ID: 933286627

View in Genome Browser
Species Human (GRCh38)
Location 2:80391239-80391261
Sequence TGGTGTGAACAGAGTGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 419
Summary {0: 1, 1: 0, 2: 4, 3: 35, 4: 379}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933286627_933286635 21 Left 933286627 2:80391239-80391261 CCCTCTTCACTCTGTTCACACCA 0: 1
1: 0
2: 4
3: 35
4: 379
Right 933286635 2:80391283-80391305 CATTCTTCTCATCTGAAAAGTGG 0: 1
1: 1
2: 32
3: 507
4: 6892

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933286627 Original CRISPR TGGTGTGAACAGAGTGAAGA GGG (reversed) Intronic
903560946 1:24226810-24226832 TGGTGTGAATACTGTGAACATGG - Intergenic
903857027 1:26343662-26343684 TGGTGTGAAGAGAGTGGTGCTGG - Intronic
904013965 1:27406300-27406322 TGATGTGTAAAGAGGGAAGAGGG + Exonic
904469368 1:30726595-30726617 TGGTGGGCAAAGAGTGAAGGGGG - Intergenic
905827975 1:41041113-41041135 GGGTGTGAACTGAGTGACCAAGG + Intronic
905972150 1:42150405-42150427 TGGAGTAAACAGAGTGTTGATGG + Intergenic
906592762 1:47043090-47043112 TGGTGTGGATACAGTGAACAGGG - Intronic
907990739 1:59579913-59579935 TGGTGTGAACAGTGAGAAAGGGG - Intronic
908641271 1:66226432-66226454 TGGTGTGAAAAGTGTGCAGAAGG + Intronic
909809817 1:79918745-79918767 TGGTTTCAGCAGAGTGCAGAGGG + Intergenic
909982287 1:82116981-82117003 TGGTGTGTGTAGAGTGAAAAGGG + Intergenic
910856803 1:91704025-91704047 TGGTATGAAAAGGGAGAAGAGGG + Intronic
912169428 1:107080517-107080539 TGGTGTGCACAGAGGGTAGCAGG + Intergenic
912542720 1:110429237-110429259 TGGTGTGAACATAGTGTTGAGGG - Intergenic
912571533 1:110627861-110627883 TGATGGGGACAAAGTGAAGAGGG + Intronic
913106065 1:115615152-115615174 TGGAGTGAGCAGAGAGAGGATGG - Intergenic
913340539 1:117753733-117753755 TCGTGCCATCAGAGTGAAGAAGG + Intergenic
913999089 1:143677355-143677377 TGGGATGAACAGAGAAAAGAAGG + Intergenic
914014093 1:143802199-143802221 TGATGAGCATAGAGTGAAGAAGG - Intergenic
914163728 1:145158997-145159019 TGATGAGCATAGAGTGAAGAAGG + Intergenic
914194011 1:145435024-145435046 TGGGATGAACAGAGAAAAGAAGG + Intergenic
914475343 1:148017921-148017943 TGGGATGAACAGAGAAAAGAAGG + Intergenic
916677371 1:167075236-167075258 TGGGGTGAACAGATAGAAGTGGG + Intronic
916783966 1:168069463-168069485 TTATCTCAACAGAGTGAAGATGG - Intronic
916881405 1:169022767-169022789 TGGTGTGAGCAAAGCAAAGAGGG - Intergenic
917994734 1:180424469-180424491 TGGTTGGAACAGAGTGAAAAAGG + Intronic
919351245 1:196456666-196456688 TGGTATGAACAAAGTCAAAATGG - Intronic
920350023 1:205331737-205331759 TGGTGTGAAGAGACTTCAGAAGG - Intergenic
922478016 1:225920283-225920305 TGGTCTGAACAGATTTAAGGAGG + Exonic
923123020 1:231011819-231011841 TGGTGCAAACTGAGTGAGGATGG + Intergenic
923663008 1:235975057-235975079 TGAGTTGAACAGAGTGAAGGGGG - Intergenic
1063115212 10:3067778-3067800 TGGGGTGACCGGAGAGAAGAGGG + Intronic
1063556430 10:7084062-7084084 TGGTGGGAACAGAAGGAGGAGGG + Intergenic
1064240264 10:13621231-13621253 TGGAGGGAACACAGTGAGGAAGG - Intronic
1064347691 10:14547992-14548014 TGGTCTGAAGAGAGGGAAGTGGG - Intronic
1064785280 10:18888054-18888076 TTGTATGAACAAATTGAAGATGG - Intergenic
1064961501 10:20970167-20970189 TTGTGTGAGCAGAGCGAGGATGG + Intronic
1068065227 10:52121842-52121864 TGCTGTGAACAGAGTGTTAAGGG - Intronic
1068077481 10:52274814-52274836 TGGTGTGGATGGAGTGAACAGGG - Intronic
1069980343 10:72248071-72248093 GGGTCTGAAGAGAGTGAACAAGG - Intergenic
1071136756 10:82462546-82462568 TGGGGTGAAGAGATTGAAGCTGG + Intronic
1071489969 10:86129603-86129625 TGGGGTGAACATGGTAAAGAGGG - Intronic
1072164316 10:92798088-92798110 TGGTGTGAACGCAGTGATTAGGG + Intergenic
1073035239 10:100560273-100560295 TGATGTGAACAGAGAGAGGTAGG - Intergenic
1074153228 10:110777074-110777096 TGCCGTGAACAAAATGAAGAAGG - Intronic
1074733400 10:116401620-116401642 TGGTCTGGAGAGAATGAAGAAGG + Intergenic
1074888373 10:117713391-117713413 TGGTGTGGATATAGTGAAAAGGG - Intergenic
1076120941 10:127935938-127935960 AGGTGAGAGCAGAGGGAAGAAGG - Intronic
1076631510 10:131854899-131854921 TGGTGTGGACAGAGAGAGGCTGG - Intergenic
1077184855 11:1231423-1231445 GGGTGTGAACAGGGTGATGTTGG - Exonic
1077809964 11:5627065-5627087 AGATGAGAGCAGAGTGAAGAAGG + Intronic
1078470490 11:11582142-11582164 AGGGCTGAACAAAGTGAAGAGGG + Intronic
1079347185 11:19663085-19663107 TGATGAGAACAGAGTCAACATGG - Intronic
1079685976 11:23360462-23360484 CTGTGGGAACAGAGTGTAGAGGG - Intergenic
1079789332 11:24716482-24716504 AGGAGTGAAAAGAGTCAAGAAGG + Intronic
1080180735 11:29422905-29422927 TGGTGTAGACAGAGGGAATATGG - Intergenic
1081118030 11:39229364-39229386 TGGTGGTAAAAGAGTAAAGAGGG + Intergenic
1081210782 11:40331136-40331158 TGGTGAGAACAGGGAGAAAAGGG + Intronic
1081804644 11:45883870-45883892 TGGCCTGCACAGAGTGAAGAAGG + Intergenic
1082054379 11:47801072-47801094 TGGAGTGACCAGAGGAAAGAGGG + Intronic
1084890679 11:72235482-72235504 TGGTGTGAACAGATCAAGGAGGG + Intronic
1085174999 11:74478219-74478241 TGGTGTGACCAGAGACAAGCAGG - Intergenic
1085231501 11:74975153-74975175 TAATGTGAACAGAATGAAGTGGG - Intronic
1085415829 11:76318531-76318553 TGGTGGGAACCGAGAGGAGAGGG + Intergenic
1086119595 11:83292258-83292280 TGGGGTGAACAAAATGAAAAAGG + Intergenic
1086187461 11:84035722-84035744 TTGTGTGAAGAGACTGTAGAGGG + Intronic
1088382266 11:109206577-109206599 TGGTGAGAACAGAATGTAAATGG + Intergenic
1088634543 11:111807265-111807287 TGGTGTGGTCAGAGTGCAGTAGG - Intronic
1089054348 11:115573074-115573096 ACGTGTGAACAGAGGGAAAACGG + Intergenic
1089220980 11:116871377-116871399 TGGAGTGAACAGGGTGAGGCAGG + Intronic
1089261763 11:117228481-117228503 AGGTGGGAACAGAGTCAAGGAGG + Intronic
1089342968 11:117772123-117772145 GGGTGTCAACAGAGAGAGGAGGG + Intronic
1089563204 11:119356342-119356364 TGGAGTTAGCAGCGTGAAGAGGG + Exonic
1090058628 11:123444719-123444741 TGGTGTGTCCAGGGTGAACACGG - Intergenic
1090986898 11:131775551-131775573 TGGTGTCAACAGAGGGAAGAGGG - Intronic
1091719075 12:2799331-2799353 TGGTGTGGCCAGAGTTAAAAAGG - Intronic
1092041253 12:5386672-5386694 TGGAGAGAAAAGAGGGAAGATGG - Intergenic
1092975974 12:13745296-13745318 TGGTGGGAAGAGAGAGCAGATGG + Intronic
1093373053 12:18387621-18387643 TGGTGTGAGAAGAGTGGAGGGGG - Intronic
1094065709 12:26358850-26358872 TGGTGGGAACAGATTGGACATGG - Intronic
1095588210 12:43871797-43871819 TGCTGTGAACAAAGGGAAAAAGG - Intronic
1098834388 12:75403745-75403767 TGGTGTGAACAGAAGGATGAAGG - Intronic
1099876263 12:88409685-88409707 TGGATTGAAGAGAGTAAAGAAGG + Intergenic
1100193491 12:92218185-92218207 AAGTGAGAACAGAGTGGAGAAGG + Intergenic
1100370646 12:93966135-93966157 GGGTGTGATCAGAATGACGAAGG - Intergenic
1100527241 12:95431356-95431378 TTGTGGAGACAGAGTGAAGAGGG + Intergenic
1100748133 12:97667916-97667938 TGGTGAGCGCAGAGCGAAGAGGG + Intergenic
1101079029 12:101162959-101162981 TGCTATTAACAGGGTGAAGAGGG + Intronic
1102124518 12:110469171-110469193 TGTTGTGGACAGAGGGCAGAGGG + Intronic
1102527021 12:113519697-113519719 TGGGGTGAAAAGAGGGAAGGGGG - Intergenic
1102654648 12:114471646-114471668 AGCTGTGAACAGAGACAAGAGGG + Intergenic
1102900901 12:116635972-116635994 CAGTGTGAACAAAGTGAAGTTGG + Intergenic
1103070303 12:117935799-117935821 TTGTGTGACCAGAGTGGAGTGGG - Intronic
1103100795 12:118173432-118173454 TGGGGAGAACAGAATGAAGGAGG + Intronic
1104631634 12:130407819-130407841 TGATCTGAACAGAGAGAAGCAGG - Exonic
1104997075 12:132664758-132664780 AGGTGTGAAGAGAGTAGAGAAGG - Intronic
1105438851 13:20399599-20399621 TGGTGACAACAGAGTGTGGAGGG + Intergenic
1106064437 13:26331077-26331099 TGGTGTGGACACAGAGAAAAGGG - Intronic
1106353473 13:28956765-28956787 TGGCGGGGACAGAGGGAAGAAGG + Intronic
1106353487 13:28956825-28956847 TGGCGGGGACAGAGGGAAGAAGG + Intronic
1106370744 13:29130336-29130358 TGGCTTGAGCAGAGTGAGGAGGG - Intronic
1106579190 13:31003139-31003161 CGGGGTGAACTGAGTGAAGCAGG - Intergenic
1107392622 13:39982895-39982917 TGGTGACAGCAGAGTGGAGAAGG + Intergenic
1107420902 13:40245380-40245402 TGTTGAGAACAGGCTGAAGAGGG + Intergenic
1107562265 13:41568167-41568189 TGGTGTCATCAGGGTGATGAAGG + Exonic
1108966547 13:56312442-56312464 TGTTGTAAAAAGAGTGAAAAAGG - Intergenic
1109161467 13:58980477-58980499 TGGGGTGCACAGGGTGAAGGTGG - Intergenic
1109576783 13:64269867-64269889 TGGTGTGGACATAGTTAAAAGGG + Intergenic
1113717849 13:112526350-112526372 TGGTGTGATGATAGTGATGATGG - Intronic
1116739166 14:48733614-48733636 TGGAAGGAAGAGAGTGAAGAGGG + Intergenic
1118162759 14:63307294-63307316 TGGTGTGGATACAGTGAACAGGG + Intergenic
1118333528 14:64832754-64832776 TGGTGTGATGAGAGGGAAGAAGG - Intronic
1118710749 14:68517450-68517472 AGATGTCAACACAGTGAAGAAGG + Intronic
1118791172 14:69094347-69094369 TAGTGTGATCAGACTGCAGATGG - Intronic
1120414274 14:84199621-84199643 GGCTGTGAACATAGAGAAGAGGG - Intergenic
1120827496 14:88968986-88969008 TGGTGTGTTCAGAGTGCAGAGGG - Intergenic
1122530136 14:102419488-102419510 TGGTGGGGACAGAGTGCAGGCGG + Intronic
1122836870 14:104434840-104434862 TGGGGTGGACTGAGGGAAGATGG + Intergenic
1122945382 14:105006240-105006262 TGGGAAGAACAGGGTGAAGACGG + Intronic
1122976578 14:105173342-105173364 TGGAGGGAGCAGAGTGGAGAGGG - Intronic
1123039130 14:105483246-105483268 AGGTGTGGAAAGAGGGAAGAAGG - Intergenic
1123722441 15:23071469-23071491 TGGCCTGAATAAAGTGAAGATGG + Intergenic
1124918454 15:33999543-33999565 GGGTCTGAACAGTGAGAAGAAGG - Intronic
1125439201 15:39683431-39683453 AGGTGTTATCAGAATGAAGAAGG - Intronic
1125815163 15:42577644-42577666 AGGTGTGAACAGATTGTAGCAGG + Intronic
1126261366 15:46696639-46696661 TAGAGTGACCAGAGAGAAGAGGG - Intergenic
1127827287 15:62715861-62715883 AGGTGGGGACAGAGGGAAGAGGG - Intronic
1128065625 15:64762877-64762899 TGGTGTGAACAGAGAAGAGAAGG + Intronic
1128235850 15:66066614-66066636 TGGTGTGACCACAGTGCAGCAGG - Intronic
1129773888 15:78221273-78221295 TGGGGTGAACAGGGTGATGGTGG + Intronic
1130846221 15:87748711-87748733 AGATGAGAGCAGAGTGAAGACGG + Intergenic
1133755333 16:8758406-8758428 TGGTCTCAGCAGAGAGAAGAGGG + Intronic
1134365179 16:13570627-13570649 CAGTGTGAACAGTGTGAACAAGG + Intergenic
1134847872 16:17456097-17456119 CTGTGTGCACAGAGTGAAGCTGG - Intronic
1138643735 16:58407225-58407247 TGGTGAGAAGAGTCTGAAGATGG - Intergenic
1139038319 16:62974648-62974670 AGGTGTGAACAGGGTGAAATTGG + Intergenic
1140024567 16:71273790-71273812 TGGAATTAACAGATTGAAGATGG + Intergenic
1140057680 16:71539635-71539657 CAGTGTGAACAGAGTGAAGAGGG + Intronic
1141902636 16:87002684-87002706 TGGGGAGAACAGAGGGAGGAAGG - Intergenic
1141927193 16:87177603-87177625 TGGCGTGTGCAGAGTGAAGACGG + Intronic
1142541822 17:665591-665613 TGCTGTGAACAGAGTGCTAAGGG + Intronic
1142740198 17:1927403-1927425 TGGTGTGGAGTGAGTGAGGAAGG + Intergenic
1143617867 17:8064295-8064317 TGGTGTGGACACAGTGGGGAGGG + Intergenic
1143857001 17:9859484-9859506 GGGAGAGAACAGAGTAAAGAGGG + Intronic
1144325517 17:14175899-14175921 TGGTGAGAACATAATGAACAAGG + Intronic
1144474393 17:15572787-15572809 TGGTGAGAACATAATGAACAAGG + Exonic
1144833612 17:18145088-18145110 TGGTCAGAACAGAGTCAAGAGGG + Intronic
1147407141 17:40220117-40220139 TGGTGTGAAGTGAGGGAAGATGG + Intronic
1148828384 17:50411977-50411999 TGGAATGAACAGAGGGGAGAAGG - Intergenic
1150434726 17:65144966-65144988 ATGTGAGAACAGAGAGAAGACGG - Intronic
1150451320 17:65271232-65271254 TGGTGGGAAAAGAGGGGAGAGGG + Intergenic
1150524006 17:65902545-65902567 TTGTGTCAACAGATTGAAGAAGG - Intronic
1152660625 17:81540309-81540331 AGGTGTGAACAGTGTGACAAGGG + Exonic
1152807603 17:82363879-82363901 TGGTGGGAACAGAGGATAGAAGG + Intergenic
1153513006 18:5875926-5875948 AGGTGTGAACAGAAGGATGAAGG + Intergenic
1153852519 18:9109121-9109143 TGTTGTGAACAGTGAGAGGAAGG + Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155710428 18:28870412-28870434 TGCTGTGAACAAAGAAAAGAGGG - Intergenic
1156058371 18:33039886-33039908 TGGGATGAATAGAGTGAAAAAGG - Intronic
1156178735 18:34578100-34578122 TGGTGTGGATGCAGTGAAGAGGG - Intronic
1156275020 18:35576071-35576093 TTGTTACAACAGAGTGAAGATGG - Intergenic
1156771700 18:40735565-40735587 TGGGGTGAAGGGAGGGAAGAGGG - Intergenic
1156774184 18:40767070-40767092 TGGTTTGTGCAGAGTGAGGAAGG + Intergenic
1158775961 18:60580315-60580337 AGGTGGGAACAGGCTGAAGATGG - Intergenic
1159434781 18:68401905-68401927 TTGCTTGAGCAGAGTGAAGAAGG + Intergenic
1159934317 18:74350243-74350265 TGGAGAGAACAGAGAGAGGAGGG - Intronic
1160410311 18:78671225-78671247 TGCTGTGATCAGAGAGAAGACGG - Intergenic
1160821128 19:1058693-1058715 TAGTGTGAAGAGAAGGAAGAGGG - Exonic
1161258896 19:3324720-3324742 TAGTGGGAAGAGAGGGAAGAAGG - Intergenic
1161625400 19:5323636-5323658 TGGCTGGAACAGAGTGAGGACGG + Intronic
1161649384 19:5474925-5474947 AGGTGTCCACAGAGTGAAGGTGG + Intergenic
1163462303 19:17446486-17446508 TGGTGGGAGCTGAGTGAGGATGG - Intronic
1163775545 19:19215227-19215249 GGGTGTGAACGGAGTCCAGAAGG - Intronic
1164310256 19:24039749-24039771 TAATGTGATCAGAATGAAGAAGG + Intronic
1164859344 19:31550450-31550472 CAGAGTGAAGAGAGTGAAGATGG + Intergenic
1165460964 19:35944269-35944291 TGGTGGGACTAGAGTGAAAATGG + Intronic
1165993336 19:39828068-39828090 AGATGTGAACAGGGTGAAGTTGG - Intronic
1168241133 19:55089415-55089437 TGGGGTGATGGGAGTGAAGATGG - Intergenic
1168456251 19:56511018-56511040 TGGTGGGGATTGAGTGAAGAAGG + Intronic
1168503745 19:56915615-56915637 TGGAGTGAACAAAGGGGAGATGG + Intergenic
1168506144 19:56936840-56936862 TGGTGTGCACAGCAGGAAGAGGG - Intergenic
926275793 2:11402347-11402369 GGGTGGGAAAAGAGTCAAGAGGG + Intergenic
927807761 2:26162995-26163017 TAGTGTGCACAAAGTTAAGAGGG - Intergenic
927885807 2:26717817-26717839 AGGTTTGAACAGAATGGAGACGG - Intronic
928017882 2:27675629-27675651 GCGTCTGAACAGAATGAAGAAGG + Exonic
928096025 2:28405490-28405512 TGGGGATCACAGAGTGAAGATGG - Intronic
928238076 2:29562610-29562632 TGGAAAGAAGAGAGTGAAGAAGG + Intronic
928403522 2:30996558-30996580 TGGTGTGAATAGAGAGTAGAGGG - Intronic
930676742 2:54209752-54209774 TGGCAGGAATAGAGTGAAGATGG - Intronic
931769900 2:65488433-65488455 TGGTGTGAAAGGAAGGAAGATGG - Intergenic
932417513 2:71582577-71582599 TATAGTGAAGAGAGTGAAGATGG + Intronic
933286627 2:80391239-80391261 TGGTGTGAACAGAGTGAAGAGGG - Intronic
933425341 2:82104385-82104407 TGGTGGGCACAGAGAGGAGAGGG - Intergenic
934520575 2:95017842-95017864 TGATGTGATCAGAGGGAGGATGG + Intergenic
935156935 2:100491709-100491731 TGGTCTGACCAGAGGGCAGAGGG + Intergenic
935551356 2:104460720-104460742 TGCTGTAAACAGTGTGAAGTTGG + Intergenic
935734614 2:106096914-106096936 TGGTGTGAATAGGGTGCAGGCGG + Intronic
935865547 2:107383965-107383987 TGCTGTGCACAGAAAGAAGACGG - Intergenic
936239657 2:110776651-110776673 TGGTGTGAGCAGAGTGAGAGAGG + Intronic
936786117 2:116095583-116095605 TGGAGTGAATAGGGTAAAGATGG - Intergenic
937103060 2:119286466-119286488 TGGTGTGCCCAGAGAGAACAGGG + Intergenic
937209377 2:120258584-120258606 TGTGGAGAACAGATTGAAGAGGG + Intronic
939682623 2:145157538-145157560 TGCAGGGAACAGAGGGAAGAGGG - Intergenic
940279819 2:151977580-151977602 TTGTTTGGACAGAGAGAAGAAGG + Intronic
940845793 2:158640735-158640757 TGGTGACAACAAAGTGAAGATGG + Exonic
943328988 2:186536384-186536406 TGGTGGGAACAGACTCAAGAGGG + Intergenic
944156845 2:196616575-196616597 AGGTGTGAACACAGTGAGGCAGG - Intergenic
944663007 2:201936819-201936841 TTGTCAGAACAGAGGGAAGAGGG + Intergenic
944972230 2:205006442-205006464 TGGTGTGGATATAGTGAAAAGGG - Intronic
945008207 2:205432286-205432308 TGTTGAGAACAGAGTGAAGTGGG - Intronic
945184221 2:207123336-207123358 TGCTGGGAAAAGAGTGAATAGGG + Intronic
946334258 2:219027082-219027104 TGGGGTGGGCAGAGTCAAGAAGG + Intronic
946825146 2:223670300-223670322 AGGTGTGAACAGATTAAACAGGG - Intergenic
946963121 2:225006017-225006039 TAGAGTGGAAAGAGTGAAGATGG + Intronic
948059145 2:235030854-235030876 TGGTGTGGACTGAGTGCAGAGGG - Intronic
948318033 2:237045158-237045180 TGGTGTGAAGAGAGCCAAGGTGG - Intergenic
1169003665 20:2189032-2189054 TATTGTGAACAGAGTGTAGAGGG - Intergenic
1169705216 20:8495874-8495896 TACTTTGAATAGAGTGAAGAAGG - Intronic
1169765383 20:9142749-9142771 TGTTGAGAACAGACTGCAGATGG - Intronic
1170344152 20:15364753-15364775 TGGTGAGCACAGAGTGATTAAGG - Intronic
1170358258 20:15516593-15516615 TGGTTTGAACAGAAGGTAGAGGG + Intronic
1170490094 20:16863824-16863846 TGGTGGGAAGAGAGTGGACAGGG + Intergenic
1170740389 20:19050896-19050918 TGGTGTGATTAGAGAGAAGGGGG - Intergenic
1171421656 20:25021574-25021596 TGGTGTGAACATGGTGGAGTGGG - Intronic
1172103868 20:32503667-32503689 TGGTGAAAAGAGAGTGGAGACGG + Intronic
1172342695 20:34170974-34170996 TGGTGTGAACAGATGGACTAAGG - Intergenic
1172606405 20:36217093-36217115 TGATGTAAACAGAGTGATGGGGG + Intronic
1173089354 20:39955518-39955540 TGGGGAGAGCAGAGTGAACAAGG - Intergenic
1173242493 20:41309862-41309884 TGAAGTGAACTCAGTGAAGAAGG - Intronic
1173880659 20:46409464-46409486 TGGCCTGAATAAAGTGAAGATGG - Intronic
1174193416 20:48756273-48756295 AGGTGGGAACAGAGTGGAGAGGG - Intronic
1175309325 20:58000484-58000506 GGGTGTTAACACAGTGATGAAGG + Intergenic
1175705774 20:61175371-61175393 AGAGGTGAACAGAGTGAGGATGG - Intergenic
1177036770 21:16054386-16054408 TGGAGTGAAGTGTGTGAAGATGG + Intergenic
1177410400 21:20722315-20722337 TTGTGTGTACAGTGTGAAGTAGG + Intergenic
1181094525 22:20496236-20496258 AGGAGAGAAGAGAGTGAAGAAGG - Intronic
1182037582 22:27211259-27211281 TGGTGTGAGCAGAATCAAGGAGG + Intergenic
1182942003 22:34285856-34285878 AGGGGTAAAGAGAGTGAAGAAGG - Intergenic
1182948450 22:34347927-34347949 TGAAGTGAACAGGGTGGAGAGGG + Intergenic
1183574142 22:38676347-38676369 TGGTGAGAACAGACTGAAGGAGG + Intergenic
1183785513 22:40027056-40027078 AGCTGTGAACAGAATGAACATGG + Intronic
1184096712 22:42320016-42320038 TGGTGGGAATGGAGGGAAGATGG - Intronic
1185138874 22:49089300-49089322 TGGAGTGGACGGAGTGATGATGG - Intergenic
949800483 3:7898363-7898385 TGGTGTGCACAGAGACAAGAGGG - Intergenic
950464924 3:13148097-13148119 TGGTGTGGACATGGTGAAAAGGG - Intergenic
953355578 3:42253764-42253786 TGGAGTGAAGTGAGTGAAGAGGG + Intergenic
953685411 3:45074400-45074422 TGGTGTGAACCAAGTGAAAGTGG + Intergenic
955607571 3:60722251-60722273 TGCTGTAAGCAGAATGAAGAAGG - Intronic
955862978 3:63352141-63352163 TGGTGTGCACTGAGGGGAGAGGG + Intronic
955977245 3:64490494-64490516 TGGGGGGAAGAGAGAGAAGAAGG + Intergenic
956524431 3:70142039-70142061 TGGTGTGAATGCAGTGAATAGGG + Intergenic
957312373 3:78537521-78537543 TGGTGGGGACACAGTGAAAAGGG - Intergenic
959034578 3:101346268-101346290 TGGTGTGGATACAGTGAAAAGGG + Intronic
959634686 3:108552166-108552188 TGTTGTGAAAAGGGTGAATATGG - Intronic
960570664 3:119182252-119182274 TGCAGTGAACAGAGGGAAGGTGG + Intronic
961194557 3:124990688-124990710 AGGTGTGAACTGAGGGAAGTGGG + Intronic
961662241 3:128475543-128475565 GGGTGCAAACAGAGGGAAGAAGG + Intergenic
962462888 3:135630911-135630933 TGGTGGGCAGAGAGTGCAGAGGG + Intergenic
964277008 3:155019652-155019674 GGGTGTGAAGAGACTGAAGCAGG - Intergenic
964549259 3:157868831-157868853 TTATGTGAAAAGACTGAAGATGG + Intergenic
964565324 3:158044492-158044514 TGGTGTGGACATGGTGAAAAGGG + Intergenic
964675380 3:159272929-159272951 TGTGGTGAATATAGTGAAGAAGG - Intronic
965376982 3:167937025-167937047 TGTTGGGAGCAGAGTGAATAAGG + Intergenic
966135692 3:176695714-176695736 TAGTGTGGACAGAGACAAGACGG + Intergenic
966496183 3:180583975-180583997 TGATGTGTACAGGGAGAAGATGG + Intergenic
967482747 3:189992640-189992662 TGATGTGATTAGAGTGAAGCTGG - Intronic
968975767 4:3821391-3821413 TGGCTTGAACAGTGTGAGGATGG + Intergenic
970165686 4:13235369-13235391 TGGTGGGAACATGGTGAAAAGGG + Intergenic
970331997 4:14996048-14996070 TGTTGGGAACAGACTGGAGAGGG + Intergenic
971816325 4:31495536-31495558 TGGTTTTAAGAGAGAGAAGAAGG - Intergenic
972662569 4:41130457-41130479 TGTTGAGAATAGAGTGTAGAGGG - Intronic
974356414 4:60818484-60818506 TGTTAAGAACAGAATGAAGAGGG - Intergenic
975395978 4:73873673-73873695 AGGTGTAAACATAATGAAGAGGG - Intergenic
975738587 4:77406047-77406069 TGGTATGGACAGTGAGAAGAGGG + Intronic
978787531 4:112626458-112626480 TGGTTGGAACAGAGTGAGCAAGG - Intronic
982433916 4:155358930-155358952 TGGTGAGAACACAGAGAAAAGGG + Intronic
983481329 4:168277957-168277979 TGGTGTCTACAGTGTGAACATGG - Intronic
984604268 4:181766525-181766547 TGGGGTGAGCAGAGTGGAGGTGG + Intergenic
985480726 5:108680-108702 TGGTGTAGACTGAGTGCAGATGG + Intergenic
986567332 5:9127928-9127950 TGGTGACAACCGAATGAAGACGG + Intronic
986979111 5:13426443-13426465 AAGTGTCAACAGAGTGAAAAGGG - Intergenic
987192564 5:15493258-15493280 TGGTCAGAACAGAAGGAAGAGGG - Intergenic
987397216 5:17435978-17436000 TGGTTGGGACAGAGTGAAAAAGG + Intergenic
987451956 5:18096263-18096285 AGGTGTGAACTTAGTGAGGATGG - Intergenic
989239021 5:39182230-39182252 CAGTGTGAACAGAGTGCAGGTGG + Intronic
990282309 5:54264326-54264348 TGGTTTGAACAGTGTGATAAGGG - Intronic
990773105 5:59273032-59273054 TTATGTAATCAGAGTGAAGATGG + Intronic
991540419 5:67721419-67721441 TAGTTTGAACACAGTGGAGATGG - Intergenic
993174442 5:84465656-84465678 TGGTGTGAAGAGAGAGAGAAAGG + Intergenic
993743714 5:91570031-91570053 TGGTGTGGATAGGGTGAAAAGGG + Intergenic
994236513 5:97369295-97369317 TGGGGTGAACAGCCTGAAGCAGG + Intergenic
994837724 5:104877238-104877260 TGTTGCAAACATAGTGAAGATGG - Intergenic
995000369 5:107120616-107120638 TGGTGCAAACACAATGAAGACGG - Intergenic
995545761 5:113228726-113228748 TGGTGAGAACAGACTGTAGAGGG + Intronic
995653651 5:114400440-114400462 TGGGGAAAACAGGGTGAAGAGGG - Intronic
996337521 5:122400962-122400984 TTGGGTGAGAAGAGTGAAGAGGG - Intronic
997574457 5:134963314-134963336 TGGTGTGCAGGGAGAGAAGAGGG + Intronic
999616820 5:153433595-153433617 TGGTGGGAATAGACTGTAGAGGG - Intergenic
1000511178 5:162185141-162185163 TGGTGTAGACACAGTGAATAGGG - Intergenic
1000513855 5:162216285-162216307 TAGTGTAAAGAGGGTGAAGAGGG - Intergenic
1000523537 5:162327736-162327758 TGGTGTGATCACAGAGAGGAAGG + Intergenic
1000923452 5:167165490-167165512 TGGGGTGACCAGAAAGAAGAGGG + Intergenic
1001193108 5:169648630-169648652 TGGGGTGAACACAGCAAAGAAGG - Intronic
1001848740 5:174944145-174944167 AGGTGAGAACAGAAAGAAGAGGG + Intergenic
1002209235 5:177586344-177586366 TGGTGTGGATGGAGTGAACAGGG - Intergenic
1003223908 6:4187889-4187911 TGGTGTCATGAGAGAGAAGAAGG + Intergenic
1003754856 6:9105628-9105650 TGGTGTGGAAGGACTGAAGAGGG - Intergenic
1004360655 6:14967896-14967918 TGGGGTAAACAGAGTGCAGGAGG + Intergenic
1005421375 6:25654878-25654900 TGGTCTGACCAGAGGAAAGAAGG - Intronic
1006385690 6:33729554-33729576 GGGTATGAACATGGTGAAGAGGG - Intronic
1006811262 6:36821931-36821953 TTGCATGAACAGACTGAAGATGG - Intronic
1006816611 6:36855351-36855373 GGGCGTGCACAGAGTTAAGAGGG + Exonic
1011075074 6:83430711-83430733 TGGTGTGGGCAGAAGGAAGAAGG - Intronic
1011302140 6:85887600-85887622 AGGGGTGAAGAGAATGAAGAAGG - Intergenic
1011634798 6:89361582-89361604 TGGTACGAACAGATTGAAAAGGG + Intergenic
1011865907 6:91826618-91826640 TAGAGGGAACAGAGAGAAGATGG - Intergenic
1012601454 6:101102590-101102612 GGGTGGGAACAGAGTGAAGCTGG - Intergenic
1014289921 6:119546282-119546304 TGGTGCAAACAGTCTGAAGAAGG - Intergenic
1014310900 6:119800081-119800103 TGCTTTGAACAGAGCAAAGAAGG - Intergenic
1014901489 6:126970751-126970773 TGGTCTAAACAGGGTGAAGAGGG + Intergenic
1015391772 6:132690414-132690436 TGGTGTGAAGAGCATGAACAAGG - Intronic
1015868667 6:137753784-137753806 AGGGGTGAACAGGGTGGAGAGGG + Intergenic
1016357204 6:143231485-143231507 TCTCGTGAACAGAGTGAAAAAGG + Intronic
1017894560 6:158668114-158668136 CAGTAAGAACAGAGTGAAGATGG + Intronic
1017973675 6:159335772-159335794 GGGTCCAAACAGAGTGAAGAAGG + Intergenic
1018007085 6:159632291-159632313 TGATGTGATCAGAGGGAGGACGG - Intergenic
1019049068 6:169169545-169169567 TGGTGAGCAGAGACTGAAGATGG - Intergenic
1019069527 6:169332109-169332131 TGCCGTGAAAAGAGGGAAGAGGG - Intergenic
1020913189 7:14159215-14159237 TGGTGTGTACAGGGTTCAGAAGG - Intronic
1021013273 7:15498506-15498528 TTGTGTGCACAGAATAAAGAAGG + Intronic
1021439414 7:20661062-20661084 TGTTGAGAACAGATTGAAGTGGG - Intronic
1021527837 7:21608693-21608715 TGGTCTGAACAGATTGTGGATGG + Intronic
1021660308 7:22913400-22913422 GGGTGTGCACACAGTGAAGTCGG - Intergenic
1022519381 7:30996181-30996203 TGGTGTGAAGAGAGTGACCCGGG - Intergenic
1022736225 7:33078682-33078704 TGGTGTGTGCAGAGTGCACATGG - Intergenic
1022836980 7:34127492-34127514 TGGTGGGATCAGGGAGAAGAGGG - Intronic
1023569966 7:41561624-41561646 TGGTGGGAAGAGAGAGAGGAAGG + Intergenic
1023878732 7:44306902-44306924 CGGTGTGAGCAGGGGGAAGAGGG + Intronic
1023878798 7:44307139-44307161 GGGTGTGAGCAGAGGGAGGAGGG + Intronic
1023878803 7:44307159-44307181 GGGTGTGAGCAGAGGGAGGAGGG + Intronic
1023878806 7:44307179-44307201 GGGTGTGAGCAGAGAGAGGAGGG + Intronic
1023878820 7:44307236-44307258 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1023878830 7:44307276-44307298 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1023878856 7:44307376-44307398 GGGTGTGAGCAGGGAGAAGAGGG + Intronic
1027814092 7:82946657-82946679 TGGTCGGAGCAGAGTGAGGAGGG + Intronic
1029129221 7:98317584-98317606 CGGTGTGAACTGAGGGATGAGGG - Intronic
1031427862 7:121629582-121629604 TGTTGAGAATAGAGTGTAGAGGG + Intergenic
1032146227 7:129383518-129383540 TGTTGAGAATAGACTGAAGATGG - Intronic
1032155173 7:129462130-129462152 TGGTTTGAGGAGAGAGAAGATGG + Intronic
1032728137 7:134611288-134611310 TGGATTTAACAGAGGGAAGAAGG - Intergenic
1033483804 7:141768004-141768026 TGGGCTGAAAAGAGTGGAGATGG - Intronic
1033966934 7:146986637-146986659 TGGCGTGGATGGAGTGAAGAGGG - Intronic
1034009609 7:147514904-147514926 TGCTGTGATGAGAGTGAATAGGG - Intronic
1034499581 7:151440831-151440853 TGGAGTGAGCAGAGCGAACATGG + Intergenic
1034818068 7:154191504-154191526 TGGTCTGCACAGAGGGAAAAGGG - Intronic
1034870948 7:154683481-154683503 TGGTGGGAACAGAAAGAAGAAGG - Intronic
1035908859 8:3543395-3543417 TGTTGAGAACAGAATGAACAGGG + Intronic
1036481893 8:9147385-9147407 GGGTGTGAACTGAGGGAGGAAGG + Intronic
1036832304 8:12030436-12030458 TGGTTAGAACAGAGGGAAGTAGG - Intergenic
1037482815 8:19320695-19320717 TAGTGAGAACGGAGTGAGGAGGG - Intronic
1037743493 8:21625644-21625666 TGGTGTGAAGAGGGGGAGGACGG + Intergenic
1037926847 8:22850359-22850381 TGGTGGGAAGGGACTGAAGAGGG + Intronic
1038213476 8:25540866-25540888 ATCTGTGAAAAGAGTGAAGAGGG - Intergenic
1038546213 8:28427513-28427535 TGCTGTGGGCAGAGTTAAGAGGG - Intronic
1039251971 8:35676049-35676071 TGATGTAAACAGATTGGAGAGGG - Intronic
1039254968 8:35709106-35709128 GGGTTTGAGCAGAGTGGAGATGG - Intronic
1039364436 8:36915632-36915654 CAGTGTGAACAGGGTGAAGGAGG - Intronic
1039858375 8:41435663-41435685 TGGTGTGAAAAGAGAGAAAAAGG - Intergenic
1040047643 8:42979696-42979718 TGGTGAGAACAAAGTGAAAATGG - Intronic
1040074965 8:43220061-43220083 TGGTGTGAAGACAGAGGAGAGGG + Intergenic
1040949164 8:52918781-52918803 TGGTGTGAAGTCAGTGAAGAGGG + Intergenic
1043000012 8:74746692-74746714 TGGAGAGAAGAGAGAGAAGATGG + Intronic
1043344401 8:79283184-79283206 TGGTGTGAACAAAGGTAAGGAGG + Intergenic
1043423312 8:80122811-80122833 TGGAGTACACAGAGGGAAGAAGG + Intronic
1043549338 8:81351789-81351811 TGGAGTTAACAGCATGAAGATGG - Intergenic
1044130534 8:88518143-88518165 TGGTTAGAACAGAGTGAGCAAGG - Intergenic
1045475591 8:102549757-102549779 TTTAGTGAACAGAGTGAGGATGG - Intergenic
1045831622 8:106468537-106468559 TGGTGGAAAGAGAGTGAACAAGG + Intronic
1048436511 8:134423465-134423487 AGGTTTGAACAGAGGTAAGAGGG - Intergenic
1048779351 8:137984679-137984701 TGGTGTGGGCAGAGAGAAAAGGG - Intergenic
1048861410 8:138726938-138726960 TGGGGTGACCAGAGGGAGGAAGG + Intronic
1049137470 8:140916367-140916389 TGGCTGGAACAGAGTGAATACGG - Intronic
1049710867 8:144062768-144062790 TGGAGTGAACAGAGAGGCGAGGG - Intronic
1049719903 8:144111002-144111024 TGGTGAGGACAGAGTGAGCAAGG + Intronic
1050362285 9:4841639-4841661 TTGTTGGAACAGAGTGCAGATGG - Intronic
1054742755 9:68825352-68825374 TGGTGGAAACCGAGTGAACAGGG - Intronic
1054942850 9:70762858-70762880 TGGTGTAAACAGAGGCAACATGG - Intronic
1055136522 9:72835274-72835296 TGGGATGAACAGAGTGAAGATGG - Intronic
1057369441 9:94456935-94456957 GGGTGGGAAAAGAGGGAAGAAGG - Intronic
1057760690 9:97871788-97871810 TGGCGTGGATAGAGTGAAAAGGG + Intergenic
1057894092 9:98892891-98892913 TGGGCTGAACAGAGACAAGACGG + Intergenic
1058315881 9:103565125-103565147 TGGTTTGAACAGGGTGAGGGAGG + Intergenic
1058712158 9:107689176-107689198 TGATGTGAAAAGACTGAAAAGGG - Intergenic
1061007464 9:127936306-127936328 AGGTGTGAGCAGAGTGATGATGG + Intronic
1062277974 9:135739574-135739596 CGGTGTGAACACCATGAAGAGGG - Intronic
1185951988 X:4447762-4447784 TTAGGTGAACAGAGTGAACAGGG + Intergenic
1186932125 X:14405369-14405391 AGGAGGGAAGAGAGTGAAGAGGG + Intergenic
1187921841 X:24211079-24211101 TTGTGTGAACTGAGAGAATATGG - Exonic
1187927550 X:24263770-24263792 TGGTGAGAACAGAGTGCAGGTGG - Intergenic
1188050024 X:25473403-25473425 AGGTGTGAAGAGAGTCTAGATGG - Intergenic
1188335446 X:28926746-28926768 AGGTTTGAAGAGAGAGAAGAAGG - Intronic
1189163296 X:38833370-38833392 TTCTGGGAACAAAGTGAAGAGGG - Intergenic
1189942094 X:46135144-46135166 TGAGGTGAAAAGAGTGAAAAGGG + Intergenic
1190216093 X:48480402-48480424 TGGTTGGAACAGAGTGAGGGGGG + Intronic
1191964713 X:66745073-66745095 TGGTGTGGATAGAGTGAACAGGG - Intergenic
1192340850 X:70262230-70262252 TGGTCTGAATATAGTGGAGAAGG + Intergenic
1192433514 X:71128124-71128146 TGGGGTGTACTGAGTGAGGAAGG + Intronic
1193307546 X:79967103-79967125 TGGTGTGGATGGAGTGAAAAGGG - Intergenic
1194243126 X:91476215-91476237 TGATGTGATCAGAGTAAGGAAGG + Intergenic
1195651048 X:107285276-107285298 TGGTGGGAAGAAAGTGAGGATGG + Intergenic
1195688159 X:107603618-107603640 TGCTGTGAGCAGAGTGAAGAGGG - Exonic
1196710936 X:118761913-118761935 TGGTGTGAACAAAATGTAGCAGG + Intronic
1196858122 X:120002212-120002234 TGGTGTGATCATAGTGAGGCAGG - Intergenic
1198462216 X:136874648-136874670 TTGTTTGAAAAGACTGAAGACGG + Intronic
1199392736 X:147299835-147299857 TGGTTAGAACAGGGTGAACAAGG - Intergenic
1199899020 X:152154777-152154799 TGGTTTGAAGAGAGTAGAGAAGG - Intergenic
1200421966 Y:2979696-2979718 TTGTGTGAACTGAGAGAATATGG - Exonic
1201391999 Y:13508742-13508764 TGGTATGAATATAGTGAAAAAGG + Intergenic
1202027743 Y:20542323-20542345 TAGGCTGAACAGAGTCAAGATGG - Intergenic