ID: 933284148

View in Genome Browser
Species Human (GRCh38)
Location 2:80366504-80366526
Sequence AAGATGATCTGTAGGACACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 101}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933284148_933284150 6 Left 933284148 2:80366504-80366526 CCTGGTGTCCTACAGATCATCTT 0: 1
1: 0
2: 0
3: 17
4: 101
Right 933284150 2:80366533-80366555 TCTGCAGATCTAGCCGATGAAGG 0: 1
1: 0
2: 0
3: 1
4: 42
933284148_933284151 17 Left 933284148 2:80366504-80366526 CCTGGTGTCCTACAGATCATCTT 0: 1
1: 0
2: 0
3: 17
4: 101
Right 933284151 2:80366544-80366566 AGCCGATGAAGGCTGTCACATGG 0: 1
1: 0
2: 0
3: 9
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933284148 Original CRISPR AAGATGATCTGTAGGACACC AGG (reversed) Intronic
906425210 1:45706186-45706208 AAGATAATTTGTTGAACACCTGG + Intronic
907297341 1:53463744-53463766 AAAATACTTTGTAGGACACCAGG + Intronic
907308320 1:53525719-53525741 GAGATGGCCTGTAGGGCACCAGG - Intronic
909678860 1:78268702-78268724 CACATGATCTGTAGCCCACCAGG - Intergenic
914868036 1:151449417-151449439 AGGATGTTCTGTAGCACTCCTGG - Intronic
919085699 1:192917969-192917991 TAGATGATCAGCAGGACACAGGG - Intergenic
921164160 1:212494159-212494181 TAAATAATCTGTAGGACACATGG + Intergenic
1063403136 10:5767286-5767308 AAGATGATCTGTAGAACAAAGGG - Intronic
1063961247 10:11307161-11307183 AAGAGGCGCTGGAGGACACCAGG - Intronic
1064117953 10:12595044-12595066 AAGGTGATCTGGGGGAGACCAGG + Intronic
1066027745 10:31380714-31380736 CAGATGATATTTAAGACACCAGG - Intronic
1071752254 10:88493354-88493376 AAGATGATCTGTATGAGATGGGG - Intronic
1075510476 10:123068227-123068249 AAGATGATCTGCATGACATTTGG + Intergenic
1086985367 11:93242752-93242774 AAGAGGATAGGTAGGACACATGG - Intergenic
1088061898 11:105663625-105663647 ATGATGATGTGGATGACACCAGG + Intronic
1090634657 11:128683500-128683522 TAGATTATCTTTAGGAAACCTGG - Intergenic
1092510964 12:9156314-9156336 AAGATGGTCAGTAGGACAAAGGG - Intronic
1097889914 12:64767670-64767692 AAGATGTTCTGCAGGATACCTGG - Intergenic
1100960638 12:99958935-99958957 GAGATGTTCAATAGGACACCGGG + Intronic
1102596684 12:113998238-113998260 AAGAGCATCTGTAAGAAACCAGG - Intergenic
1106652500 13:31706669-31706691 AAAATGATCTGTAGGGTACAGGG + Intergenic
1112608317 13:100929914-100929936 AAGATGAAATGGAGGACACAGGG + Intergenic
1113285607 13:108845179-108845201 AAGAAGATCTTTAGAAAACCTGG - Intronic
1113883936 13:113647486-113647508 AGGGTGATATGTGGGACACCAGG - Intergenic
1120584507 14:86295242-86295264 AAGCTGGTCTGAAGGACCCCAGG + Intergenic
1122076221 14:99236671-99236693 AAGATGGTCTTTAGGAGAGCAGG + Intronic
1123425202 15:20165098-20165120 TAGATGGACTGTAGCACACCAGG + Intergenic
1123534426 15:21171632-21171654 TAGATGGACTGTAGCACACCAGG + Intergenic
1126694283 15:51313039-51313061 AAGATGACCTCCAGCACACCAGG - Intronic
1127279681 15:57478261-57478283 AAGATGCTCTGTAGGAGAGGCGG + Intronic
1131024661 15:89129817-89129839 AAGATGATTTATAGGATACTTGG + Intronic
1131836765 15:96398680-96398702 AAGTTGAACTGTAGGAGACAGGG - Intergenic
1135032141 16:19047066-19047088 AAGAGGAACAGTAGGTCACCAGG - Exonic
1136859659 16:33690645-33690667 TAGATGAACTATAGCACACCAGG - Intergenic
1140908632 16:79431044-79431066 AAAATGATCTGCAGGTCCCCAGG - Intergenic
1203121165 16_KI270728v1_random:1538824-1538846 TAGATGAACTATAGCACACCAGG - Intergenic
1151009116 17:70473015-70473037 AAGTTGATCTTTAGGTCACTGGG - Intergenic
1153659905 18:7317229-7317251 AAGATGAGCTGGAGCACACAGGG - Intergenic
1154406748 18:14098811-14098833 AAGATGCTCTATAGAACACGAGG - Intronic
1155111916 18:22724135-22724157 AAGAGGATCAGTAGGACCCCCGG + Intergenic
1155591325 18:27430077-27430099 ATGATGATCTTAAGGAAACCTGG + Intergenic
1157324917 18:46662081-46662103 CAGCTGATCTGAAGGACCCCAGG + Intergenic
1159032056 18:63241582-63241604 CAGATGATCTGCTGGACAGCAGG - Intronic
1159552539 18:69910458-69910480 GAGATGCTCTGCAGGACACTGGG + Intronic
1168529313 19:57115014-57115036 AAGATGATCCAAAGGACAGCGGG + Intergenic
926796776 2:16625973-16625995 ATGATGATCAGGAGGAAACCCGG - Intronic
929830435 2:45342731-45342753 AAGCTGATCTGTGGGAGACAAGG - Intergenic
933284148 2:80366504-80366526 AAGATGATCTGTAGGACACCAGG - Intronic
934458019 2:94191755-94191777 TAGATGAACTGTAGCACACCAGG - Intergenic
941256251 2:163234941-163234963 AAGATAATCTGTAGCATACCTGG - Intergenic
942383924 2:175421647-175421669 AAGATGATCTGGTGTACACATGG - Intergenic
944198577 2:197081368-197081390 AGAATGATATTTAGGACACCAGG + Intronic
945819457 2:214646057-214646079 GAGAGCATCTGTCGGACACCAGG - Intergenic
947625474 2:231615601-231615623 AAGCTGATCAAGAGGACACCTGG - Intergenic
1170935004 20:20802146-20802168 ATGGTTATCTGTAGGACACAAGG - Intergenic
1178156521 21:29860169-29860191 AAGAGGATCAGTTAGACACCAGG - Intronic
1178438753 21:32581720-32581742 AGGATGAACAGAAGGACACCAGG + Intronic
1178542614 21:33467191-33467213 TATATGATCTGTAGGACAAAAGG - Intronic
1181358191 22:22314673-22314695 TAGATGAACTGTAGCACACCAGG + Intergenic
1182800262 22:33026411-33026433 AAGGTGATCTGGAGCACTCCAGG - Intronic
1183730047 22:39613353-39613375 TAGAGGATCAGTGGGACACCAGG + Intronic
949368519 3:3309158-3309180 AAGGTGAACTATAGGACACAAGG + Intergenic
949757239 3:7426352-7426374 AGCATGGTCTGTAGGGCACCTGG + Intronic
950654526 3:14428305-14428327 AAGATGATCTGTAAAGCACTCGG + Intronic
951943987 3:28113694-28113716 AACATAATCTGCATGACACCTGG - Intergenic
954044491 3:47917773-47917795 AAGATAATCTGTGGGACAGCAGG + Intronic
957350036 3:79012832-79012854 AAGATGATCTGTAGTGTACAGGG - Intronic
963822084 3:149908697-149908719 AAGCTGATCTATAGGACAGAAGG + Intronic
965706511 3:171513407-171513429 AAGTTGATCTATATGACAACTGG - Intergenic
966787914 3:183636740-183636762 AAGGTGATCTGGAGGACGCGCGG + Intronic
975973203 4:80067359-80067381 AAGATGAAGTGTAGGTCACTGGG - Intronic
978550833 4:109924594-109924616 AAGAGGATCTGTAAGTCATCAGG - Intronic
979460009 4:120971215-120971237 AAGGTGATCTGTGGGGCACAGGG + Intergenic
981043767 4:140247324-140247346 AAGAAGCTCTGTAGGATCCCAGG - Intergenic
981762042 4:148205351-148205373 AAGATGTACTATAGGACATCTGG + Intronic
982849703 4:160297008-160297030 ATGCTGCTATGTAGGACACCTGG + Intergenic
986737515 5:10679084-10679106 AAGTAGAACTGTTGGACACCTGG - Intergenic
988516412 5:31908452-31908474 AAGATGGTCTGTAGGAGAGAGGG + Intronic
999684283 5:154088528-154088550 AAGATGAATTGCAGGACAGCTGG + Intronic
1000634785 5:163631574-163631596 AATCTGCTCTGTAGGATACCTGG - Intergenic
1002366268 5:178714587-178714609 AAGAGGATCTGTAGGAAAATAGG - Intronic
1003142203 6:3481042-3481064 AGGATGATCTGGAGGAGACAAGG - Intergenic
1005245520 6:23880026-23880048 AAGATGATCTGGGGGACATGTGG - Intergenic
1006263717 6:32897729-32897751 AAAATGATCTGTGTGACGCCAGG - Intergenic
1007216333 6:40242773-40242795 ATGATGCTATGTAGGACAACTGG - Intergenic
1010375828 6:75168881-75168903 ATGATGCTCTGTAGGACTGCTGG + Intronic
1011374582 6:86675642-86675664 CAGATGATCTGGAGGACATTTGG + Intergenic
1012187461 6:96237159-96237181 AAAATAATTTGTAGGACATCTGG - Intergenic
1012815658 6:104018913-104018935 ATCAGGATCTGTAGGCCACCAGG + Intergenic
1013967951 6:115978161-115978183 AAGATTTTCTGTAGGAAACTGGG - Intronic
1018794347 6:167174424-167174446 AAGATGAACAGAAGGACACCGGG - Intronic
1018821972 6:167380643-167380665 AAGATGAACAGAAGGACACCGGG + Intronic
1022451372 7:30518560-30518582 AATATGATCTGTGGGCCACTGGG + Intronic
1024412615 7:49063356-49063378 CAGGTGATCTGTAGGAAGCCAGG + Intergenic
1029452282 7:100647741-100647763 CAGCTGATCTGGAGAACACCAGG + Intronic
1039362182 8:36888578-36888600 AAGATGCTCAGTAAGACAACAGG + Intronic
1042739573 8:72028091-72028113 AAGATGGTGTTTAGGACTCCAGG - Intronic
1047158748 8:122352531-122352553 ATGATGAAATGTAGGACACTGGG - Intergenic
1051308201 9:15739257-15739279 AACATGTTCTGTAGAACACCCGG - Intronic
1053688530 9:40567560-40567582 TAGATGAACTGTAGCACACCAGG - Intergenic
1054275502 9:63063498-63063520 TAGATGAACTGTAGCACACCAGG + Intergenic
1054299769 9:63368471-63368493 TAGATGAACTGTAGCACACCAGG - Intergenic
1054399331 9:64701433-64701455 TAGATGAACTGTAGCACACCAGG - Intergenic
1054432911 9:65185698-65185720 TAGATGAACTGTAGCACACCAGG - Intergenic
1054497474 9:65835977-65835999 TAGATGAACTGTAGCACACCAGG + Intergenic
1056554612 9:87678130-87678152 ACCATGATCTGTAGAACACGAGG - Intronic
1058910486 9:109516208-109516230 AAGATGGTCTGCCAGACACCGGG + Intergenic
1060676187 9:125517252-125517274 AAGATGCTGTGTGGGAGACCAGG + Intronic
1187201743 X:17140569-17140591 AAGATGAACTGATGGACACAAGG - Intronic
1189138227 X:38572600-38572622 ATGATGATGTGTAGAACTCCTGG + Intronic
1193213219 X:78832963-78832985 AGGATGATCTGTATTACTCCTGG + Intergenic
1196319048 X:114267185-114267207 AAGAAGAACTGGAGTACACCAGG + Intergenic
1196328562 X:114439057-114439079 AAGATGGTTTGGGGGACACCTGG - Intergenic
1197124660 X:122930201-122930223 AAGAGCATCTGTAAGACACAAGG + Intergenic
1197934754 X:131728900-131728922 AGGCTGATCTGTAGGCCCCCAGG + Intergenic
1199450758 X:147976697-147976719 CAGGTGATCTGTAGGACAACGGG + Intergenic
1200375889 X:155779829-155779851 ACAATGATCTATAGGACACAGGG - Exonic
1201917836 Y:19201898-19201920 AAAAGGAACTGTAGGACCCCAGG - Intergenic
1202057463 Y:20849913-20849935 TAGATGATCCTTAGGACTCCTGG + Intergenic