ID: 933285314

View in Genome Browser
Species Human (GRCh38)
Location 2:80378904-80378926
Sequence GAGAGTTCTGTGTAGGCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 167}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933285308_933285314 16 Left 933285308 2:80378865-80378887 CCGACATCAGAAAGCACTGATCT 0: 1
1: 0
2: 2
3: 23
4: 195
Right 933285314 2:80378904-80378926 GAGAGTTCTGTGTAGGCTCTGGG 0: 1
1: 0
2: 0
3: 16
4: 167
933285307_933285314 17 Left 933285307 2:80378864-80378886 CCCGACATCAGAAAGCACTGATC 0: 1
1: 0
2: 1
3: 12
4: 180
Right 933285314 2:80378904-80378926 GAGAGTTCTGTGTAGGCTCTGGG 0: 1
1: 0
2: 0
3: 16
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933285314 Original CRISPR GAGAGTTCTGTGTAGGCTCT GGG Intronic
904662472 1:32095563-32095585 GTGACTTCTGTGTCTGCTCTGGG - Intronic
905389542 1:37627359-37627381 TCAAGTTCTGTGTAGACTCTGGG - Intronic
906148913 1:43576444-43576466 AAGAGTTCTGTGTAGGTGCTAGG + Intronic
907719252 1:56956257-56956279 GAGAGCTCTTTGTAGACTGTTGG - Intronic
907724967 1:57011243-57011265 GAGAGCTCTGTCTAGGGGCTGGG + Exonic
908963118 1:69725951-69725973 GAGAGTGCTGTCTAGGCTACAGG - Intronic
910457233 1:87411017-87411039 GAGCATTCTGTTTGGGCTCTGGG - Intergenic
912955792 1:114153506-114153528 GGGAGTTCTCTCTAGGTTCTGGG + Intronic
913712080 1:121495262-121495284 CAGAGTTCTGTGTAAGATCAAGG - Intergenic
916201146 1:162272852-162272874 GACACGTCTCTGTAGGCTCTGGG - Intronic
916432602 1:164745772-164745794 GAGACTTTTCTGAAGGCTCTTGG - Intronic
917431733 1:174976568-174976590 CAGAGATCTCTGTAGGCTTTCGG - Intronic
917923038 1:179766670-179766692 GAAAGTTCTGTCTATGCTGTGGG - Intronic
918779394 1:188677831-188677853 GAGCATTCTGTGTATGCTCTGGG - Intergenic
919768195 1:201140720-201140742 GAAAATTCTGTCTAGGCTCCAGG - Intronic
923357569 1:233175557-233175579 GAGACTTTTGGGTAGACTCTGGG + Intronic
923389737 1:233502277-233502299 GAGAGTCCTGTGTAGGTTGAAGG - Intergenic
923951731 1:238963636-238963658 GAGAGTTATGAGTAGCCTCAAGG + Intergenic
924315126 1:242787483-242787505 GAGAGTTGTGTGTGGGATGTGGG - Intergenic
1065361619 10:24894560-24894582 CAGAGTTCTGTGAAGGCACCCGG + Intronic
1066449924 10:35519651-35519673 GAGACTTCAGTGTAGATTCTGGG + Intronic
1067941681 10:50661802-50661824 GAAAGTTCTGAGTGGACTCTGGG - Intergenic
1067994489 10:51256182-51256204 CAGAGGTCTGTGGGGGCTCTTGG - Intronic
1068795715 10:61077557-61077579 GAAAGTTCTATGCAGGCTTTAGG + Intergenic
1070967186 10:80536683-80536705 GCGAGTCCTGTGGCGGCTCTAGG + Intergenic
1071244654 10:83749885-83749907 CAGAATGCTGTGTAGGCTATAGG - Intergenic
1075970918 10:126651668-126651690 CAGTGTTCTGTATAGACTCTGGG - Intronic
1076741197 10:132486584-132486606 GAGAGCTCTGTGTGGACTCGGGG - Intergenic
1077452170 11:2654822-2654844 GAGAGCTCTATGTAGCCTCATGG + Intronic
1077844772 11:6012926-6012948 CTGAGATCTGTGTAGGTTCTGGG + Intergenic
1080645547 11:34185049-34185071 GGGACTTTTGTTTAGGCTCTTGG + Intronic
1081966402 11:47172791-47172813 GGGAGCTCTGTGGAGGCTCTGGG - Intronic
1086023148 11:82256567-82256589 GAGAGTTGTGAGCAGCCTCTAGG - Intergenic
1086414079 11:86571355-86571377 TCCAGTTCTCTGTAGGCTCTAGG + Intronic
1087075953 11:94127581-94127603 GAGAGAGCTGTATACGCTCTTGG + Intergenic
1088383584 11:109223963-109223985 GAGAGTGCTCTGTATGGTCTAGG - Intergenic
1092600688 12:10059824-10059846 GAGAGTTCTTTGTACATTCTAGG - Intronic
1093138369 12:15478581-15478603 GAGAGTTCTGTTTACCCTATTGG + Intronic
1096387662 12:51205446-51205468 GAGTGTTCTGAGGAGGCTCAGGG - Intronic
1096780620 12:53989937-53989959 GAGGGTTTGGTGGAGGCTCTGGG - Exonic
1099592298 12:84610359-84610381 GAGAGTGCTATGTTGGCTCAGGG + Intergenic
1103643405 12:122371325-122371347 GAGAACTTTGTATAGGCTCTTGG - Intronic
1107805743 13:44152351-44152373 GAGTGTCCTGTGAAGGCTGTGGG - Intronic
1108191750 13:47948477-47948499 GAGAGTTCAGAGTAGCCTTTGGG - Intronic
1108489351 13:50964947-50964969 GAGAGTACTGAGTAGGAGCTGGG - Intronic
1111883062 13:93982941-93982963 AAGAGATCTGTGTCAGCTCTAGG + Intronic
1113717564 13:112523732-112523754 GAGAGTTCCGAGGAGGCTCTGGG - Intronic
1118347611 14:64951311-64951333 GAGAGTTCTGTGATGGGCCTGGG - Intronic
1121588679 14:95082493-95082515 CAGAGTTCAGGGGAGGCTCTGGG - Intergenic
1125920878 15:43524968-43524990 GAGACTTGGGGGTAGGCTCTTGG - Exonic
1126982241 15:54257521-54257543 GGCAGTTTTTTGTAGGCTCTTGG + Intronic
1128837262 15:70819598-70819620 GAGAGTTCTTTATATACTCTGGG + Intergenic
1129067400 15:72917094-72917116 AAGAGTTCTGTGGTTGCTCTAGG - Intergenic
1129206838 15:74042274-74042296 GAGAGAGCAGTGGAGGCTCTTGG - Intronic
1129255758 15:74333134-74333156 GAGAGGCCTGTGTAGGGTCCAGG - Intronic
1132349485 15:101130576-101130598 GAGAGTTCTGTGGAGGGGCTGGG + Intergenic
1132349498 15:101130661-101130683 GAGAGTTCTGTGGAGGGGCTGGG + Intergenic
1132349511 15:101130746-101130768 GAGAGTTCTGTGGAGGGGCTGGG + Intergenic
1132349524 15:101130831-101130853 GAGAGTTCTGTGGAGGGGCTGGG + Intergenic
1132349537 15:101130916-101130938 GAGAGTTCTGTGGAGGGGCTGGG + Intergenic
1132349550 15:101131001-101131023 GAGAGTTCTGTGGAGGGGCTGGG + Intergenic
1132922270 16:2403369-2403391 CAGAGTTCTGTTGAGACTCTAGG - Intergenic
1134034448 16:11018904-11018926 GAGAGTGATGAGTAGGCACTGGG + Intronic
1135113377 16:19707721-19707743 GAGTGCTCTGTGTAGGGTCGTGG - Intronic
1135711055 16:24717621-24717643 TAGACTTCTGTGTGGTCTCTGGG - Intergenic
1140323083 16:73972679-73972701 GGCAGTTCTGTGCAGGATCTGGG - Intergenic
1142744391 17:1948436-1948458 GAGGTTTCAGTGAAGGCTCTGGG + Intronic
1146187566 17:30734892-30734914 TATAGATCTGTGTTGGCTCTAGG - Intergenic
1146332623 17:31940281-31940303 TATAGATCTGTGTTGGCTCTAGG - Exonic
1147480854 17:40761625-40761647 GTGGATTCTGTGTAGTCTCTGGG + Intergenic
1147556067 17:41479914-41479936 GAGTGTTATGGGCAGGCTCTAGG + Intronic
1148548840 17:48537474-48537496 GAGAGATCAGTGGAGGATCTGGG + Intergenic
1150900559 17:69271823-69271845 GAGAATTTTTTGTAGGCTCTGGG + Intronic
1151769215 17:76148899-76148921 GATAGTTCTATGAAGGCCCTGGG - Intronic
1151838586 17:76600872-76600894 AATAGTTCTGTGTTGGCACTGGG - Intergenic
1152175381 17:78783312-78783334 GAGTGTTCTGTGTAGGGTGCAGG - Intergenic
1156472923 18:37388733-37388755 GCATGTTCTGTGGAGGCTCTGGG - Intronic
1157403700 18:47406419-47406441 GAGGGTCCAGTGTAGCCTCTGGG + Intergenic
1157444457 18:47734347-47734369 GAGAGTTCTGTGAGGGTCCTGGG + Intergenic
1157498147 18:48170989-48171011 GACAGTTGAGTGTAGGCTATAGG - Intronic
1162058508 19:8080413-8080435 GAGCGCTCTGGGGAGGCTCTGGG + Intronic
1162590485 19:11588100-11588122 GGCAGTTCTGAGTAGGCACTGGG + Intronic
1162803264 19:13122714-13122736 GACAGTGCTGTGAAGGCTCTGGG + Intronic
1164565895 19:29325758-29325780 GTGAGATGTGTGTGGGCTCTCGG - Intergenic
1164813436 19:31176039-31176061 GAAAGTTCTGTGTGGGCTGAAGG + Intergenic
1167959999 19:53097835-53097857 GTGATTTCTGTGGAGGCTTTGGG - Intronic
926128664 2:10286777-10286799 GAGAGTGCTTTGCAGGCGCTCGG - Intergenic
926194050 2:10751108-10751130 CAGAGTTATGTGTGGGCTATAGG + Intronic
927908650 2:26880693-26880715 GAGAGTTCTGTGCTGGTTGTGGG - Intronic
932443881 2:71759703-71759725 GAGAGTTCTTTGCATACTCTAGG - Intergenic
933285314 2:80378904-80378926 GAGAGTTCTGTGTAGGCTCTGGG + Intronic
934880843 2:97977282-97977304 GAGAGTTCTTTATATGTTCTGGG - Intronic
936506971 2:113115777-113115799 GAGAGTTCTGACTAGACACTGGG + Intronic
940049942 2:149451502-149451524 TGGTATTCTGTGTAGGCTCTGGG + Intronic
941816354 2:169799384-169799406 GAGGGTTCTGTGGAGCCTATGGG + Exonic
942252990 2:174063584-174063606 CAGGGTTCTGTGTTAGCTCTTGG + Intergenic
943300760 2:186196020-186196042 CAGAGTTCTGTGTAGTATATAGG + Intergenic
944594925 2:201252536-201252558 AAGAGTTCTTTGTACGCTTTTGG + Intronic
945605195 2:211920595-211920617 GGGAGTTCTGTGTAGTATATTGG - Intronic
946111116 2:217418345-217418367 GAGAGTACTGTGGAGGAACTGGG - Intronic
946237369 2:218332461-218332483 GAGAGTCCTGTGGAAGCCCTTGG + Intronic
948096626 2:235340211-235340233 TAGACTTCTTTGTAGTCTCTTGG + Intergenic
948108302 2:235433282-235433304 CAGAGTGCTGTGAAGGTTCTTGG - Intergenic
948239104 2:236414101-236414123 GAGAGTTCTGTATATATTCTAGG + Intronic
948246287 2:236489103-236489125 GTGAGGCCTGTGTGGGCTCTGGG + Intronic
948246326 2:236489246-236489268 GTGAGGCCTGTGTGGGCTCTGGG + Intronic
948246366 2:236489390-236489412 GTGAGGCCTGTGTGGGCTCTGGG + Intronic
1169014404 20:2279944-2279966 TAAAGTTCTGTGTATGCTCCAGG - Intergenic
1169426172 20:5498931-5498953 GAGAGTTCTTCTTAGGCCCTGGG + Intergenic
1169543368 20:6625588-6625610 GAGAGTTCTATGTATATTCTGGG - Intergenic
1169805144 20:9551620-9551642 AAGAATTCTGTGTCTGCTCTAGG + Intronic
1171096315 20:22335536-22335558 GAGAGCTCTGTCTTAGCTCTTGG - Intergenic
1172194766 20:33084289-33084311 CAGAGTACTGTGTTGGCACTGGG + Intronic
1175048876 20:56134295-56134317 GTGATGTCTGTGCAGGCTCTTGG - Intergenic
1175689237 20:61053706-61053728 GTGAGATCTGTGCTGGCTCTTGG - Intergenic
1177876242 21:26634803-26634825 GAGGGTTATGAGTTGGCTCTTGG + Intergenic
1183657831 22:39200158-39200180 GAGAGTTCTTTATATGTTCTAGG - Intergenic
1184643327 22:45883478-45883500 GAGAGTGCAGTGTTGGCCCTGGG - Intergenic
950718142 3:14864123-14864145 TAGGGCTCTGTGTAGGCGCTGGG - Exonic
953990331 3:47478360-47478382 GAGAATCCTGTGGAGCCTCTGGG + Intergenic
954868118 3:53746931-53746953 TAGAGAACTCTGTAGGCTCTAGG - Intronic
968119633 3:196116258-196116280 GAGAGGTGTGTATAGGTTCTGGG - Intergenic
969250367 4:5964216-5964238 GAGAGCTCTGAGCAGCCTCTTGG + Intronic
970660215 4:18277045-18277067 TAAAGCTCTGTGTAGGCTTTTGG - Intergenic
971158063 4:24104317-24104339 GAGAGATCTGTGCAGGTCCTTGG + Intergenic
981293128 4:143099915-143099937 GGGAGTTCAGTCAAGGCTCTGGG - Intergenic
981910310 4:149972297-149972319 GAGATGTCTGTGAAGGTTCTTGG - Intergenic
984487748 4:180393397-180393419 GAGAGTTCAGGGTAGGATCTTGG + Intergenic
990925124 5:61012308-61012330 GAGAGTTCTGTAGAAGATCTTGG - Intronic
990927232 5:61040387-61040409 GAGGGTCCTCTGAAGGCTCTAGG - Intronic
995319386 5:110815278-110815300 GAGAGTTCTTTATATGGTCTAGG - Intergenic
997990025 5:138536898-138536920 CAGAGTGCTGTGTAGGTTATAGG - Intronic
998112878 5:139515687-139515709 GCGTGGTCTGTGTTGGCTCTAGG + Intergenic
1001422423 5:171597983-171598005 GAAAGCTCTGTGTAGCATCTAGG - Intergenic
1002921286 6:1575197-1575219 CAGAGTTCTGTTAAGGCCCTGGG + Intergenic
1005019520 6:21404324-21404346 GAGTGTTCTTTCTAGACTCTGGG + Intergenic
1006010233 6:31036808-31036830 GAATGTTCTGTGTATGATCTGGG + Intergenic
1007714978 6:43850634-43850656 ACGAGTACTGTGGAGGCTCTGGG + Intergenic
1008387514 6:50909685-50909707 GAGAGTTCTTTATATGTTCTGGG + Intergenic
1011651520 6:89510788-89510810 GTAAGTTCTGTGAAGGATCTTGG + Intronic
1012660277 6:101880444-101880466 AAGAGTTGTGTATAAGCTCTGGG + Intronic
1013370624 6:109467936-109467958 ACGATTTCTGTGTATGCTCTTGG - Intronic
1014086755 6:117355003-117355025 AAGAATCCTGTTTAGGCTCTTGG - Intronic
1021161337 7:17276574-17276596 CAGAGTTCTGTGGAAGCACTTGG + Intergenic
1022367661 7:29740738-29740760 GAGAGTTCTTTGTATATTCTGGG - Intergenic
1022928521 7:35083129-35083151 GAGAGTTCTTTGTATATTCTGGG + Intergenic
1023048635 7:36232705-36232727 GAGAGTTCTGTGGAGGCTGGGGG + Intronic
1024486506 7:49926050-49926072 GGCAGTTCTGTGTAGTCACTTGG + Intronic
1025087336 7:56034072-56034094 GAGCGTTCGGTGGAGGCCCTGGG - Exonic
1029548514 7:101223882-101223904 GAGAGGTCTGGGGAGGCTGTGGG - Intronic
1029824634 7:103176803-103176825 GAGAGTTCTTTGTATATTCTGGG + Intergenic
1030040987 7:105449669-105449691 TAGAGTTCTTTGTATGTTCTAGG - Intronic
1032189455 7:129755754-129755776 GAGAGTTCTGTGTGGCCACTGGG - Exonic
1038136595 8:24792570-24792592 GAGAGTTCTGGGAAGGCTGGCGG - Intergenic
1038934989 8:32239677-32239699 GAGAGTTCTTTATACTCTCTAGG - Intronic
1039572484 8:38598866-38598888 GAGAGTTGTGTGTTATCTCTAGG - Intergenic
1039750710 8:40475874-40475896 GAGAGTTCTGTTCAGCCCCTTGG + Intergenic
1039828563 8:41195073-41195095 GACATCTTTGTGTAGGCTCTTGG - Intergenic
1040565192 8:48558929-48558951 GAAAGTTCTTTATATGCTCTAGG + Intergenic
1041569028 8:59314893-59314915 GTGAGTACTGGGTAGGTTCTAGG - Intergenic
1044052255 8:87520547-87520569 GAGAGTTCTTTGCAGACTTTGGG + Intronic
1048133230 8:131720349-131720371 GAGAGTTATGTGTAGAATGTGGG - Intergenic
1048457451 8:134591031-134591053 GAGAGTTCTGTGGAGGCAGGTGG + Intronic
1049723587 8:144133912-144133934 GAGAGTTGTCTGTGGGCTCATGG + Intergenic
1050698164 9:8302735-8302757 GTGAGTTCTCTGTTGGCTCCTGG + Intergenic
1055330117 9:75174872-75174894 GAGAGTGCTGGGTAGGGGCTGGG + Intergenic
1057072452 9:92111502-92111524 GAGACTTCTATGTGGGCTTTAGG - Intronic
1059417915 9:114173415-114173437 GAGAGTTCTGGGTAACCTCAAGG - Intronic
1060552820 9:124493663-124493685 GAGAGCTCTGCGTAGGCCCGGGG - Intronic
1062030461 9:134359795-134359817 GAAGGTCCTGGGTAGGCTCTGGG + Intronic
1062609110 9:137365386-137365408 GAAAGGTCTGTGAAGGCTCCAGG - Intronic
1186887334 X:13927119-13927141 GAAAGTTTTGTGTAGGTTATTGG - Intronic
1187513860 X:19947597-19947619 GGGGGTTCTGTCTAGCCTCTAGG - Intronic
1187664522 X:21590494-21590516 GAGAGTTCTGTGTAGCGTGCTGG + Intronic
1188250806 X:27891941-27891963 GAGAGATCTGTGTAGCCTAATGG + Intergenic
1189019402 X:37318872-37318894 GACACTTCTCTGGAGGCTCTGGG + Intergenic
1189237674 X:39500525-39500547 GAGGCTTCTGTGGAGCCTCTGGG + Intergenic
1191781367 X:64871377-64871399 AAGAGTTCTGTGTAAGCTTTGGG + Intergenic
1198237557 X:134749492-134749514 GATATTTCTGTGTAGGCATTTGG - Intronic
1198339600 X:135701007-135701029 AAAAGTTCTGTGTTGTCTCTTGG - Intergenic
1198412756 X:136388314-136388336 GAAAGTTCTGTGGGGGCTGTGGG - Intronic
1198565041 X:137895675-137895697 GAGAGTTCTGCTTTGGGTCTTGG + Intergenic
1199609721 X:149602142-149602164 AAGAGTTCTCTGTATGTTCTGGG + Intronic
1199629395 X:149767210-149767232 AAGAGTTCTCTGTATGTTCTGGG - Intergenic