ID: 933292337

View in Genome Browser
Species Human (GRCh38)
Location 2:80451923-80451945
Sequence TAAGATAAGCATAAAGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 434
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 406}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933292337 Original CRISPR TAAGATAAGCATAAAGAGGA GGG Intronic
902531343 1:17092650-17092672 ATAGAAAAGCATAAAGAGGCTGG + Intronic
902961590 1:19967340-19967362 TAAGGCAAGCATACAGAGGCAGG - Intergenic
903463553 1:23536067-23536089 TAGGAAAAGCACAAAGAAGATGG - Intergenic
904301339 1:29556710-29556732 TCAGGGAAGCATAAAGAGTAGGG + Intergenic
904406783 1:30296182-30296204 GAAGAAAAGGATAAAGAGAAGGG - Intergenic
904844323 1:33397461-33397483 TAAGATTATAATTAAGAGGATGG - Intronic
906049360 1:42857742-42857764 GAAGGTAAGTTTAAAGAGGAAGG - Intergenic
907535209 1:55146814-55146836 TTATATAAGCATAAATAGTATGG - Intronic
908492547 1:64660820-64660842 TAAGAAAAGCAAAAAGTGGCTGG - Intronic
908971919 1:69845939-69845961 AAAGATAATCCTGAAGAGGATGG - Intronic
909078791 1:71084769-71084791 TATAATAAGAATAAAGAGAATGG - Intergenic
909782453 1:79563413-79563435 TATCTTAAGCAAAAAGAGGAAGG + Intergenic
909903445 1:81167149-81167171 TAAGGTAAACATAATTAGGAGGG - Intergenic
911018370 1:93359534-93359556 TTAGCTATGCATAAAGGGGAGGG + Intronic
912372381 1:109184073-109184095 TAAAATAATAATAAAGAGGCCGG + Intronic
913012097 1:114693903-114693925 TAAAAAAACCATAAAGAGGCCGG + Intronic
913380005 1:118200124-118200146 TACGAAAAGCATGAGGAGGAAGG + Intergenic
915086314 1:153391242-153391264 TAGGAGAAGCGGAAAGAGGAAGG + Intergenic
915236015 1:154483178-154483200 TGAGATAAGCATAAATAGGAAGG - Exonic
915293666 1:154904204-154904226 TAAAATAATAATAAAGAGTATGG + Intergenic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
916163278 1:161940909-161940931 TACAACAAGAATAAAGAGGAAGG - Intronic
916401467 1:164453510-164453532 AAAGAAAACCATAAAGAAGAAGG + Intergenic
916431094 1:164729368-164729390 AAAGATAAGGAAAAAAAGGAAGG - Intronic
917478637 1:175391019-175391041 TAAGATCAGCATAAATACAATGG + Intronic
917758732 1:178132066-178132088 TAAGAGAAGGAAAAAGAGAAGGG - Intronic
917807840 1:178629862-178629884 TAAGATAAGTAAAAAGAGATAGG - Intergenic
917991354 1:180382662-180382684 TAAAAAAAACTTAAAGAGGAAGG + Intronic
918534649 1:185560765-185560787 TCAGACAAGAATAAAGAGGAAGG + Intergenic
918625944 1:186656128-186656150 TCACATAAGCATAAAGAGGAGGG - Intergenic
919357260 1:196538986-196539008 TAACATAACAAAAAAGAGGAGGG - Intronic
919700440 1:200626181-200626203 TAAGAAAAGTAGAAAGAGAAGGG + Intronic
921161434 1:212475020-212475042 TGTGATCAGCACAAAGAGGAAGG + Intergenic
921809966 1:219501616-219501638 TAAAATATGCCTAAAGAGGCAGG - Intergenic
922368288 1:224886297-224886319 GAAGGTAAGTTTAAAGAGGAAGG - Intergenic
922806035 1:228390120-228390142 AAAGAAAACAATAAAGAGGAAGG + Intergenic
922894342 1:229088771-229088793 CAAGGTAAGGAGAAAGAGGAGGG + Intergenic
922897804 1:229114016-229114038 TAAGATATGGCTAGAGAGGAAGG - Intergenic
923695997 1:236252827-236252849 TAAGAAAAGCAGAAAGTGAAAGG + Intronic
923850164 1:237785632-237785654 TTAGATAAGAATGAAGAGGTAGG + Intronic
924163693 1:241260518-241260540 GAAGATAAGGAAAAAGAGTAAGG + Intronic
924227314 1:241932745-241932767 TAAGAAAAGTAGAAATAGGAGGG + Intergenic
1063435999 10:6031288-6031310 AAAGATAAGCATAAGGAAGCTGG + Intronic
1064265619 10:13822980-13823002 GAATAAAAGCATAAAGGGGAAGG - Intronic
1064274700 10:13894789-13894811 TAAGAAAAAAATAAACAGGATGG - Intronic
1065260105 10:23915062-23915084 TAAGAAAAGAAAAAAGAAGAGGG + Intronic
1067907584 10:50309755-50309777 TAAGATAAGGAAATACAGGAAGG - Intronic
1068196614 10:53725764-53725786 TAAGATAATCATCAAGTTGATGG + Intergenic
1068228982 10:54145122-54145144 TAAAATATGAATAAAGAAGAGGG + Intronic
1068379080 10:56225128-56225150 TAAGATAAGCTATAAGAGGGAGG + Intergenic
1068659814 10:59612321-59612343 TAAACTAAGCATATGGAGGATGG + Intergenic
1068926191 10:62541721-62541743 CAAGATAAGGAACAAGAGGAAGG + Intronic
1069361914 10:67652835-67652857 TAAGAAAAACAAAAACAGGAAGG - Intronic
1070245372 10:74726243-74726265 CAATAAAAGCATAAAGAGGGAGG + Intergenic
1070514056 10:77187337-77187359 GAACATAAGCATTATGAGGAGGG - Intronic
1073370193 10:102981376-102981398 TAATATAGGAAAAAAGAGGAAGG - Intronic
1073388638 10:103151570-103151592 TAAGATAGGCATATAGATTATGG - Intronic
1075556547 10:123436421-123436443 AAAGACAAGTAGAAAGAGGAGGG - Intergenic
1076100565 10:127774384-127774406 CAAAATAAGCAGGAAGAGGAAGG - Intergenic
1076170233 10:128313115-128313137 TAAGAAAAACATAAAAAGGTTGG + Intergenic
1077786081 11:5384752-5384774 TAAAATAAGCAGATTGAGGATGG - Intronic
1079598462 11:22283623-22283645 GAAGATAAGCATGAACAGAAAGG + Intergenic
1080678872 11:34454514-34454536 TAAGATAAGCAGAAAGAAGTGGG + Intronic
1081078792 11:38712686-38712708 TATAATAAGCATACAGAAGAGGG + Intergenic
1081180344 11:39977881-39977903 TAAGATAGGTATAAAGAGCATGG - Intergenic
1081459987 11:43263625-43263647 TAAGATCAAAATATAGAGGAGGG + Intergenic
1081868107 11:46370745-46370767 TAAGATAAGCCTGAAGAGCAGGG - Intronic
1083077506 11:60056294-60056316 TAAGAGAAGCATCTGGAGGAGGG - Intergenic
1086987516 11:93266534-93266556 TTAGAACAGCAGAAAGAGGATGG + Intergenic
1087193251 11:95278774-95278796 TGAGAGAAGCAGAATGAGGAGGG + Intergenic
1087928579 11:103949297-103949319 TAAGATTAGAATAACGAGGCCGG - Intronic
1088536317 11:110866012-110866034 TAAAATAAAAATAAAAAGGATGG - Intergenic
1088967536 11:114738786-114738808 TAATATAAGCATAAGGTGGGGGG - Intergenic
1091013678 11:132029763-132029785 TAAGAAAAGCATATAAGGGAGGG + Intronic
1092467479 12:8746191-8746213 TGAGATAAGGATATAGAGAATGG - Intronic
1093024170 12:14231786-14231808 GAAGGTAAGTTTAAAGAGGAAGG - Intergenic
1093666975 12:21825930-21825952 AAAACTAGGCATAAAGAGGAAGG + Intronic
1094391438 12:29954947-29954969 TAAGAAAAAAATAAACAGGATGG + Intergenic
1094655265 12:32413521-32413543 TAAGAGAAGCGTTCAGAGGAAGG + Intronic
1095455477 12:42379984-42380006 TAAGATAATAGTAAAGATGAAGG - Intronic
1095528611 12:43158024-43158046 TGAGAAAAGCAGCAAGAGGATGG + Intergenic
1095853040 12:46831409-46831431 TAAGAGAAGCCTAGGGAGGAGGG - Intronic
1095910568 12:47422409-47422431 AAAATTAAGCATAGAGAGGAAGG + Intergenic
1096067520 12:48752970-48752992 GAAGCTAAGAATAAATAGGATGG - Intergenic
1096232292 12:49903349-49903371 AAAGATGAGCATAAAGTGGTTGG + Intronic
1096765832 12:53888506-53888528 AAATATAAGCATCAGGAGGATGG - Intergenic
1097458175 12:59826898-59826920 CAAGACAAGCATCAAGAGTAAGG - Intergenic
1098370715 12:69758135-69758157 TAAGATAAGACTAAAGAAAATGG - Intronic
1098460246 12:70725122-70725144 TAAAATAAGCATGAAGAGACAGG + Intronic
1102887415 12:116532654-116532676 TGAGAACAGCATTAAGAGGAAGG + Intergenic
1104342524 12:127964308-127964330 TGAGATGAGCATAAAGGTGAAGG - Intergenic
1105668709 13:22588728-22588750 TAAGAAAAGTATTAGGAGGAGGG + Intergenic
1105952011 13:25237516-25237538 TAAGATGAGCAAAAGGATGATGG + Intergenic
1106369758 13:29120620-29120642 TAAGAGAAGAATAAAAAGAAAGG + Intronic
1107705184 13:43095777-43095799 TAAAATAAGGATAGAGAGGAGGG + Intronic
1108729151 13:53215103-53215125 TACCATAACCATATAGAGGAGGG - Intergenic
1109483538 13:62988557-62988579 TAAGAGAAGCTTAAAGAAGTGGG - Intergenic
1109641581 13:65198770-65198792 TAAAATAAGCAGGAAGAGGTAGG - Intergenic
1109840049 13:67908477-67908499 GATGATGAGGATAAAGAGGATGG + Intergenic
1110141139 13:72131002-72131024 TAGAATAAGCATAATAAGGAAGG + Intergenic
1110356327 13:74571952-74571974 TAAGAGAAGCAGAAAGATGCAGG + Intergenic
1111091729 13:83454644-83454666 TAAGATAAAAATAAATAAGAAGG - Intergenic
1111278044 13:85978092-85978114 TGATATAAGAATAAAGAGAAAGG + Intergenic
1111806799 13:93048496-93048518 TAAGATAAGGAAAAAGATTAAGG - Intergenic
1112835728 13:103512040-103512062 GAATCTAAGCAGAAAGAGGAGGG + Intergenic
1113016372 13:105832807-105832829 TGAGACAGGCATAAAGTGGAAGG + Intergenic
1113242222 13:108350602-108350624 CCAGATTACCATAAAGAGGATGG - Intergenic
1114257296 14:21014297-21014319 AAAGAGAAGGAAAAAGAGGAAGG + Intergenic
1115469861 14:33757342-33757364 TAAGACAGGGATGAAGAGGATGG + Intronic
1115891713 14:38037730-38037752 TAAGATAAGCCTGAAGAGGTAGG - Intronic
1115899688 14:38130899-38130921 TAAGATAAGCAACAAGACAAGGG + Intergenic
1116379477 14:44247438-44247460 GAAGATACTCATAAAGAAGAAGG + Intergenic
1118830266 14:69424897-69424919 TAAGAATAGTATAAAGAGGTAGG + Intronic
1119121078 14:72078139-72078161 TAAGAACAGCACAAAGTGGAGGG - Intronic
1119146608 14:72320777-72320799 TAATATAAGGATAAGGTGGAAGG + Intronic
1120700931 14:87698087-87698109 CAAAATCACCATAAAGAGGATGG - Intergenic
1121030866 14:90657544-90657566 TAAGAAAAACATAAAGATGGTGG + Intronic
1122106340 14:99459634-99459656 AAAGATAAGTATGTAGAGGAAGG - Intronic
1124039936 15:26092445-26092467 TTAGATAAGGATAAAGCTGAAGG - Intergenic
1124094598 15:26637345-26637367 TATGATTAGGATTAAGAGGATGG - Intronic
1125254817 15:37751398-37751420 AAAGAAAAGGAAAAAGAGGAAGG + Intergenic
1126335809 15:47585027-47585049 TAAGATAGGCAGAAAGACGATGG - Intronic
1126393855 15:48190803-48190825 TAAAATAAGGATAAAGAGCAAGG + Intergenic
1127954643 15:63842760-63842782 AAAGATAATCATAAGGAGGCTGG + Intergenic
1128586165 15:68852410-68852432 TAAAATAAACATGAAGAGAAAGG + Intronic
1129819442 15:78587568-78587590 TCAGATAAGCAAGAAGAGGCTGG + Intronic
1131713747 15:95085501-95085523 TAAGAAAAGCATAATTAGAAAGG + Intergenic
1131880184 15:96854073-96854095 TAGGATGAGCATATAGGGGAGGG - Intergenic
1132312597 15:100868100-100868122 TAAGAAAAGCATAACCAGGCCGG + Intergenic
1134839821 16:17392846-17392868 TAAAGTAAACATAAAGTGGAGGG - Intronic
1134841771 16:17407293-17407315 TAAAATAAGAATAAATAGGCTGG - Intronic
1135483439 16:22842648-22842670 GAAAATAAGCAAAAAGATGATGG - Intronic
1135485587 16:22861970-22861992 TATGAAAAACATAAACAGGATGG - Intronic
1135540672 16:23327859-23327881 AAAGAAAAGAATAAACAGGAAGG + Intronic
1135973761 16:27091581-27091603 GAAGAAAAGAAGAAAGAGGATGG + Intergenic
1136405659 16:30045126-30045148 AAAGATAAGCACAGAGAGAAAGG + Intronic
1136650613 16:31666676-31666698 TATAATAAGTATAAAGGGGAAGG + Intergenic
1137333535 16:47525862-47525884 TTATAAAAGCATAATGAGGAAGG + Intronic
1138248800 16:55486933-55486955 TAGTAAAAGCATAAACAGGAAGG - Intronic
1139597476 16:67966808-67966830 TAAGAGGAGGAGAAAGAGGAAGG + Intronic
1140767867 16:78176802-78176824 GAAGATAAAAATAAAAAGGAAGG + Intronic
1141076391 16:81009612-81009634 TAAGACAAAGATAAAGAGGAAGG - Intronic
1142487845 17:258453-258475 TAAAAGAGGGATAAAGAGGAAGG + Intronic
1143191671 17:5044477-5044499 TAAGGTAAGCTTAAAAAGAAAGG - Intronic
1143939223 17:10521692-10521714 AAATATAAGCTTAGAGAGGAAGG + Intronic
1144053168 17:11515281-11515303 AAAGAAAAGAAGAAAGAGGAAGG + Intronic
1144414397 17:15032644-15032666 TAAGACAATCATAAGGGGGAGGG - Intergenic
1144612256 17:16731219-16731241 AAAGAGAAACATAAAAAGGATGG + Intronic
1144900475 17:18584073-18584095 GAAGAGAAACATAAAAAGGATGG - Intergenic
1145131972 17:20361612-20361634 AAAGAGAAACATAAAAAGGATGG + Intergenic
1146417270 17:32647260-32647282 GAATCTAAGCATAAAGAAGAGGG + Intronic
1146502113 17:33373040-33373062 TAGGATAAGCAGAAAGGGAATGG + Intronic
1146543174 17:33715446-33715468 TGAGACAAGCACAAAGAGGATGG + Intronic
1147965039 17:44190041-44190063 TTAGTTAAGGATAAAGATGAGGG + Intronic
1147966393 17:44196426-44196448 AAACAAAAGCATAAAGAGCAGGG + Intronic
1149747469 17:59113222-59113244 TAAGAAAAGAAAAAAGAGGCCGG + Intronic
1150123941 17:62624749-62624771 TGAGAACAGCATCAAGAGGATGG + Intergenic
1150735501 17:67733551-67733573 TAAGATAAGGAAAAAGACAAAGG - Intronic
1152019646 17:77773820-77773842 TAAGAAAATCATAAGGAGGCTGG - Intergenic
1155467902 18:26159215-26159237 TAACACAAGCATAAAGACCATGG - Intronic
1155680988 18:28485460-28485482 TAAGATAATTATAAACAGAAGGG + Intergenic
1155730943 18:29157449-29157471 TAAGAAAAAAATAAAGAGAAAGG + Intergenic
1156413946 18:36867173-36867195 CAAGAATAGCACAAAGAGGATGG - Intronic
1156994023 18:43445114-43445136 TGAGATAAGCATAAATAGATTGG + Intergenic
1157132902 18:45024186-45024208 TGAGACAGGCATAAAGAGTAAGG + Intronic
1158129005 18:54132207-54132229 TGAGAACAGCATCAAGAGGATGG - Intergenic
1158317820 18:56230954-56230976 TGAGAACAGCACAAAGAGGATGG - Intergenic
1161488105 19:4546561-4546583 TAAAATAAAAATAAAGAGGCAGG - Intronic
1162274382 19:9641235-9641257 GAAGGTAAGTTTAAAGAGGAAGG + Intronic
1162286468 19:9742684-9742706 GAAGGTAAGTTTAAAGAGGAAGG - Intergenic
1162363520 19:10233642-10233664 TAAAATAAAAATAAAGAGGCTGG + Intergenic
1162787697 19:13045928-13045950 GAAGATACGCAGAAATAGGAAGG + Intronic
1164292689 19:23881819-23881841 TAAGAGAAGGAGGAAGAGGAGGG + Intergenic
1164602285 19:29570435-29570457 TAAGAAAAGCAAAAACAGGCTGG + Intergenic
1167022158 19:46885435-46885457 TAAGCTAAGGATTCAGAGGAAGG + Intergenic
1167649809 19:50723139-50723161 TCAGATAATCAGGAAGAGGATGG - Intergenic
1168624028 19:57902538-57902560 TATAATAAGTATAAAGGGGAGGG + Intronic
925404065 2:3594752-3594774 TCAAAAGAGCATAAAGAGGAGGG - Intergenic
926449200 2:12981751-12981773 TCATATAAGCATACACAGGATGG - Intergenic
926960823 2:18356696-18356718 TAAGAGAAGAAAAGAGAGGAGGG + Intronic
927222913 2:20730981-20731003 TAAAAGAAGAATAAAGTGGAAGG - Intronic
928251800 2:29687277-29687299 TAAGCCAAGCAGAAAGAGGTAGG + Intronic
929811091 2:45189910-45189932 TGAGAACAGCATCAAGAGGACGG - Intergenic
929911399 2:46092548-46092570 TCAGATAAGAATCAAGAGCAAGG + Intronic
930104072 2:47626495-47626517 TAAGAACAGCACCAAGAGGATGG - Intergenic
930274624 2:49297071-49297093 TAAGATTAGCATAAGCAGGTGGG - Intergenic
931067748 2:58605597-58605619 TAATAAAAGCATATAGCGGAAGG - Intergenic
931618507 2:64186487-64186509 TCAGATAAGGAGAAAGAGGAAGG + Intergenic
931676848 2:64705531-64705553 TAACATAGTCATTAAGAGGATGG - Intronic
931712636 2:65002313-65002335 AAAGATAAGCATACATAGTATGG + Intronic
933292337 2:80451923-80451945 TAAGATAAGCATAAAGAGGAGGG + Intronic
934032001 2:88056335-88056357 TAAGGTAAGAATACAGAGGGTGG + Intergenic
934149077 2:89128173-89128195 TAAGAAAAGTGTAAAGTGGAAGG + Intergenic
934218217 2:90053868-90053890 TAAGAAAAGTGTAAAGTGGAAGG - Intergenic
935252867 2:101280244-101280266 TAAAAGAAGAATAAAGATGAAGG + Intronic
936824260 2:116561679-116561701 GAAGATAAGCAGAAATAGAATGG + Intergenic
936828386 2:116609554-116609576 TCAGGAAAGCATACAGAGGAGGG + Intergenic
939453186 2:142399441-142399463 TAAGTACAGCATCAAGAGGATGG - Intergenic
939797939 2:146670553-146670575 AAAAGTAAGAATAAAGAGGAAGG + Intergenic
939866324 2:147476566-147476588 TAAGATGAGGACAAAGAGGTAGG - Intergenic
940586597 2:155659716-155659738 TAAGAAGAGTATAAAGAAGATGG - Intergenic
941062679 2:160865595-160865617 TAAAATAAAAATAAAGAGAATGG + Intergenic
941562238 2:167060983-167061005 ATATATAAGCATAAATAGGAAGG - Intronic
941611707 2:167669051-167669073 TAAGAGAAAGATAAAGAGAAAGG - Intergenic
943352227 2:186809108-186809130 TATAAGAAGCATAAAGAAGAGGG + Intergenic
943484983 2:188467424-188467446 AGAGAAAAACATAAAGAGGAGGG - Intronic
943749498 2:191496613-191496635 TAAGAAAGGGATGAAGAGGAAGG + Intergenic
943778120 2:191790188-191790210 AAACATAAGCAGAAAGAGCAAGG - Intergenic
944080680 2:195784846-195784868 TATGATAAGCATATAAAAGATGG - Intronic
944565024 2:200981235-200981257 AAAGGTAAGCAGAAAGATGAGGG + Exonic
945407877 2:209471656-209471678 TAATAAAAGAATAAAGAGGAAGG + Intronic
1168824414 20:799932-799954 TGATATTAGCAGAAAGAGGAGGG + Intergenic
1168872291 20:1140245-1140267 TAGGATAAACATATAGAGCAAGG + Intronic
1170564900 20:17593749-17593771 TAAGATAAGGCTAAAGAGGTAGG + Intronic
1172145191 20:32752606-32752628 TGAGATAAACATAGAGGGGATGG - Intergenic
1173437184 20:43043918-43043940 TGGGATAAGCAGACAGAGGAAGG - Intronic
1174847382 20:53955892-53955914 TAAGACAAGCTTAAATATGATGG - Intronic
1175014557 20:55775341-55775363 TAAGATAAGCATCAGGAGGATGG - Intergenic
1175346414 20:58280054-58280076 TAAGATAAGCGTGAACAGCATGG + Intergenic
1177127350 21:17211874-17211896 GAAGAAAAACATAAAGAGGGAGG + Intergenic
1177735829 21:25087797-25087819 TAAAATAAGAATAAAAATGAAGG - Intergenic
1178713608 21:34943075-34943097 TATGGAAAGCATAAAGGGGAAGG + Intronic
1179582718 21:42353595-42353617 AAGGATAAACAGAAAGAGGAGGG - Intergenic
1181834891 22:25596701-25596723 AAAGATATGAATGAAGAGGAAGG - Intronic
1181885663 22:26020318-26020340 TAAGATAATCTGAAAGGGGAAGG + Intronic
1181893074 22:26081816-26081838 CAGGATAAGCGTGAAGAGGAAGG + Intergenic
1182164738 22:28161848-28161870 TAAGAAAGGAAGAAAGAGGAAGG + Intronic
1183031165 22:35106253-35106275 TAAAACAAGAATAATGAGGAAGG - Intergenic
1183630743 22:39031175-39031197 TAATAAAAAAATAAAGAGGAAGG + Intronic
1184944438 22:47793094-47793116 AAAAATAAGCATAAAAAGGAAGG + Intergenic
949103082 3:169403-169425 GAAGAAAAGGAGAAAGAGGAGGG + Intergenic
949126617 3:452731-452753 TAGGATGAGGATACAGAGGAAGG - Intergenic
949871257 3:8591322-8591344 TGAGATAAGCAAAAAGGGAAGGG - Intergenic
950037814 3:9899711-9899733 GAAGATAAGGGTAAAGAAGAAGG + Intergenic
951050305 3:18086256-18086278 AAAGAGAGCCATAAAGAGGATGG - Intronic
951279065 3:20725212-20725234 TCAGATAAGCAACAAGAGTATGG - Intergenic
951557918 3:23939272-23939294 TAAGATAAAAATAAAATGGAAGG + Intronic
951788374 3:26450858-26450880 TAAGAAAAGAATAAAGACTATGG + Intergenic
951946839 3:28147674-28147696 TAAGAAAAGTACAAATAGGATGG + Intergenic
952001698 3:28793452-28793474 TAAGATAAGAAGAAAGAGGTAGG + Intergenic
952071146 3:29637417-29637439 TAAGAAAGACGTAAAGAGGAAGG - Intronic
952274929 3:31867728-31867750 TAAGACAAGAAGAAAGAGAAAGG + Intronic
952773710 3:37024671-37024693 TAAGAGAAGGAGAAAGAGAAGGG - Intronic
953820280 3:46202451-46202473 TAAAATAGCCATAAAGGGGAGGG - Exonic
953987264 3:47454069-47454091 TAAGATAAGAATAGACAGGCCGG + Intronic
955074585 3:55601661-55601683 TAAGAGAAGGATAAAGAGCCGGG + Intronic
956383348 3:68689326-68689348 TAAGATAAGGAGGAAGAGAAGGG - Intergenic
956578686 3:70784595-70784617 AAAGAACAGCATGAAGAGGATGG - Intergenic
956752082 3:72351477-72351499 CAAGTTAAGCAAAAAGAGAAAGG + Intergenic
957395905 3:79637667-79637689 TAAGATATATATAAAGAGGATGG + Intronic
957580998 3:82073141-82073163 TAATTTAAGTAAAAAGAGGAGGG + Intergenic
958755323 3:98244838-98244860 GAAGGTAAGTTTAAAGAGGAAGG - Intergenic
959116078 3:102180130-102180152 TAAGCTAAGCTTAAAGAAGCCGG - Intronic
959627641 3:108471038-108471060 AAAGAAAAGGAGAAAGAGGAAGG + Intronic
959787731 3:110320788-110320810 TTAGACAAGCATAAAAATGAAGG + Intergenic
960425765 3:117506134-117506156 TAAGATAAGAATGAAGAGAGAGG - Intergenic
963760483 3:149283564-149283586 TAAGATAGGAAAAAAAAGGAGGG + Intergenic
964309744 3:155379954-155379976 TAAGAAAAGGAAAAAGAAGAAGG + Intronic
964474054 3:157083072-157083094 AAAAATTAGCATAGAGAGGATGG + Intergenic
964522745 3:157585435-157585457 TCAGATAAAGATAAAGACGAGGG - Intronic
965153902 3:165020340-165020362 CAAGAAGAACATAAAGAGGAAGG + Intronic
965177662 3:165356438-165356460 TAAGGGAAGAATTAAGAGGAGGG - Intergenic
965355154 3:167664458-167664480 TGAGATAAGCAAAAAGCAGAAGG + Intergenic
965367982 3:167822353-167822375 TAAAACAGGCATAAATAGGAAGG + Intronic
965441443 3:168720184-168720206 TAAGATAGAGATAAAGAAGATGG - Intergenic
966334387 3:178852143-178852165 TAACATAAGCTTCAAGAGGTGGG + Intergenic
966384230 3:179378344-179378366 TTAAATAAGCACATAGAGGATGG + Exonic
969323668 4:6428117-6428139 TAGGACATGCATAAAGAGGAAGG - Intronic
970161541 4:13194107-13194129 AAAGTTAAGCATCAAGAGAATGG + Intergenic
970367883 4:15379208-15379230 AAAAATAAGAGTAAAGAGGATGG + Intronic
970401780 4:15724203-15724225 TAAGAGAAACACAAAGAGGAAGG - Intronic
970421159 4:15906586-15906608 TAAAAAAAGAAAAAAGAGGATGG - Intergenic
971809832 4:31410125-31410147 TAAGTTGAGCATAAAGACCATGG - Intergenic
972897476 4:43641317-43641339 GAAGAGAAGAAAAAAGAGGAGGG - Intergenic
975710417 4:77156351-77156373 TAAGATAGGCAAAAAGTTGAGGG - Intergenic
975919349 4:79365800-79365822 TAAGATGTGCAGAAACAGGAAGG - Intergenic
976691687 4:87875039-87875061 TAAGATCCACTTAAAGAGGATGG + Intergenic
976860710 4:89662701-89662723 TAAGAGAAGGATAAAATGGAAGG + Intergenic
977309660 4:95369800-95369822 TAAAATATGAATAAATAGGAAGG + Intronic
977437746 4:97021373-97021395 TAAAATAAGAAAAAAGAGAAAGG - Intergenic
977501362 4:97842877-97842899 TAAGATGAGTAGGAAGAGGAGGG - Intronic
977595470 4:98874575-98874597 TACACTAAGCATAAAGAAGACGG - Intronic
978824483 4:113004639-113004661 TAAAATAAGAATAAAAAGTATGG + Intronic
979059583 4:116041019-116041041 GGAGATAACCATACAGAGGATGG + Intergenic
979566129 4:122155965-122155987 TAACATATGCATAAAGATGATGG - Intronic
979737705 4:124108014-124108036 TTAGAAAGGCATAAGGAGGAAGG - Intergenic
980017216 4:127663817-127663839 TAGGAAAAGAAAAAAGAGGAAGG + Intronic
981152218 4:141392324-141392346 AAAAATATGCATAAAGAGGGAGG - Intergenic
981716103 4:147753868-147753890 CAAATTAAGCATCAAGAGGAAGG - Intronic
983125679 4:163948744-163948766 GAAAATAAGAATAAACAGGAAGG + Intronic
983259978 4:165444934-165444956 TAAAATAAGAAGAAAGAGAATGG - Intronic
983563217 4:169122273-169122295 TAGGAAAAACATAAAGAGAAAGG + Intronic
983583513 4:169332657-169332679 TCAGAAAAGAATAAAGAGCATGG - Intergenic
984016941 4:174437983-174438005 TAAGATAAGAATAGAAATGAAGG - Intergenic
984207695 4:176805883-176805905 TAAGAGAAAGAAAAAGAGGAAGG + Intergenic
984911076 4:184674749-184674771 TAAGAAAATCATAAGGAAGAGGG + Intronic
987284491 5:16441974-16441996 TAAAATAACAAGAAAGAGGAAGG + Intergenic
987456897 5:18158294-18158316 TAAGCCAAGCATTAGGAGGAAGG + Intergenic
987590517 5:19919781-19919803 TAATATAATAATAAAGAGAAAGG + Intronic
988045637 5:25949092-25949114 TAAAATAACAATAAAAAGGACGG + Intergenic
988954572 5:36301964-36301986 GATGATTAGCATAAAGAGGCAGG + Intronic
990222149 5:53604711-53604733 CAAGATAAACCTAGAGAGGAAGG - Intronic
990406680 5:55498016-55498038 GAAGATAAGCAGAACCAGGAGGG + Intronic
990498307 5:56370368-56370390 TGAGATCAGCATGGAGAGGATGG - Intergenic
993292069 5:86086265-86086287 AAGGATAAGCATAAAGAAGAAGG + Intergenic
993339681 5:86708000-86708022 TAGGAAAAACATAGAGAGGAGGG + Intergenic
993477033 5:88378911-88378933 GAATACAAGCACAAAGAGGATGG + Intergenic
993589156 5:89772829-89772851 TGAGATAAGTATAAGTAGGAAGG - Intergenic
994390544 5:99187461-99187483 TATGATGAGGATAAAGAAGAGGG - Intergenic
994804234 5:104422531-104422553 TAGGCTAAGGAGAAAGAGGAGGG + Intergenic
995502673 5:112824886-112824908 TAACAGAAGCATAGAGAGAAAGG - Intronic
996406744 5:123112693-123112715 AAAGATAAGGATAAAGATTAGGG - Intronic
998745356 5:145252221-145252243 TAACATAAGAATCAACAGGAAGG - Intergenic
999014173 5:148080489-148080511 CAAGATAGGCATAAAGATCAGGG + Intronic
999505868 5:152195342-152195364 TGAGATCAGCAGAAACAGGAAGG + Intergenic
1000440779 5:161260582-161260604 AAAGATAAGAAGTAAGAGGAAGG + Intergenic
1002178524 5:177416981-177417003 AAAAATAAAAATAAAGAGGAAGG - Intronic
1003664237 6:8094882-8094904 TAAGAAAATCATAAGGCGGAGGG - Intronic
1003854579 6:10260294-10260316 TAAAAAAAGCAGAAAAAGGATGG + Intergenic
1004213915 6:13683298-13683320 TGAGATAAACATAAATAGAATGG + Intronic
1004289741 6:14355590-14355612 TAATATAAAGATAAAGATGAAGG + Intergenic
1004416265 6:15427035-15427057 GAAGATAAGCATAAATGGCAAGG - Intronic
1004562827 6:16767177-16767199 TAAGAAAAGTAAAAAGAGGCTGG - Intergenic
1005775903 6:29130439-29130461 TGAGATATGCAGAAAGTGGAGGG - Intergenic
1007025829 6:38572520-38572542 TAAGAAAAGAAGAAAAAGGAGGG + Intronic
1008494741 6:52121667-52121689 TAATATGGGGATAAAGAGGAGGG - Intergenic
1008646939 6:53524120-53524142 TTAAATAAGCATAATGAGAAAGG + Intronic
1009029828 6:58043340-58043362 TAAGAGAAGGAAAAAGAGAAAGG + Intergenic
1009205356 6:60794578-60794600 TAAGAGAAGGAAAAAGAGAAAGG + Intergenic
1009652973 6:66499817-66499839 TGAGAACAGCATCAAGAGGATGG - Intergenic
1009666931 6:66694511-66694533 TATGAAAAGCATAAAGCAGAAGG - Intergenic
1010355707 6:74930230-74930252 AAAGCTAAGCATAAATAGTAGGG - Intergenic
1010641094 6:78328761-78328783 TAAGATAACCATTATGAGCAAGG - Intergenic
1010953562 6:82065356-82065378 AAAGTTAAGAAAAAAGAGGAGGG + Intergenic
1011038009 6:82999113-82999135 TAAGATAGGAGTAAAGAGGGAGG - Intronic
1011745748 6:90406418-90406440 TAAGATCAGTGGAAAGAGGAAGG + Intergenic
1013714140 6:112937480-112937502 TAAGGACAGCATCAAGAGGATGG - Intergenic
1014374197 6:120651916-120651938 GAAGAAAAGGAGAAAGAGGAGGG + Intergenic
1014493067 6:122086608-122086630 TGAGAACAGCACAAAGAGGATGG + Intergenic
1015193742 6:130502013-130502035 TAAGATAAACATAGGCAGGAAGG + Intergenic
1020224538 7:6269752-6269774 CAAGATAAGGAGAGAGAGGATGG - Intronic
1020482339 7:8677658-8677680 GAAACTAAGCATAGAGAGGAAGG - Intronic
1020734436 7:11929525-11929547 AAAGATAAGCAAAATGAAGAAGG + Intergenic
1021169207 7:17377558-17377580 TAAAATAAAGATAAAGAGAAGGG - Intergenic
1021285225 7:18772464-18772486 TTACATCAGCAGAAAGAGGAGGG + Intronic
1021360279 7:19704542-19704564 TATGAAAAGAATAAAGTGGATGG + Intronic
1021479353 7:21098857-21098879 TAAGATAGGTATTAAAAGGATGG - Intergenic
1023340241 7:39211994-39212016 GGAGATAAGGATAAAGATGATGG - Intronic
1023518819 7:41030454-41030476 GAAAATACACATAAAGAGGATGG + Intergenic
1024864088 7:53882868-53882890 TAAAATAAACCTAAGGAGGATGG + Intergenic
1025838425 7:65119425-65119447 GAAGAAAAGTAAAAAGAGGAGGG - Intergenic
1025878852 7:65513671-65513693 GAAGAAAAGTAAAAAGAGGAGGG + Intergenic
1025884647 7:65576556-65576578 GAAGAAAAGTAAAAAGAGGAGGG + Intergenic
1026417239 7:70195139-70195161 TAATTTAAGCATATTGAGGAAGG - Intronic
1026418273 7:70205850-70205872 TAGCATAAGCTTTAAGAGGAGGG + Intronic
1026434499 7:70383723-70383745 TAAGACAAGCAAAAATAGGGTGG + Intronic
1027181111 7:75940058-75940080 TAAAATAAGAGTAAAGAGGTGGG - Intronic
1027544799 7:79513872-79513894 TGAGCTGAGAATAAAGAGGATGG + Intergenic
1027578795 7:79966177-79966199 CAACATACGCTTAAAGAGGATGG + Intergenic
1029566484 7:101341841-101341863 AAAGAAAAGTATAAAGAGGCTGG - Intergenic
1030193267 7:106830556-106830578 GAAGGTAAGTTTAAAGAGGAAGG - Intergenic
1030324183 7:108202704-108202726 TAAGATAAGCACCAGGAGAATGG - Intronic
1030781840 7:113610652-113610674 TAAAAAAAAAATAAAGAGGAAGG + Intergenic
1031228825 7:119077763-119077785 TACCATAAGCATTAAGAGGATGG + Intergenic
1032333879 7:131006355-131006377 AAAGATAATCATGAAGAAGATGG + Intergenic
1032432760 7:131875358-131875380 GAGGTTAAGCATAAGGAGGAAGG - Intergenic
1033480711 7:141737722-141737744 TAAGAAAAGCAGAAAAAGAAAGG - Intergenic
1037985342 8:23287585-23287607 TAACAGAGGAATAAAGAGGAAGG - Intronic
1039483429 8:37892796-37892818 TAAGATGAGGCTGAAGAGGAAGG - Intronic
1039682049 8:39750774-39750796 AAAGTTAAGCATAAAGACAAAGG + Intronic
1039994474 8:42519989-42520011 AAAGATTAGCATAAAGAGTTGGG - Intronic
1039994522 8:42520308-42520330 AAAGATGGGCATAAAGAGGCTGG - Intronic
1040066119 8:43145443-43145465 TAAGATAAACTTAAAAATGAGGG + Intronic
1040754615 8:50757737-50757759 TAAAATAAGAATAAAGAACAAGG - Intronic
1041816336 8:61976052-61976074 TAAGATAAGTAAAAAGACAAAGG - Intergenic
1041862598 8:62531420-62531442 TAAGCTAAGAATAAAGGGAATGG - Intronic
1042002528 8:64141727-64141749 CAAGAACAGCATCAAGAGGATGG - Intergenic
1043082708 8:75785374-75785396 TAAGAGGAGGAGAAAGAGGAGGG - Intergenic
1044364148 8:91323799-91323821 AAAGATAAGAAAAAAGAGAAAGG - Intronic
1044449348 8:92315367-92315389 TATGATTAGGATAAAGATGAAGG + Intergenic
1046160483 8:110356699-110356721 TAACATAAGGATAAAGGCGAAGG - Intergenic
1046214271 8:111122520-111122542 AAAGATAAACAGAAAGAGCAAGG + Intergenic
1047343101 8:124001633-124001655 TAAGGTAAGAATAATGAAGAAGG + Intronic
1047616740 8:126568836-126568858 CAAGAGAAGCAAAAAGAGGGTGG + Intergenic
1047831821 8:128641209-128641231 TAAGACAATTATAAACAGGAAGG - Intergenic
1049905427 9:212385-212407 AAAGATACGGAGAAAGAGGAAGG + Intergenic
1050846207 9:10223221-10223243 TAAGAAAAGGAGGAAGAGGAAGG - Intronic
1051031420 9:12684713-12684735 AAAGATAAAAATAAAGGGGAAGG + Intergenic
1051085727 9:13346824-13346846 TAAGTTAAGCATATAATGGATGG + Intergenic
1051786362 9:20748607-20748629 GGAGTTAAGGATAAAGAGGAAGG + Intronic
1052516390 9:29486072-29486094 GAATATAAGCCTAAAGAGGTAGG - Intergenic
1053004605 9:34596151-34596173 TACTATAAGGAAAAAGAGGATGG - Intergenic
1053302048 9:36959186-36959208 TAAGATAAGAAGAATGAGAAGGG - Intronic
1053873045 9:42513776-42513798 CAGGATCAGCATAAAGAGGTGGG + Intergenic
1053899707 9:42782144-42782166 CAGGATCAGCATAAAGAGGTGGG - Intergenic
1054261938 9:62875449-62875471 CAGGATCAGCATAAAGAGGTGGG + Intergenic
1054269285 9:62952976-62952998 CAGGATCAGCATAAAGAGGTGGG - Intergenic
1055080286 9:72261868-72261890 TATGATTAGCAAAAAGAAGAAGG - Intergenic
1055188061 9:73480398-73480420 AAAGATAAGAATAAAGTTGAAGG - Intergenic
1055919910 9:81449382-81449404 TAAAAGAAGCAAAAAGGGGAAGG - Intergenic
1056023670 9:82468084-82468106 TAAAATAAGCATAAAGGTAATGG + Intergenic
1056392149 9:86150269-86150291 TAGGCAAAGCATAAATAGGAAGG + Intergenic
1056523129 9:87418590-87418612 AAGGATGAGCATAAAGAAGAGGG - Intergenic
1056983861 9:91342879-91342901 TAGGTTAAGGAGAAAGAGGAGGG - Intronic
1057477688 9:95417212-95417234 CAAAATAAACACAAAGAGGATGG + Intergenic
1058858734 9:109093117-109093139 TAAGATATGCGTAAAGTGGAGGG + Intronic
1060701355 9:125751843-125751865 TAAGATGACCAAAAAGAGGTGGG - Intronic
1061232507 9:129322871-129322893 TCTGATAAGGATAAAAAGGAGGG + Intergenic
1062138313 9:134941535-134941557 TCAGACAAGCAGAATGAGGATGG + Intergenic
1062164073 9:135097117-135097139 AAACATTAGCATAAAAAGGACGG - Intronic
1185669643 X:1797389-1797411 TAAAATAAAAATAAAGAGAAAGG - Intergenic
1186017836 X:5218111-5218133 AAAGGGAAGGATAAAGAGGAAGG + Intergenic
1186318590 X:8398964-8398986 TATAAGAAGCAAAAAGAGGACGG - Intergenic
1187972783 X:24675149-24675171 CAAGATAAGAATAAGGATGAGGG - Intergenic
1188122340 X:26323623-26323645 TGAGATACACATACAGAGGAAGG + Intergenic
1188750373 X:33897730-33897752 TAAGGTAAGGACAAAGAGAATGG + Intergenic
1190734315 X:53245729-53245751 TAGAATAAGCAAAAAGAGCAAGG + Intronic
1191041625 X:56087356-56087378 TGAGAAAAGCATCAAGGGGATGG - Intergenic
1192153620 X:68727004-68727026 TAGGAGATGGATAAAGAGGAGGG + Intergenic
1192321407 X:70093355-70093377 TAAGATAAACTGAAAGAGCATGG - Intergenic
1192764813 X:74129669-74129691 GAAGGTAAGTTTAAAGAGGAAGG + Intergenic
1193097908 X:77573019-77573041 TAAGAAAAGGATAAAGGAGATGG - Intronic
1194138977 X:90184234-90184256 TAAGAAATGGAAAAAGAGGAGGG + Intergenic
1194331228 X:92585177-92585199 AAAGAACAGCATCAAGAGGATGG + Intronic
1195878624 X:109569399-109569421 TTAAATAAGCATATAGAGGATGG + Intergenic
1196101722 X:111853858-111853880 CAGGAGAAGCATAAAGAGGAAGG + Exonic
1196302806 X:114065792-114065814 TAAGAAAAGCAATAAAAGGAAGG + Intergenic
1197280983 X:124535592-124535614 TATAATAAGAATAATGAGGATGG - Intronic
1199328587 X:146531440-146531462 AAAGATAAGGATAAAGAAAAAGG + Intergenic
1199704886 X:150415509-150415531 TTGCATAAGCAAAAAGAGGAAGG + Intronic
1199920933 X:152402990-152403012 TAACATAAGAAGAAATAGGATGG + Intronic
1200484775 Y:3754465-3754487 TAAGAAATGGAAAAAGAGGAGGG + Intergenic
1200639929 Y:5704232-5704254 CAAGAACAGCATCAAGAGGATGG + Intronic
1201402084 Y:13614203-13614225 TACAATAAGTATAAAGGGGAGGG - Intergenic