ID: 933285315

View in Genome Browser
Species Human (GRCh38)
Location 2:80378905-80378927
Sequence AGAGTTCTGTGTAGGCTCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 4, 3: 14, 4: 203}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933285308_933285315 17 Left 933285308 2:80378865-80378887 CCGACATCAGAAAGCACTGATCT 0: 1
1: 0
2: 2
3: 23
4: 195
Right 933285315 2:80378905-80378927 AGAGTTCTGTGTAGGCTCTGGGG 0: 1
1: 0
2: 4
3: 14
4: 203
933285307_933285315 18 Left 933285307 2:80378864-80378886 CCCGACATCAGAAAGCACTGATC 0: 1
1: 0
2: 1
3: 12
4: 180
Right 933285315 2:80378905-80378927 AGAGTTCTGTGTAGGCTCTGGGG 0: 1
1: 0
2: 4
3: 14
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933285315 Original CRISPR AGAGTTCTGTGTAGGCTCTG GGG Intronic
901214466 1:7548200-7548222 ACAGTTCTGGGTCTGCTCTGTGG + Intronic
904007888 1:27373382-27373404 AGGGTTCTGAGGAGGCTGTGGGG + Intronic
904328672 1:29744154-29744176 AGAGTCATGAGCAGGCTCTGGGG + Intergenic
905279382 1:36839210-36839232 GGGGCTCTGGGTAGGCTCTGAGG - Intronic
907333122 1:53684254-53684276 TGAGTTCTGGGGAGGCCCTGAGG - Intronic
907724968 1:57011244-57011266 AGAGCTCTGTCTAGGGGCTGGGG + Exonic
907944995 1:59127852-59127874 AGAGTGCTGTGTAGTGTCGGTGG + Intergenic
910457232 1:87411016-87411038 AGCATTCTGTTTGGGCTCTGGGG - Intergenic
911349994 1:96742073-96742095 TAAGTTCTGTGAAGGCTCTTTGG + Intronic
912955793 1:114153507-114153529 GGAGTTCTCTCTAGGTTCTGGGG + Intronic
914707432 1:150181882-150181904 AGAGTCACTTGTAGGCTCTGAGG - Intergenic
915250755 1:154586654-154586676 ACAGTGCTCTGAAGGCTCTGAGG + Intronic
915907411 1:159888823-159888845 AGAGTGCAGTGTGGGCTCAGAGG - Intronic
916201145 1:162272851-162272873 ACACGTCTCTGTAGGCTCTGGGG - Intronic
917923037 1:179766669-179766691 AAAGTTCTGTCTATGCTGTGGGG - Intronic
919071432 1:192760783-192760805 AGAGTTAAATGTAGGCTCTCTGG - Intergenic
921414836 1:214873699-214873721 AGATTTCTGTGTGTTCTCTGAGG + Intergenic
921680065 1:218020749-218020771 TGAATTCTGTGCAGGCTCTGAGG - Intergenic
924315125 1:242787482-242787504 AGAGTTGTGTGTGGGATGTGGGG - Intergenic
1063110712 10:3034516-3034538 AGAGTTCTGTGGGTGCACTGAGG - Intergenic
1063571161 10:7215641-7215663 AGGGTTCTGTGCTGCCTCTGCGG - Intronic
1065205962 10:23357960-23357982 TGAGCTTTGTGAAGGCTCTGAGG - Intergenic
1065361620 10:24894561-24894583 AGAGTTCTGTGAAGGCACCCGGG + Intronic
1065882037 10:30045206-30045228 AGAATTCTGTGTGGGCAGTGTGG - Intronic
1067233172 10:44426025-44426047 GGAGTTCAGTGTCAGCTCTGGGG + Intergenic
1067802083 10:49366041-49366063 AGAGTTTTCTGTAGGGGCTGAGG + Exonic
1067994488 10:51256181-51256203 AGAGGTCTGTGGGGGCTCTTGGG - Intronic
1070093344 10:73311415-73311437 AAAGTTCTGTGTGGGCTCTGAGG - Intronic
1070977734 10:80618895-80618917 AGAATTCTGGGTTGGCTTTGAGG + Intronic
1071244653 10:83749884-83749906 AGAATGCTGTGTAGGCTATAGGG - Intergenic
1071485370 10:86098348-86098370 AGATGACTGTGTAGGCTCTAAGG - Intronic
1071729807 10:88236320-88236342 AGAGTTCTGAGCTGGCTCTATGG + Intergenic
1074024573 10:109621122-109621144 AGACCTCTTTGTTGGCTCTGTGG + Intergenic
1078023819 11:7675618-7675640 TGATTTCTGTGTAGGATGTGAGG + Intronic
1078477051 11:11639904-11639926 AGACTTCTGAGTAGGCCCAGTGG - Intergenic
1079866165 11:25737253-25737275 AGAGTTCTGTGTACTATCTATGG - Intergenic
1081778668 11:45694746-45694768 AGAGGTCTGTGAGGGCCCTGTGG - Intergenic
1081868337 11:46371875-46371897 GGGGGTCTGTGTGGGCTCTGGGG + Intronic
1081966401 11:47172790-47172812 GGAGCTCTGTGGAGGCTCTGGGG - Intronic
1084032804 11:66491247-66491269 AGAGTCCAGGGAAGGCTCTGGGG - Exonic
1086573161 11:88307862-88307884 TCAGTTCTGTGTAGGCCGTGAGG - Intronic
1087162063 11:94958785-94958807 AGATGTATGTGGAGGCTCTGTGG + Intergenic
1089474144 11:118744656-118744678 AGACTTCCTTGTAGACTCTGTGG - Intergenic
1091941561 12:4488415-4488437 AGAGAACTGTATAGGCTCTAAGG + Exonic
1093213727 12:16337999-16338021 ACAGTCCTGGGGAGGCTCTGTGG + Intergenic
1095528659 12:43158392-43158414 AGATTTCTGTGTAGGTGCTCTGG - Intergenic
1097345213 12:58483822-58483844 AGAATTCTGTGAGGGCTCAGGGG - Intergenic
1099449204 12:82788635-82788657 AAAGTTCTGGGAAGGCTGTGAGG - Intronic
1099756411 12:86856509-86856531 AGAGTTCTGGCTGGGCTCAGTGG - Intergenic
1101605464 12:106245340-106245362 ATGGCTCTGTGTAGGCTTTGTGG - Intronic
1103270724 12:119671147-119671169 AAAGTTCTGTCTAGGGACTGGGG - Intronic
1104586465 12:130051959-130051981 AGAGTTTTGTGTGGGTTTTGGGG + Intergenic
1105413386 13:20190339-20190361 AGACTTTCGTGTAGGCTTTGTGG + Intronic
1105518442 13:21111014-21111036 ACAGTTCTGTGGAGGCTGGGAGG - Intergenic
1106472561 13:30070562-30070584 AGAGTTCTGTGCAGGATCTCTGG - Intergenic
1108015564 13:46071847-46071869 ATAATTCTGTGAAGGCCCTGAGG + Intronic
1108556361 13:51596993-51597015 AAAGTTCTCTTGAGGCTCTGGGG + Intronic
1108927094 13:55764360-55764382 AGACTTCTGTCTGGGCTCGGTGG - Intergenic
1110717237 13:78720240-78720262 ATAGTTCTGTGAAGGCTGGGTGG + Intergenic
1112946116 13:104929078-104929100 AGTATTCAGTGTAGGCACTGTGG + Intergenic
1113741797 13:112716434-112716456 AGTGGTCTGTGGTGGCTCTGGGG + Intronic
1115469931 14:33757964-33757986 AGTGCTCTGTGCAGGCACTGAGG - Intronic
1116041896 14:39696141-39696163 AGAATTCTGTTTAGGCACTTAGG - Intergenic
1117023651 14:51597829-51597851 AGAGTTCTGACTGGTCTCTGAGG + Intronic
1119010195 14:70977630-70977652 AGAGTGCTGTGCAGGCCCAGAGG + Exonic
1121113434 14:91327969-91327991 AGTGTTCTGGGTCTGCTCTGAGG + Intronic
1121588678 14:95082492-95082514 AGAGTTCAGGGGAGGCTCTGGGG - Intergenic
1122013133 14:98770114-98770136 AGAGGTCTGTGTGGACTCTTTGG - Intergenic
1125847740 15:42873519-42873541 AGAGTTCTCTGCCTGCTCTGTGG - Intronic
1126189065 15:45860717-45860739 TGTATTCTGTGTGGGCTCTGAGG + Intergenic
1128551228 15:68599208-68599230 AGAGATCAGAGAAGGCTCTGTGG - Intronic
1130997353 15:88911381-88911403 AGATTTGGGTGTAGGGTCTGGGG - Intronic
1132954445 16:2584051-2584073 TCAGTGCTGAGTAGGCTCTGAGG + Intronic
1132959900 16:2616112-2616134 TCAGTGCTGAGTAGGCTCTGAGG - Intergenic
1134025871 16:10953349-10953371 TGATTTCTGTGTAGGATATGAGG - Intronic
1134317236 16:13129926-13129948 CCAGTTGTGTGTAGCCTCTGTGG - Intronic
1137224753 16:46492490-46492512 AGAGTTCTGTAGAGTCTCTTAGG - Intergenic
1137982189 16:53079432-53079454 TGAGTTATGTTTAGGCACTGTGG + Intronic
1140292813 16:73678715-73678737 ACAGTTCTGTGTAATCACTGTGG - Intergenic
1140508006 16:75486520-75486542 ATAGTTCTGTGTGGGCTGGGGGG - Intronic
1140574747 16:76153876-76153898 AGGGTTCTGAGTAGACTCTCAGG + Intergenic
1143471388 17:7178064-7178086 AGGTTTCTGTGAAGGGTCTGAGG - Intronic
1144567709 17:16373662-16373684 AGACTTCTGTGGAGGCACAGAGG - Intergenic
1147214027 17:38888816-38888838 GGAGGTCTCTGCAGGCTCTGAGG + Intronic
1147335318 17:39723983-39724005 AGATTTCTTTGTTGGCTTTGGGG - Exonic
1148346646 17:46907974-46907996 AGAGTTCAGTCTCGGCACTGTGG + Intergenic
1151078421 17:71300880-71300902 AGACTTATGTTAAGGCTCTGTGG + Intergenic
1151152725 17:72101734-72101756 AGAGTTATGTGTCTGCTGTGGGG - Intergenic
1151402187 17:73863032-73863054 AGAGATCTGTCCAGGCTGTGTGG - Intergenic
1151769214 17:76148898-76148920 ATAGTTCTATGAAGGCCCTGGGG - Intronic
1151838585 17:76600871-76600893 ATAGTTCTGTGTTGGCACTGGGG - Intergenic
1152333189 17:79685267-79685289 GGGGCTCTGTGGAGGCTCTGGGG - Intergenic
1153138161 18:1941520-1941542 AGGTTTCTGTGTAGCCACTGAGG - Intergenic
1153687616 18:7562245-7562267 AAAGCTCTGTGTAAACTCTGAGG - Intergenic
1153979198 18:10294935-10294957 AGAGGCCTGCCTAGGCTCTGAGG - Intergenic
1156562228 18:38138482-38138504 AGAGTTCTGTATATGATCTGCGG + Intergenic
1157061359 18:44294471-44294493 ACAGTTCTGTATAGCCTTTGTGG - Intergenic
1157152325 18:45230503-45230525 AGATTTCTGTGAAGGAGCTGTGG + Intronic
1158136331 18:54212282-54212304 TGGGTTCTGTGAAGGCTTTGTGG - Intronic
1159390958 18:67791028-67791050 GGAGCACTGTGTAGGCTGTGTGG + Intergenic
1159859094 18:73625924-73625946 TGAGTTCAGTGTGGGATCTGTGG - Intergenic
1160941102 19:1620882-1620904 TGAGGTCTGTGAAGGCTTTGCGG - Intronic
1162803265 19:13122715-13122737 ACAGTGCTGTGAAGGCTCTGGGG + Intronic
1165345062 19:35240852-35240874 AGAGTTCTGTGTTGGGACTCTGG + Intergenic
1165927744 19:39337469-39337491 AGAGTCCAGTGTAGGGTCCGGGG - Intronic
925143767 2:1567769-1567791 AGAGTTCTGGAAAGGCTCCGGGG - Intergenic
925335272 2:3094493-3094515 AGAGTTCTGTGTTTGCCTTGTGG + Intergenic
927093764 2:19732039-19732061 TCAGTTCTGTGGAGACTCTGAGG + Intergenic
927151565 2:20199167-20199189 AGAGAACTGTGTGGGCTGTGGGG - Intergenic
929682394 2:44004683-44004705 AAAGTTCTCTGTAGGATCTGAGG - Intergenic
929771937 2:44899657-44899679 TGAATTCATTGTAGGCTCTGAGG - Intergenic
930307219 2:49689987-49690009 ATAGTTCTTTGTTGGCTATGAGG + Intergenic
933285315 2:80378905-80378927 AGAGTTCTGTGTAGGCTCTGGGG + Intronic
936227974 2:110675106-110675128 AGAGTTCTCTGGGAGCTCTGTGG - Intronic
936506972 2:113115778-113115800 AGAGTTCTGACTAGACACTGGGG + Intronic
938142637 2:128809217-128809239 AGAGTTCTGCTTTGGCTCTTTGG + Intergenic
939205326 2:139094757-139094779 AGAGTTTTTTGTAGGCTCCTTGG - Intergenic
940797498 2:158096099-158096121 AGAGTTTTCTGTTGACTCTGAGG + Intronic
941151002 2:161915635-161915657 GAAACTCTGTGTAGGCTCTGTGG - Intronic
942002948 2:171668370-171668392 TGCGTTCTGTGAAGCCTCTGCGG + Intergenic
944139919 2:196444820-196444842 AGATTTCAGTGGTGGCTCTGGGG + Intronic
944594926 2:201252537-201252559 AGAGTTCTTTGTACGCTTTTGGG + Intronic
946334124 2:219026191-219026213 AGAGTCCTGTGTCTGCCCTGTGG + Intronic
948012766 2:234663107-234663129 AGAATTCTGTGTCAACTCTGTGG + Intergenic
948892261 2:240913224-240913246 AGGGGTCTGTGCAGGGTCTGGGG - Intergenic
1168755295 20:312553-312575 AGTGTGCTGTGTAGGCAATGCGG + Intergenic
1169014403 20:2279943-2279965 AAAGTTCTGTGTATGCTCCAGGG - Intergenic
1169805145 20:9551621-9551643 AGAATTCTGTGTCTGCTCTAGGG + Intronic
1172194767 20:33084290-33084312 AGAGTACTGTGTTGGCACTGGGG + Intronic
1173271396 20:41539021-41539043 AGAGTTCAGTGGAGTCACTGCGG - Intronic
1174672720 20:52323038-52323060 ACAGTTTTTTTTAGGCTCTGAGG - Intergenic
1174945657 20:54982643-54982665 AGTGTTCTGTGTAGCCACAGTGG + Intergenic
1176167915 20:63683832-63683854 AGGGTTCTCTGTAAGTTCTGAGG + Intronic
1178461189 21:32803859-32803881 ACCGTTCTGTGCAGTCTCTGTGG + Intronic
1179804927 21:43831384-43831406 AGGGTCCTGTGGAGGATCTGGGG + Intergenic
1181541601 22:23575941-23575963 AGAGGTCTGGGTGGGGTCTGGGG - Intronic
1182908742 22:33962047-33962069 AGAGTTCTTGCTAGGGTCTGGGG - Intergenic
1183583764 22:38740387-38740409 AGAGCTCTGTGAAGGAGCTGAGG - Exonic
1183960126 22:41406448-41406470 AGTGCCCTGTGAAGGCTCTGGGG + Intergenic
1184616093 22:45639743-45639765 AAAGTCCTGTGGAGGCTCTGAGG - Intergenic
1185277368 22:49955621-49955643 CGATTTCTGTGGAGGCTGTGCGG - Intergenic
950141549 3:10619492-10619514 ATATTCCTGTGTGGGCTCTGTGG - Intronic
950332405 3:12166986-12167008 AGAGATCAGGGCAGGCTCTGTGG + Intronic
950399430 3:12759223-12759245 GGAGCTCTGTGTAGACTATGTGG + Exonic
951822940 3:26834196-26834218 TGAGTTCTGTGTATGCTGTTTGG + Intergenic
952898386 3:38094311-38094333 AGAGTCCTGTGTAATGTCTGGGG - Intronic
953245304 3:41185510-41185532 AGTTTTCAGTGTAGCCTCTGTGG - Intergenic
953283177 3:41578742-41578764 ATACTTATGTGTAGGGTCTGTGG - Intronic
953990332 3:47478361-47478383 AGAATCCTGTGGAGCCTCTGGGG + Intergenic
954040109 3:47879573-47879595 AAAAATCTGAGTAGGCTCTGTGG - Intronic
955625855 3:60918555-60918577 AGAGATTTGTGTAGGCTGAGAGG + Intronic
956489701 3:69757763-69757785 AGAATTATGTGTAGGATCTTCGG + Intronic
960405354 3:117252989-117253011 AGAGGTCTGGGTAGGATCAGTGG - Intergenic
961751294 3:129096285-129096307 AGACTTCTGTGTTGGGGCTGGGG - Intronic
962358600 3:134716228-134716250 AGAATTCCCTGTAGGCCCTGTGG + Intronic
963268511 3:143262770-143262792 AGAGTTCTTTGTATATTCTGAGG + Intergenic
963445410 3:145399638-145399660 ATAGTTCTGGTAAGGCTCTGAGG + Intergenic
964808161 3:160634339-160634361 AGAGTTCTGTGAAGGGTCTGAGG - Intergenic
965096475 3:164234312-164234334 AGAGAGCTGTGTATGCTGTGAGG - Intergenic
966419058 3:179719329-179719351 AGAGATCTGTGAAGACTGTGTGG - Intronic
967736517 3:192958420-192958442 AGAGTTCTGTGGAAGCACAGAGG + Intergenic
967913143 3:194558468-194558490 TGAGTTCTGTATAGGTCCTGGGG - Intergenic
968079040 3:195833993-195834015 TGATTTCAGTGCAGGCTCTGGGG + Intergenic
968119632 3:196116257-196116279 AGAGGTGTGTATAGGTTCTGGGG - Intergenic
973344939 4:49045081-49045103 AGGGTACTGTGTAGGCTATTAGG + Intronic
979039172 4:115764843-115764865 AGAATACTGTGGAGACTCTGGGG + Intergenic
981882146 4:149627119-149627141 AGAGTTCTGTGTGGAGGCTGGGG + Intergenic
983052106 4:163060735-163060757 AGAGTTGTGTCTAAGTTCTGAGG + Intergenic
984518381 4:180770260-180770282 AGAGTTCTGCTAAGGATCTGTGG - Intergenic
984663051 4:182394558-182394580 AGAGTTCTATGTAAGCTCTGAGG + Intronic
985137623 4:186802986-186803008 AGAGTTGTGTGTGTTCTCTGTGG + Intergenic
987297118 5:16563210-16563232 ACAGAAATGTGTAGGCTCTGAGG - Intronic
988584910 5:32499898-32499920 AGAGTTCAGTGAAAGATCTGTGG - Intergenic
989206441 5:38813814-38813836 AGAGTTCTTTGTATATTCTGGGG - Intergenic
990000695 5:50888271-50888293 AGAGTTCTTTTGAGGCACTGTGG - Intergenic
992614664 5:78536460-78536482 AGAGTTCTTACTGGGCTCTGTGG - Intronic
995013755 5:107287390-107287412 GGAGTTCAAAGTAGGCTCTGAGG + Intergenic
997977303 5:138448028-138448050 AGTGCTAGGTGTAGGCTCTGGGG + Intergenic
997979075 5:138457989-138458011 AGAGTTCTTGGTAGGAGCTGGGG + Intergenic
1000283092 5:159799242-159799264 TCAGTTCTGTGTAGTATCTGTGG + Intergenic
1000847057 5:166294773-166294795 AGAGTGTTGTGTAAACTCTGAGG + Intergenic
1000907231 5:166978096-166978118 TCAGCTCTGTGCAGGCTCTGTGG - Intergenic
1001274029 5:170337273-170337295 AGAGTGCTGAGTTGGCTCTGAGG - Intergenic
1001756154 5:174171839-174171861 ATAGTGCTGAGCAGGCTCTGAGG + Intronic
1001875388 5:175195704-175195726 AGAGTCCAGTGCAGTCTCTGGGG - Intergenic
1001934124 5:175692642-175692664 AAAGTTCAGGGCAGGCTCTGTGG + Intergenic
1003268651 6:4588602-4588624 AGAGTTCTTTGCGGGCTTTGTGG - Intergenic
1003371965 6:5537380-5537402 GCAGCTCTGTGTAGGGTCTGGGG - Intronic
1005019521 6:21404325-21404347 AGTGTTCTTTCTAGACTCTGGGG + Intergenic
1007120486 6:39376717-39376739 AGAGTTCTGTGTGAGCCCAGAGG + Intronic
1008211037 6:48726417-48726439 AGAGCTCTGTCTAGGCTCAGAGG + Intergenic
1008897030 6:56567750-56567772 AGAGTTCTGAGTATCCTCTGTGG - Intronic
1008970356 6:57360189-57360211 AGAGTACTGTGTAGGTGCTATGG + Intronic
1009159325 6:60262009-60262031 AGAGTACTGTGTAGGTGCTATGG + Intergenic
1010730127 6:79382250-79382272 AGAGTTGTGTGCAGGCTCATTGG + Intergenic
1012307853 6:97681524-97681546 AGAGTTCTGATTAGTTTCTGTGG - Intergenic
1013177254 6:107688452-107688474 TCAGTTCTTTGTGGGCTCTGAGG + Intergenic
1013628198 6:111958236-111958258 TGACTTCTATGAAGGCTCTGTGG - Intergenic
1023048636 7:36232706-36232728 AGAGTTCTGTGGAGGCTGGGGGG + Intronic
1030107066 7:105996286-105996308 GGAGCTCTGTGGAGGCTTTGAGG - Exonic
1035769928 8:2138902-2138924 GGAGTTCTGTGAAGGCACAGTGG - Intronic
1038027510 8:23605417-23605439 AGGGTTCTGTGTATCCTTTGAGG - Intergenic
1039622774 8:39014101-39014123 TGAGTTCTGTATAGGCACTCAGG + Intronic
1041081928 8:54222332-54222354 AGAGTTCAGTGTTAGCTGTGGGG + Intergenic
1041705256 8:60840147-60840169 AGAGTTTTGTGTATGGTGTGAGG + Intronic
1042054887 8:64754155-64754177 AGGCTTCTGTGTGGGCCCTGTGG + Intronic
1044225911 8:89717911-89717933 AGACTGCTGTATAGACTCTGAGG - Intergenic
1048432255 8:134381453-134381475 AGAGCTCTGTGGGGGCTCAGTGG + Intergenic
1049455401 8:142683885-142683907 AGAGTTCTGTGCGGGCTCCCAGG - Intergenic
1050772792 9:9224177-9224199 CCAGTTCTGTGTGGGATCTGAGG - Intronic
1052068776 9:24055998-24056020 ATAGGTCTGTGAGGGCTCTGTGG + Intergenic
1053728130 9:41025126-41025148 AGAGTCCTCTGGAAGCTCTGAGG + Intergenic
1055857864 9:80713306-80713328 AAAGCTCTGTCTAGGCTCAGAGG + Intergenic
1057535424 9:95899038-95899060 AGAGATATATATAGGCTCTGTGG - Intronic
1060552819 9:124493662-124493684 AGAGCTCTGCGTAGGCCCGGGGG - Intronic
1060795628 9:126510801-126510823 AGAGGTCTGGGAAGGCCCTGAGG + Intergenic
1061242427 9:129382416-129382438 AGAGCTCTGTGGGGCCTCTGGGG + Intergenic
1186646169 X:11509413-11509435 AGAATTCTGTGTAGAATTTGAGG - Intronic
1191781368 X:64871378-64871400 AGAGTTCTGTGTAAGCTTTGGGG + Intergenic
1196351983 X:114742453-114742475 AGAGTTCAGTCTTGCCTCTGTGG - Intronic
1197005432 X:121490761-121490783 AAAGTTCTGTGTATCCACTGTGG + Intergenic
1199561204 X:149164568-149164590 GGTGTTCTTTGTAGTCTCTGAGG - Intergenic