG + Intergenic
976543109 4:86300915-86300937 CTAAGCCTAAGTGGGGAGAGAGG + Intronic
977762752 4:100759168-100759190 CTCAGCCACTGTGGGGAAGGCGG - Intronic
982123662 4:152165743-152165765 CTCTGCATGTCTGGGGAAACAGG - Intergenic
982215437 4:153079331-153079353 CTCTGCCAAATTGGGAAAAGAGG - Intergenic
982720521 4:158855042-158855064 CTATGCCTTTGGGGAGAAAGAGG + Intronic
982807302 4:159782421-159782443 CTGTGCATGTGTGGGGATAGAGG - Intergenic
983514485 4:168641834-168641856 CTATGCCTCTCTGGGGAAACTGG - Intronic
984213282 4:176877010-176877032 GTCTTCCTAAGTGGGGAATGTGG + Intergenic
985031476 4:185794824-185794846 TCCTGCCTATGTGAGGAATGTGG + Intronic
985445035 4:190017207-190017229 CTCTGGGTGTGTGGGGCAAGAGG + Intergenic
986644014 5:9898789-9898811 CTCTGCCTGTCTGTGGACAGGGG - Intergenic
987129852 5:14850230-14850252 CACTGCCTGGGTGGGGAAGGTGG + Intronic
987403733 5:17503657-17503679 CTATGCATATGTGGGGAAAGAGG - Intergenic
987411198 5:17616402-17616424 CTATGCATATGTGGGGAAAGGGG - Intergenic
987703899 5:21438359-21438381 CTCTGCCTCTGTGGGTAAAGTGG + Intergenic
988124624 5:27013450-27013472 CTCATCCTATGTTCGGAAAGAGG - Intronic
990121293 5:52456380-52456402 CTCTGACTGTGTGGGGAACAAGG + Intergenic
990744790 5:58948803-58948825 CTAGGGCTATGTGGGGAGAGAGG + Intergenic
992024182 5:72654332-72654354 CCCTCCCTCTGTGGGGAGAGAGG - Intergenic
992154480 5:73941422-73941444 CTCTGCCTATGTGGGCACTGAGG - Exonic
993872767 5:93271617-93271639 CTTTCCTTATGTGGGGAAAGAGG + Intergenic
994124569 5:96154951-96154973 CACTGCTTAAGTGGGGGAAGTGG - Intergenic
994976572 5:106815361-106815383 CTCTGTCTTTTCGGGGAAAGTGG - Intergenic
995008641 5:107232299-107232321 CTGTGCATGTGTGGGGCAAGGGG + Intergenic
995048083 5:107672002-107672024 CTGTGCCTAAGGAGGGAAAGAGG - Intergenic
995709100 5:115016539-115016561 CTGTGCATGTGTGGGGAGAGGGG + Intergenic
996878371 5:128264742-128264764 TTCAGCCCATGTGGGGAAACAGG + Intronic
996932389 5:128905390-128905412 ATCTGCCTAAGTAGAGAAAGAGG + Intronic
996987647 5:129586082-129586104 CTATGCATATGTGTGGACAGGGG - Intronic
997054957 5:130431133-130431155 CTATGCATGTGTGGGGAAATGGG + Intergenic
998311125 5:141133378-141133400 CTGTGCTTGTGTGGGGACAGGGG + Intronic
999212108 5:149898760-149898782 TTTTGCCTATGTGGGGATAGGGG + Intronic
999917697 5:156281435-156281457 GTGTGCCTGTGTGTGGAAAGCGG + Intronic
1000092788 5:157944901-157944923 CACTGCAGAAGTGGGGAAAGAGG - Intergenic
1001197345 5:169685576-169685598 CTCTGCCTTTGTGGGAAAAATGG + Intronic
1001728444 5:173928385-173928407 CTATGCATATGTGGGGGCAGGGG + Intronic
1001786293 5:174416723-174416745 CTGTGCATGTGTGGGGTAAGGGG - Intergenic
1002000779 5:176195269-176195291 CTCAGCCTCTGTGGGGCTAGAGG + Intergenic
1002253557 5:177943701-177943723 CTCAGCCTCTGTGGGGCTAGAGG - Intergenic
1005252477 6:23963287-23963309 CTGTGTCTTTGTTGGGAAAGAGG - Intergenic
1007364993 6:41385032-41385054 CTGTGTGTATGTGGGGAAGGGGG - Intergenic
1007905246 6:45453348-45453370 CATTACCTATGTGGGGACAGTGG + Intronic
1008073519 6:47121298-47121320 CTATGCATGTGTGGGGGAAGGGG - Intergenic
1008645072 6:53505451-53505473 CTCTGCCTATGTGGTGTTTGTGG - Exonic
1010079326 6:71840540-71840562 CTATGTTTATGTGGGGGAAGGGG - Intergenic
1011624407 6:89271567-89271589 CTGTGCCTGTGTGGGCAGAGCGG - Intronic
1013759787 6:113503902-113503924 CTGTGCATGTGTGGGGACAGGGG + Intergenic
1014148934 6:118031031-118031053 CTGTGCCTGTGTGGGGAGAGGGG - Intronic
1018277987 6:162153514-162153536 CTCTGCCAGTGAGGGCAAAGGGG + Intronic
1018990110 6:168668197-168668219 CTCTTCCCATGTGTGGAAGGAGG - Intronic
1019602076 7:1889829-1889851 CTCTGCCTGGGTGGGGTGAGGGG - Intronic
1019833841 7:3360770-3360792 CTCTGCCTCTGTGGGGAGGGGGG - Intronic
1021248699 7:18296799-18296821 GTCTGCCTCTGTGGAGAAAGGGG + Intronic
1021786551 7:24158159-24158181 CCATCCCTCTGTGGGGAAAGGGG - Intergenic
1022629914 7:32075465-32075487 GGCTTCCTTTGTGGGGAAAGGGG + Intronic
1023750891 7:43371382-43371404 CTGTGCGTGTGTGGGGACAGGGG + Intronic
1029976127 7:104835918-104835940 CTCCTCCCATTTGGGGAAAGGGG - Intronic
1032896537 7:136257080-136257102 TTCTACCTAATTGGGGAAAGGGG + Intergenic
1034053599 7:148010750-148010772 CTGTGCATATGTGGGGGCAGAGG - Intronic
1034987875 7:155528580-155528602 TCCTGCCTATGCGGGGACAGGGG - Intronic
1035321303 7:158030877-158030899 CTCTGGCTGTGTGGGGCCAGAGG - Intronic
1037935230 8:22911027-22911049 CTGTGCCTGTGTGGGGGCAGGGG + Intronic
1038419709 8:27425517-27425539 CTGTGCATGTGTGGGGAAGGGGG - Intronic
1039296123 8:36157135-36157157 CTCTGCCTCTCTGGGGAAGGAGG + Intergenic
1039342115 8:36661978-36662000 TACTGCAGATGTGGGGAAAGGGG + Intergenic
1041135664 8:54755687-54755709 CTCTGTCTCTTTGGGGAGAGGGG + Intergenic
1042770425 8:72374781-72374803 CAGTACCTATGTGGGGGAAGAGG - Intergenic
1044507108 8:93034896-93034918 CTCAGAATTTGTGGGGAAAGGGG - Intergenic
1044556352 8:93566284-93566306 CTCTGCCTATGTTGAATAAGAGG + Intergenic
1044848114 8:96401483-96401505 CTATGCCTGTGTGGGGGCAGGGG + Intergenic
1046952391 8:120030941-120030963 CCGTGCCTATGTGGGGCAGGAGG + Intronic
1047161958 8:122390572-122390594 CTATGCATGTGTGGGGCAAGTGG + Intergenic
1049441022 8:142609892-142609914 CCCTGCCTTTGTGGGGACACTGG - Intergenic
1049441066 8:142610048-142610070 CCCTGCCTTTGTGGGGACACTGG - Intergenic
1049441081 8:142610100-142610122 CCCTGCCTTTGTGGGGACACTGG - Intergenic
1049441096 8:142610152-142610174 CCCTGCCTTTGTGGGGACACTGG - Intergenic
1049938925 9:526050-526072 CTCTGCCTCTGAGGAGAATGGGG + Intronic
1051721887 9:20045929-20045951 CTCTCCATATGTGGGGAGTGTGG - Intergenic
1053749164 9:41235639-41235661 CTCTGGGTGTGTGGGGCAAGAGG - Intergenic
1054254601 9:62800492-62800514 CTCTGGGTGTGTGGGGCAAGAGG - Intergenic
1054336702 9:63815110-63815132 CTCTGGGTGTGTGGGGCAAGAGG + Intergenic
1055150936 9:72998754-72998776 TTGTGCCTCTGTGGAGAAAGAGG - Intronic
1055425368 9:76190065-76190087 CTATGCCTGTGTGGGGAAAACGG - Intronic
1058381748 9:104384357-104384379 TTCTGCCTAGTTGGGGAAGGAGG - Intergenic
1058763564 9:108160219-108160241 ATGTGGCTTTGTGGGGAAAGGGG - Intergenic
1059590367 9:115652982-115653004 CTCTCTCTTTATGGGGAAAGAGG - Intergenic
1059890011 9:118791148-118791170 CTCTTCCTAAGTGTGAAAAGAGG + Intergenic
1060504046 9:124184823-124184845 CTGTGCCCATGTGGGGGCAGAGG - Intergenic
1061779945 9:132989593-132989615 CTCTGCCTCTGAGGTGAAACTGG - Intronic
1185505186 X:627933-627955 CTCTGCCTCTGCTGGGAAACTGG - Intronic
1187787744 X:22911782-22911804 CTCTTCATATGTGAGGTAAGTGG - Intergenic
1188809281 X:34632836-34632858 CTTTGCCTTTGTGAGGAAAAGGG + Intronic
1189268501 X:39734230-39734252 CTCTGGCTATCTGGAGAAATTGG + Intergenic
1191146311 X:57169094-57169116 CTGTGCATCTGTGGAGAAAGAGG + Intergenic
1192025466 X:67445688-67445710 CTCTGCCTATGGATTGAAAGTGG + Intergenic
1192963803 X:76156449-76156471 CTGTGGCTATTTGAGGAAAGTGG + Intergenic
1195235550 X:102894005-102894027 CTCTTACTCTGTGGGGAAATAGG - Intergenic
1196894287 X:120319592-120319614 CTCTGCCTAGGTGGGAGGAGAGG + Intergenic
1197368274 X:125594231-125594253 CTATGCATGTGTGGGGATAGGGG + Intergenic
1197706830 X:129640136-129640158 CTCTGCCTAGATGGAAAAAGAGG + Intergenic
1197900454 X:131366142-131366164 CTCTTCCTTAGTGGGCAAAGAGG + Intronic
1198255594 X:134921672-134921694 CTGTGCATATGTGGGGGCAGGGG + Intergenic
1199334282 X:146600312-146600334 CTCTGCCTTTGAGGGAAGAGTGG - Intergenic
1200032234 X:153306192-153306214 TACTGACTATGTGGGGGAAGAGG - Intergenic
1201065426 Y:10091021-10091043 CTCTGGGTGTGTGGGGTAAGAGG - Intergenic
1201073418 Y:10169952-10169974 CTCTGGGTGTGTGGGGCAAGAGG + Intergenic