ID: 933294827

View in Genome Browser
Species Human (GRCh38)
Location 2:80477515-80477537
Sequence ATGGAGACTCAGAATGGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 791
Summary {0: 1, 1: 2, 2: 30, 3: 135, 4: 623}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933294827 Original CRISPR ATGGAGACTCAGAATGGGAA AGG (reversed) Intronic
900578376 1:3395363-3395385 GTCTAGACTCAGAAAGGGAAGGG - Intronic
901202843 1:7476372-7476394 AAGGAGACACAGAATGGGCGGGG + Intronic
901262848 1:7886152-7886174 GGGGAGACTCAGAGTGGGCAGGG - Intergenic
901746326 1:11376117-11376139 CTGGAGGCTCAGATTGGCAAAGG + Intergenic
902553940 1:17235682-17235704 ATGCAGACTCAGGAAGGGGAGGG + Intronic
902729071 1:18356923-18356945 ATGGAGATTGAGGATGGGGAGGG + Intronic
902939204 1:19787601-19787623 ATGGAGCATCAGATGGGGAAGGG + Intronic
903350661 1:22714532-22714554 GTTGAGACTGAGAATGGGAGTGG + Intronic
903414906 1:23175900-23175922 ATGGAGCCTCAGAGAGGGTAAGG + Intronic
903646276 1:24898045-24898067 AGGGAGACTCAGAGAGGGACAGG + Intergenic
903751949 1:25628749-25628771 TTGGAGACTCAGAAGGGGGAGGG - Intronic
903758158 1:25677679-25677701 ATATAGACTCAGAAAGGGAAGGG - Intronic
904271457 1:29353069-29353091 ATTGAGGGCCAGAATGGGAAAGG + Intergenic
904586963 1:31586005-31586027 ACTGAGACTCAGAAAGAGAAAGG + Intronic
904990990 1:34592448-34592470 ATGGATACTCAGAGTGGTGAGGG - Intergenic
905976056 1:42174644-42174666 ATTGAGACCCAGAGAGGGAAGGG - Intergenic
906556273 1:46717313-46717335 ATTGGGGCTCAGGATGGGAAAGG - Intronic
906659750 1:47573878-47573900 ATGGAGTCTCAGAGAGGGCAAGG + Intergenic
906736161 1:48130938-48130960 ATGGAGACTCAGAAGGGTGAGGG - Intergenic
906882199 1:49603719-49603741 CTGGAGACTCAGAATGGGGGAGG - Intronic
906953205 1:50350783-50350805 ATGGGGAGTCAGAAGGGGGATGG - Intergenic
907271209 1:53292337-53292359 ATTGAGGCCCAGAAAGGGAAAGG + Intronic
907272245 1:53297970-53297992 ACTGAGGCCCAGAATGGGAAGGG - Intronic
907350163 1:53822886-53822908 ATAGAGGGTCAGAATGGGAATGG + Intronic
907744019 1:57194565-57194587 ACCAAGACTCAGAAAGGGAAAGG - Intronic
908595038 1:65678937-65678959 TTGGAGACTCAGAATAGGAGAGG - Intergenic
908897809 1:68920331-68920353 ATGAAGAATGAGAAAGGGAATGG - Intergenic
908959377 1:69676936-69676958 CTGGAGACTCAGAAGGGAAAGGG - Intronic
909659795 1:78069198-78069220 CAGGAAACTGAGAATGGGAAAGG - Intronic
910087322 1:83419021-83419043 AGGGAGACACAGGATGAGAAAGG + Intergenic
910802759 1:91162208-91162230 ATGGAAACTTAGCCTGGGAAGGG + Intergenic
911457797 1:98148905-98148927 TTAGAGACTCAGAAGGGGAAAGG + Intergenic
911946207 1:104112760-104112782 TTGGAGACTCAAAAGGGGGAAGG - Intergenic
912003539 1:104864322-104864344 TTGGAGACTCTGAAGGGGGAAGG - Intergenic
912521325 1:110246923-110246945 ATGGAGACTCAGAGGGAGAGAGG - Intronic
913085164 1:115430107-115430129 ATGGAGAAAGAGAATGGGAGGGG - Intergenic
914406509 1:147379447-147379469 AGATAGACTCAGGATGGGAATGG - Intergenic
914435230 1:147653697-147653719 AAGAAGACTAACAATGGGAAAGG - Intronic
914437134 1:147670210-147670232 AGGGAGACCCCGAGTGGGAACGG + Exonic
914863228 1:151403878-151403900 ATGAAGACTCAAACTGGGAATGG + Exonic
914988742 1:152480520-152480542 ATGGAGAGAGAGACTGGGAAAGG - Intergenic
915162397 1:153929736-153929758 ATGGAGAGTGAGAAAGGGAAGGG - Exonic
915478856 1:156171373-156171395 AAGGAGGCTCAGAATGGAGAAGG + Intronic
916025194 1:160827558-160827580 ATGGAGGCTCCTAATAGGAAAGG - Intronic
916091044 1:161308243-161308265 CTGGAGAGTCAGGAAGGGAAGGG + Intronic
916598874 1:166273102-166273124 ATGGTGACTCAGAGTGGGGAAGG + Intergenic
916636847 1:166680054-166680076 ATGGAGACTGAGAAGGAGGAGGG - Intergenic
917410822 1:174758452-174758474 TTGGAGACTCAGAAGGGGAAAGG - Intronic
918108010 1:181429752-181429774 AAGCAGACTGGGAATGGGAAAGG - Intronic
918570483 1:185985779-185985801 ATGGAGACACAGAATGATGAAGG - Intronic
918725611 1:187918097-187918119 TTGGAGACTCAGAATGGGGAGGG + Intergenic
918928876 1:190826700-190826722 ATGGAGATTCAGAAGGGTGAGGG + Intergenic
919211611 1:194494144-194494166 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
919492261 1:198219540-198219562 TTGGAGACTCAGAATGGGGAAGG + Intronic
920019675 1:202945849-202945871 ATGGAGACTTAGAAGCGGGAGGG + Intronic
920611143 1:207438966-207438988 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
922122927 1:222691699-222691721 TTAGATACTAAGAATGGGAAAGG + Intronic
922461459 1:225817167-225817189 CTGGAGACTCAGGATGGAAGAGG - Intronic
922623959 1:227018292-227018314 TTGGAGACTCAGGGTGGCAATGG + Intronic
922647199 1:227300658-227300680 GTGGAGACTCAGAAGGGAGAAGG + Intronic
922860832 1:228814946-228814968 TTAGAGACTCAGAAAGGGGAGGG - Intergenic
923116100 1:230939235-230939257 AGGGAGATACAGAAAGGGAAAGG - Intronic
923249345 1:232165764-232165786 TTGGAGACTCAGAGTGGGGAGGG + Intergenic
923482286 1:234396881-234396903 TGGGGGACTCAGAATGAGAAGGG + Intronic
924108113 1:240669712-240669734 ATGGAGACTCAGAAGGGTGAAGG - Intergenic
924621992 1:245669971-245669993 TTGGAGACTCCGAAGGGGAAAGG + Intronic
924820088 1:247480895-247480917 CTGCAGAGTTAGAATGGGAATGG + Intergenic
1064955500 10:20903856-20903878 ATGGAGACTCAGAAGGGAGAAGG + Intronic
1065423677 10:25576202-25576224 CTGGAGACTCAGAAGGGGTTAGG - Intronic
1065915603 10:30352118-30352140 ATGGGGTTTCACAATGGGAATGG + Intronic
1066173198 10:32874439-32874461 CTGGAGGCTCAGAAGGGGAGAGG - Intronic
1066643219 10:37577674-37577696 ATGAAGACTGGGAATGGTAATGG + Intergenic
1067570757 10:47369253-47369275 ATGGAGAGTCTGCAGGGGAAGGG + Intronic
1067784394 10:49233229-49233251 TGGGAGACTCAGAATGGGGGAGG + Intergenic
1067935266 10:50605904-50605926 ATGGAGACTCAGAAGGGTGAAGG - Intronic
1068168778 10:53365891-53365913 TTTGAGAAGCAGAATGGGAATGG + Intergenic
1068227794 10:54129073-54129095 AATGAGACTCAGAAATGGAAAGG - Intronic
1068465639 10:57387166-57387188 ATGGAGACTCAGAAGCCCAAGGG + Intergenic
1068553280 10:58429594-58429616 ATGGAGACTCAGAAGAGTGAAGG - Intergenic
1068640260 10:59396956-59396978 ATGGAGACTCAGAAGGGTGAGGG - Intergenic
1070103495 10:73411284-73411306 TTAGAGACTCAGAAAGGGGAGGG + Intronic
1071068561 10:81666142-81666164 ATGGAGACAGAGTATTGGAAAGG + Intergenic
1071299595 10:84246386-84246408 CTGGAGACTCAGAAGGGGAAGGG - Intronic
1071479322 10:86052693-86052715 ATAGAGAAGAAGAATGGGAAAGG + Intronic
1072223104 10:93344405-93344427 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1072324894 10:94288232-94288254 TTGGAGACTCAGAATGAGAGTGG - Intronic
1072872126 10:99131729-99131751 TTGGAGACTCAGAGTTGGAGAGG + Intronic
1072872907 10:99139271-99139293 CTGGAGACTCAGAAGCAGAAGGG + Intronic
1074518929 10:114198990-114199012 ACGGTGACTCAAAGTGGGAAAGG - Intronic
1074566625 10:114585253-114585275 CTGGAGACTAAAAAAGGGAAAGG - Intronic
1074734847 10:116419596-116419618 TTGGAGACTCAGAAGTGGGAGGG - Intergenic
1074750166 10:116578210-116578232 AAGGAGTCTCAGAATGGGACTGG + Intergenic
1074972331 10:118549370-118549392 ATTGAGACCCAGGATGTGAAGGG - Intergenic
1075213669 10:120513127-120513149 ATAAAGACTCAATATGGGAATGG + Intronic
1076143892 10:128101394-128101416 ATGCAGAATCAGAAAGGGAAAGG - Exonic
1077797917 11:5510135-5510157 GTGGAGGCTCAGACTGGGATTGG + Intronic
1078569065 11:12442018-12442040 AGAGAGACTCAGAGTTGGAAGGG + Intronic
1079919358 11:26413063-26413085 TTTGTGCCTCAGAATGGGAATGG + Intronic
1080005898 11:27406076-27406098 ATGGGGACACAGACTGGGATAGG - Intronic
1080047543 11:27825149-27825171 TTAGAGACTCAGAAAGGGCAGGG - Intergenic
1080510706 11:32967310-32967332 TTGGAGACTCAGAAGGGGAGAGG + Intronic
1080675792 11:34425551-34425573 TTTGAGACTCAGAAGGGGGAGGG + Intergenic
1080694722 11:34592972-34592994 ATGAAGACAAAAAATGGGAAAGG - Intergenic
1081017635 11:37903050-37903072 ATGGAGATTCACAATGGACAAGG + Intergenic
1081155908 11:39690144-39690166 TTGGAGACTCAGAAAGGGGAAGG - Intergenic
1081201593 11:40222784-40222806 ATGCAGGCTTAGAGTGGGAAAGG + Intronic
1081796000 11:45820177-45820199 ATGGACTCTCAGAATCAGAAAGG + Intergenic
1082119269 11:48360618-48360640 TTGGAGACTCAGAAGCGGGAAGG + Intergenic
1082255027 11:50024529-50024551 CTGGAGACTCAGAAGCGGGAAGG - Intergenic
1083132662 11:60640300-60640322 CTGGAGACTCAGAAGCGGGAGGG + Intergenic
1083185866 11:61017548-61017570 AAGGTGAGTCAGGATGGGAAGGG + Exonic
1084475520 11:69386516-69386538 ATGGAGGCTCAGAGAGAGAATGG - Intergenic
1084554433 11:69867530-69867552 ATGGAGCATCAGAATGGGGAAGG - Intergenic
1084717107 11:70880946-70880968 ACACAGACTCAGAATGTGAAAGG - Intronic
1084963652 11:72732185-72732207 ATAGAGCCTGAGAATGAGAAAGG + Intronic
1085624467 11:78061432-78061454 ACTGAGACTCAGAAAGGGAGAGG - Intronic
1085998342 11:81949762-81949784 TTGGGGACTCGGAAGGGGAAGGG - Intergenic
1086049252 11:82569328-82569350 ATGGAAGCTCAGAAGGGGGATGG - Intergenic
1086460758 11:87003307-87003329 AGAGATTCTCAGAATGGGAAGGG + Intergenic
1088553021 11:111033794-111033816 TTGGAGACGCAAAATGGGGAGGG + Intergenic
1088765261 11:112969295-112969317 ATGGAAACTGAGACTGAGAAAGG + Intronic
1088793629 11:113248748-113248770 GTGGCGACTCAGAAGGAGAAGGG + Intronic
1089472811 11:118734444-118734466 ATGGAGATGCTGAGTGGGAAAGG + Intergenic
1090412599 11:126519395-126519417 ATGGAAACTCAGAGAGGCAAAGG - Intronic
1092027761 12:5257380-5257402 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1092042390 12:5395982-5396004 ATGGGGACTCAGCCTGGAAATGG - Intergenic
1092130654 12:6110574-6110596 ATGGAGACTCTGGAGGGCAAAGG + Exonic
1092915453 12:13185208-13185230 CTGGAGACTCAGAAGGCGGAGGG + Intergenic
1093072129 12:14716544-14716566 AGGAAGACTCAAAGTGGGAAGGG + Intergenic
1093456649 12:19371465-19371487 TTGGAGACTCAGAAGGGAGAGGG - Intronic
1093656748 12:21703511-21703533 TTGGAGACTCAGAGGTGGAAGGG - Intronic
1093705501 12:22270640-22270662 ATGGAGACTCAGAAAGGTAAAGG + Intronic
1093977971 12:25443907-25443929 TTGGAGACTCAGAAGGGGGAAGG - Intronic
1094143975 12:27209624-27209646 ATGGAGGCTCAGAAGGGGGAGGG + Intergenic
1094166887 12:27452350-27452372 ATGGAGACTCAGGAGGGTGAAGG - Intergenic
1094702663 12:32885235-32885257 ATGAACACTCAGATTGGGAAAGG - Intronic
1094816512 12:34191756-34191778 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1095472004 12:42547167-42547189 ATAGAAACTTAGAATTGGAAGGG + Intronic
1095557914 12:43529640-43529662 TTGGAGACTCAGAAGCGGGAGGG + Intronic
1096334330 12:50741807-50741829 ATAGACTCTCATAATGGGAAGGG + Intronic
1096613988 12:52821463-52821485 ATTGAGACACAGACAGGGAAGGG + Exonic
1097257343 12:57689293-57689315 ATGGAGACTCAGAAGGATGATGG + Intergenic
1097477657 12:60078625-60078647 TTGGAGACTCAGAAGGGGATAGG - Intergenic
1097620952 12:61938893-61938915 TTGGAGACTCAGAAGGAGGAGGG + Intronic
1097819214 12:64110663-64110685 ATGGAGATTCTGAATAAGAATGG - Intronic
1098111038 12:67122130-67122152 ATGGATAATCAGTTTGGGAAAGG + Intergenic
1098992733 12:77082433-77082455 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
1099913462 12:88862326-88862348 AAGAAGACTCAGAATGGAATGGG - Intergenic
1099938035 12:89151387-89151409 ATGAAGACTCAGAATGGGGAGGG + Intergenic
1099957489 12:89364797-89364819 ATGGAGACCTAGTATGGGAAGGG - Intergenic
1100699402 12:97130346-97130368 ATGGAGACTCAGGGAGGGATGGG - Intergenic
1100893853 12:99157643-99157665 CTGGAGACTCAGAAAGGGGGAGG + Intronic
1101464474 12:104933906-104933928 CTGGAGACTCAGAAAGGGGGAGG + Intronic
1101520439 12:105477550-105477572 TTAGAGACTCAGAAAGGGGAAGG - Intergenic
1101946738 12:109143129-109143151 TTGGAGACTCAGAGAGGGGAAGG - Intronic
1102558051 12:113741925-113741947 ATGGAGAGAGAGAAGGGGAAGGG + Intergenic
1103105680 12:118222761-118222783 TTGGAGACTCAGAAGAGGAAGGG + Intronic
1103728023 12:123008511-123008533 CTGAAGCCTCAAAATGGGAATGG - Intronic
1104062480 12:125280501-125280523 ATGGACACTCAGATTGAGCAAGG - Intronic
1104867155 12:131963176-131963198 ATGTAGGGTCAGAATGGCAAAGG - Intronic
1106316036 13:28594640-28594662 ATGGAGACCCTGAAAGTGAAAGG + Intergenic
1106572690 13:30941651-30941673 ATGGAGACTCAGAAGCAGAGAGG - Intronic
1107966211 13:45600531-45600553 ATGGAGACTCAAAAGAGTAAGGG - Intronic
1108008025 13:45972429-45972451 TTGGAGACTCAGAAGGGGGAGGG + Intronic
1108738994 13:53315143-53315165 TTGGAGACTCAGAAGAGGGAGGG + Intergenic
1108976642 13:56452319-56452341 TTGGAGACTCAGAATAGGGGAGG - Intergenic
1109399010 13:61800055-61800077 ATGGAGAATGAGAAGGAGAATGG + Intergenic
1109940797 13:69361373-69361395 TTGAAGACTCAGAAGGGGGAAGG + Intergenic
1110484264 13:76019768-76019790 ATGGGGACCCAGAAGGGGCATGG + Intergenic
1110901031 13:80824859-80824881 CTGGAGACTCAGAGTGGAGAGGG - Intergenic
1112559610 13:100501371-100501393 ATGGAGACTCAGAAGGGTGACGG - Intronic
1112722881 13:102265141-102265163 ATGGAGGATGAGAATGAGAAAGG - Intronic
1112912498 13:104505262-104505284 ATTGAGTCTCAGAAAGGTAAAGG - Intergenic
1113050290 13:106203835-106203857 TTGGAGACTCAGAGGGGGAAGGG - Intergenic
1114952514 14:27773645-27773667 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1115947592 14:38679674-38679696 ATGGAGACTCAGAAGGAGGAGGG - Intergenic
1116042001 14:39697407-39697429 TTGGAGACTCAGAAGGGGGGAGG - Intergenic
1116145436 14:41061854-41061876 AAAGAAACTTAGAATGGGAAAGG + Intergenic
1116183183 14:41561694-41561716 ATGGAGACTAGCAAGGGGAATGG - Intergenic
1116693851 14:48147220-48147242 CTGGAGACTCAGAAGGGCAGAGG + Intergenic
1117740135 14:58809526-58809548 ATGGAGTCTCAGAAGGGTGAGGG - Intergenic
1117997262 14:61489542-61489564 TAGGAGACTCAGCAAGGGAAGGG + Intronic
1118636977 14:67756961-67756983 ATGGAGACACAGACTGAGAAAGG - Intronic
1120454073 14:84709159-84709181 AGACAGACACAGAATGGGAAAGG + Intergenic
1120978949 14:90274200-90274222 ACGGGGACTCAGCATGGGCAGGG + Exonic
1121086027 14:91146701-91146723 ATGGAAACTCAGAATGGAAGGGG + Intronic
1121178391 14:91908323-91908345 ATGAAGACTGGGAATGAGAAAGG - Intronic
1121295806 14:92821016-92821038 ATGGAGGCACAGAATGGTGATGG + Intronic
1123111014 14:105866863-105866885 ATGGAGCCTTAGGCTGGGAATGG + Intergenic
1123629787 15:22253695-22253717 AAGAAGACTCAGAGTGGGACAGG - Intergenic
1123805172 15:23863337-23863359 ATGGAGGCTCAGAAGCAGAAAGG + Intergenic
1124216451 15:27811348-27811370 TTGGAGATTCAGAATGGGAAGGG + Intronic
1124938492 15:34195416-34195438 ATGGAGACTCAGAGAGGTAGGGG + Intronic
1125020949 15:34986728-34986750 ATGGAACTTCAGAATAGGAAAGG + Intronic
1125085623 15:35725908-35725930 CTGTGGACTCAGAATAGGAAGGG - Intergenic
1125375252 15:39021912-39021934 AAGGAAACTGAGAATGAGAAAGG + Intergenic
1125714106 15:41809581-41809603 CTGGAGACTGCGAATAGGAAAGG - Intronic
1126304046 15:47234501-47234523 TTGGAGACTCAGGAAGGGGAAGG - Intronic
1126475250 15:49058954-49058976 ATGGAGACTCAGAAGGAGGAAGG + Intergenic
1126753413 15:51900357-51900379 TTGGCGACTCAGGATGGGGATGG + Intronic
1127823350 15:62680736-62680758 TTAGAGACTCAGAAGGGAAAGGG - Intronic
1128061160 15:64736813-64736835 AAGGGGACTGAGAAAGGGAAAGG - Intergenic
1128255494 15:66193203-66193225 ATGTAGACTCATAATGGGTTTGG - Intronic
1128388656 15:67167965-67167987 AGGGAGACTCTGTCTGGGAAAGG - Intronic
1128577376 15:68785442-68785464 ATGGGGACTCAGCCTGGGATGGG - Intronic
1129151336 15:73689867-73689889 ATGAAGACCCAGAAAGGCAAGGG + Intronic
1129479714 15:75814023-75814045 ATGGGGTTTCACAATGGGAATGG - Intergenic
1129673988 15:77622488-77622510 AGGGAGACTCAGAAAGGTGAGGG + Intronic
1129710503 15:77818399-77818421 GAGGAGACTCACAATGGGAGAGG + Intronic
1129779436 15:78260402-78260424 ATGAAGGCTCTGAATTGGAAGGG - Intergenic
1129786715 15:78314559-78314581 GTAGAGATTCAGAAGGGGAATGG + Intergenic
1130064476 15:80592748-80592770 GTGGGGCCTCAGAATGGGCAAGG - Intronic
1130712278 15:86294911-86294933 ATGGAGACTCGGAAGGGTCAGGG - Intronic
1130930065 15:88419387-88419409 ATGGAAACTCAGAATGACAAAGG + Intergenic
1131080837 15:89533476-89533498 ATGGAGACTCAGAATGCTGAGGG - Intergenic
1131572089 15:93548780-93548802 TTGGAGACTCAGAAGGGTACAGG + Intergenic
1132463286 16:66101-66123 GTGGAGACCCAGATTGAGAAGGG + Intronic
1133070900 16:3246300-3246322 ATGGAGCTGCAGACTGGGAAGGG - Intronic
1133472716 16:6091220-6091242 ATGGTGACTAAGGCTGGGAAGGG - Intronic
1133595120 16:7283555-7283577 ATGGAGATACAGAATGTCAAGGG - Intronic
1133670304 16:8012161-8012183 ATGGAGACTTAGTCTTGGAAAGG - Intergenic
1133696258 16:8265838-8265860 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1133886942 16:9838894-9838916 CTGGAGACTCAGAAAGGGAGAGG + Intronic
1134343270 16:13365177-13365199 ATGGAGATTTAAACTGGGAAGGG + Intergenic
1134740667 16:16540914-16540936 CTGGAGACTCAGAAGAGGAGAGG - Intergenic
1134926835 16:18171266-18171288 CTGGAGACTCAGAAGAGGAGAGG + Intergenic
1135218560 16:20593564-20593586 TTGGAGACTCAGAAGGAGGAAGG - Intergenic
1135704277 16:24661236-24661258 TGAGAGACTCAGAAGGGGAAGGG - Intergenic
1135799604 16:25480351-25480373 CTGGAAACTCAGAAAGGGAGGGG + Intergenic
1135973013 16:27086005-27086027 CTGGAGACTCAGAAGGTGGAGGG + Intergenic
1137755998 16:50902739-50902761 GTGGAGACACAGAATGCAAAGGG + Intergenic
1137935053 16:52626991-52627013 ATTGAGGCTCAGAATGGTTAAGG + Intergenic
1137971708 16:52991915-52991937 CTGGAGACTCAGAATGGGGAGGG + Intergenic
1137980072 16:53061960-53061982 ACAAAGTCTCAGAATGGGAAAGG + Intronic
1138274953 16:55727689-55727711 ATTGGGACCCAGAATGTGAAAGG + Intergenic
1138300809 16:55928404-55928426 CTGGAGACTCAGAAGGTGGAAGG + Intronic
1138359314 16:56413618-56413640 AAAGTGACTCAGAATGGGCAGGG - Intronic
1138436042 16:57000598-57000620 ATTGAGGCTCACAGTGGGAAAGG - Intronic
1138528668 16:57623092-57623114 ACTGAGACTCAGAGAGGGAAAGG - Intronic
1139305913 16:65986243-65986265 TTGGAGACTCAGAAGGGAAAAGG + Intergenic
1139947109 16:70648961-70648983 ATAGAGACACACAAAGGGAAAGG - Intronic
1139964151 16:70736347-70736369 TCTGAGACTCAGAATGAGAACGG - Intronic
1140049062 16:71463403-71463425 ATGGAGGGTAGGAATGGGAAGGG - Intronic
1140705238 16:77622657-77622679 TTGGAGACTGAGAAAGGGGAAGG - Intergenic
1141008832 16:80377837-80377859 ATGGAAACACAGAAAGGGAAGGG + Intergenic
1141263070 16:82471327-82471349 AAGGAGAAACAGAAGGGGAAGGG - Intergenic
1141867696 16:86762059-86762081 ATGGAAAATCAGAATGAGGAAGG + Intergenic
1141973355 16:87497061-87497083 AAGAAGACTCAGAGTGGGACAGG + Intergenic
1144042144 17:11421518-11421540 ATGGAGACAGCGAATGGTAATGG - Intronic
1144528208 17:16009885-16009907 ATGTAGACTAAAAATAGGAATGG + Intronic
1145977898 17:28994794-28994816 ATGGAGCCTCCGGATGGGCAGGG + Intronic
1146097659 17:29947401-29947423 ATGGAGACTCAGAAGTGGGAGGG + Intronic
1146614567 17:34344618-34344640 TTGGAGATTCAGAAGGGGGAAGG + Intergenic
1146789502 17:35743377-35743399 ACAGAGACTCAGAATGGGGGTGG - Exonic
1147253635 17:39168362-39168384 ATAAAGACCCAGACTGGGAATGG - Intergenic
1148148119 17:45378888-45378910 GTGGGGTCTCAGAATAGGAAGGG + Intergenic
1148387015 17:47241484-47241506 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1148444591 17:47729803-47729825 ATGAAGACTCAAAATGAGAGAGG - Intergenic
1149275350 17:55027400-55027422 TTGGAGACTCAGAAGGGGGATGG + Intronic
1149436923 17:56640854-56640876 ATGGAGAGTCAGTAGGTGAACGG + Intergenic
1153110346 18:1579036-1579058 ATGGAGACTCAGAAGAGAATTGG - Intergenic
1153361463 18:4202340-4202362 CTGGAGCCTCAGAATGAGGAAGG + Intronic
1153597622 18:6743997-6744019 ATTGACACTCAGTATGTGAATGG + Intronic
1154083855 18:11282863-11282885 TTGGAGACTCAGAAGGGTGAGGG - Intergenic
1154214961 18:12408739-12408761 ATGGAGACTCTGAAGGGTGAGGG + Intronic
1154505899 18:15040574-15040596 ATGGAGAACAGGAATGGGAATGG + Intergenic
1154940843 18:21111592-21111614 ATGGAGACTTAGCAGAGGAAAGG + Exonic
1155012341 18:21792288-21792310 ATGGAGGCACTGAATGGGACTGG - Intronic
1155315134 18:24563740-24563762 ATGGAGACTCAGAAGGGGGACGG - Intergenic
1155771342 18:29704342-29704364 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1156687516 18:39667947-39667969 ATGGAGAGGCAGAATGGTATGGG - Intergenic
1157849625 18:51035873-51035895 ATGCTGCTTCAGAATGGGAATGG + Intronic
1158001793 18:52628074-52628096 ATAGAGAATGAGAATTGGAAAGG - Intronic
1158290402 18:55934042-55934064 ATAGATACACAAAATGGGAAAGG + Intergenic
1158369557 18:56784434-56784456 ATGGAGACTCAGAAGGGGAAGGG - Intronic
1158841894 18:61396743-61396765 ATAGAGGCTCAGAATGGAAAGGG - Intronic
1159116630 18:64121348-64121370 ATGAAGACTCAAAAAGGTAAGGG - Intergenic
1159391302 18:67796041-67796063 AAGGAGAATGAGAATGAGAATGG - Intergenic
1159692242 18:71503663-71503685 ATGGATACCAAGAATGGGACAGG + Intergenic
1160105993 18:75976638-75976660 ATGGAAACTCACATTGTGAAGGG + Intergenic
1160331894 18:78001281-78001303 TTAGAGACTCAGAAGGGGAAGGG - Intergenic
1161810858 19:6470450-6470472 ATGGAGACTCAGAGAGGGAAAGG - Intronic
1161847180 19:6718655-6718677 GCGGGGACTCAGAAAGGGAAGGG + Intronic
1162258384 19:9512129-9512151 ATGGGATATCAGAATGGGAAAGG - Intergenic
1163229300 19:15989310-15989332 CTGGAGACTCAGAAGAGGGAAGG - Intergenic
1163640906 19:18461479-18461501 ATGGAGACTGGGATTGGGACTGG - Intronic
1163676011 19:18655665-18655687 ATGGAGAGCCAGGATGGGAGGGG + Intronic
1164290841 19:23867456-23867478 ATGGAATATCAGAGTGGGAAAGG + Intergenic
1164443850 19:28300544-28300566 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1164471785 19:28542228-28542250 TGGGAGACTCAGAAGGGGGAGGG + Intergenic
1164922742 19:32101799-32101821 ATGGAGACTCAGAAGGGGGTGGG - Intergenic
1164944595 19:32282757-32282779 CTGGAGACTCAAAAGGGGAGAGG - Intergenic
1165001189 19:32763834-32763856 AGAGAGACTCAGAATGGACAGGG - Intronic
1165800907 19:38549216-38549238 ATGGAGAGTTAGGATGGGAGAGG - Intronic
1166069321 19:40378039-40378061 CTGGTGACGCAGAATGGGAGGGG + Exonic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166207366 19:41280199-41280221 ATGGAGACTCAGAAGTGTTAGGG + Intronic
1166602117 19:44105674-44105696 ATGGAGACTCAAAATGGGGAGGG - Intronic
1167385583 19:49161099-49161121 GTGGGGACTGAGATTGGGAAAGG + Intronic
1167691752 19:50989258-50989280 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1167723677 19:51196607-51196629 TTGGAGACTCAGAATGAGGAAGG - Intergenic
1167725931 19:51212480-51212502 ATGGGGGCTGAGGATGGGAATGG - Intergenic
1167793385 19:51693966-51693988 ATGGAGACTCAGAGAGGGGGAGG + Intergenic
925092509 2:1166946-1166968 ATGGAGAGCCAGAAGGGGCATGG - Intronic
926198411 2:10777094-10777116 TTGCAGAGACAGAATGGGAAAGG + Intronic
926400975 2:12496337-12496359 AGGGAGAATAAGCATGGGAAAGG - Intergenic
926906942 2:17814827-17814849 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
927152610 2:20204479-20204501 CTGGACACACACAATGGGAAGGG - Intronic
927503170 2:23595792-23595814 GTGGAGAGACAGCATGGGAAGGG - Intronic
928479676 2:31669264-31669286 TTTGAGACTCAGAATGGGGAGGG - Intergenic
929301106 2:40304581-40304603 AAGGAGGCTGACAATGGGAAAGG - Intronic
929994140 2:46814629-46814651 ATAGACACTCAGAGTGGCAAGGG + Intergenic
930463176 2:51710059-51710081 GTGGAGACTCAGAAGGGTGAGGG + Intergenic
930528325 2:52559784-52559806 TTAGAGACTCAGAAAGGGGAGGG - Intergenic
930539442 2:52686754-52686776 CTGGAGTCTCAGAATGGGGGAGG + Intergenic
930892919 2:56412005-56412027 CTGGAGACTCAGAAGGGTGAGGG + Intergenic
931121151 2:59221497-59221519 GTGGAAAATGAGAATGGGAATGG + Intergenic
931421331 2:62130474-62130496 ATGGAGGGTGAGAGTGGGAAAGG - Intronic
931978248 2:67666686-67666708 AGGGAGAGTAAGAAGGGGAAGGG + Intergenic
932884416 2:75535766-75535788 TTGGAGACTCAGAATGGGGAAGG + Intronic
933173170 2:79146920-79146942 TTGGAGACTCAGGGTGGGGAGGG - Intergenic
933294827 2:80477515-80477537 ATGGAGACTCAGAATGGGAAAGG - Intronic
933349856 2:81139416-81139438 GTGGAGACTTAGAATGGTGAGGG + Intergenic
933904903 2:86882292-86882314 TTGGAGACTCAGAAGGAGGAGGG + Intergenic
934079851 2:88458572-88458594 AGGGAGACTCACAAGGGGAAGGG - Intergenic
934484794 2:94695637-94695659 TTGGAGACTCAGAGCGGGGAGGG + Intergenic
934616763 2:95776165-95776187 ATGGAGAGACAAAATGGGAATGG - Intergenic
934644127 2:96048395-96048417 ATGGAGAGACAAAATGGGAATGG + Intergenic
934837544 2:97604486-97604508 ACGGAGAGACAAAATGGGAATGG + Intergenic
934959847 2:98662502-98662524 ATAGAATTTCAGAATGGGAAAGG - Intronic
934993731 2:98938644-98938666 GAGGAGACTCAGCATGAGAAGGG + Intergenic
935081085 2:99795373-99795395 CTGGGGACTCAGAAGGGCAATGG + Intronic
935752128 2:106245015-106245037 CTGGAGACTCACAATCAGAAAGG - Intergenic
935912540 2:107912562-107912584 CTGGAGACTCACAATCAGAAAGG - Intergenic
936367325 2:111869870-111869892 TTGGAGACTCAGAAGGAGGAGGG - Intronic
936580027 2:113691493-113691515 ATGGAGACTCAGAAGGGGGAGGG - Intergenic
937260502 2:120583403-120583425 ATCGAGAATCAGAATGGCATCGG - Intergenic
938200821 2:129371700-129371722 ATGAAGACTCATAATGGGGAGGG - Intergenic
938265737 2:129926912-129926934 CTGGAAACACAGCATGGGAAAGG + Intergenic
939106173 2:137951166-137951188 TTGGAGACTCAGAAGTGGAAGGG - Intergenic
939877408 2:147593547-147593569 ATGAGGACTTAGAATGGAAATGG + Intergenic
939918717 2:148081782-148081804 ATGTAGAATAAGAATGGGGAAGG - Intronic
940545974 2:155085858-155085880 ATGCAGACTCAGAAGGAGGAGGG + Intergenic
940605545 2:155919547-155919569 CTGGAGACTTAAAATGTGAATGG - Intergenic
940612453 2:156007387-156007409 GTGGAGACTCAGCTTGGGATGGG - Intergenic
940706717 2:157114561-157114583 ATGGAGACTTGCAAGGGGAAGGG + Intergenic
942491105 2:176490504-176490526 AAGGAGACTCAGATTGCCAACGG + Intergenic
942529149 2:176889632-176889654 ATGCAGGCTGAGAATGGCAATGG + Intergenic
945075774 2:206038066-206038088 ATGAAGACTCAGAAGGGTGACGG + Intronic
945630277 2:212266109-212266131 AAGGAGACACAGAATAGGAGAGG - Intronic
945975924 2:216270733-216270755 GTGGAGCCTGAGAATGGGATGGG - Intronic
946557166 2:220871818-220871840 ATGGAGACTGGAGATGGGAATGG + Intergenic
946859013 2:223982306-223982328 ATGGAGACTCAGAAGGAGGAGGG + Intronic
947131508 2:226931477-226931499 TTTGAGACTCAGAAGGGGAAAGG + Intronic
947321784 2:228927173-228927195 ATGGAGCCACAGAATGGAAGGGG - Intronic
947420468 2:229937783-229937805 AAGCAGACTCAGAAGGGAAAGGG + Intronic
947448877 2:230186660-230186682 ATGGAGACTCAGAAAGGAGAGGG - Intronic
947864557 2:233387323-233387345 AAGGAGCCTCAGCATGGAAATGG - Intronic
948208291 2:236174229-236174251 ATGGGGAGTGAGAATTGGAATGG + Intergenic
1168916081 20:1489557-1489579 AAGGGGACTCAGAAGGGGAGAGG - Intronic
1169083255 20:2810604-2810626 TTGGAGACTCAGAAGGAGGAGGG - Intergenic
1169323214 20:4652615-4652637 ATGGAGACTCAGAAGTGGGGAGG - Intergenic
1169513731 20:6294267-6294289 CTGGAGACTCAGAAAGGGGGAGG - Intergenic
1169766780 20:9155105-9155127 TTACAGACTCAGAAGGGGAAGGG - Intronic
1169791681 20:9416355-9416377 AAGGAGATTCAGAACTGGAAAGG + Intronic
1171211855 20:23323055-23323077 CTGGAGACTCAGAAGGGGTAGGG + Intergenic
1171336404 20:24389456-24389478 ATGGGAACTCACACTGGGAAGGG + Intergenic
1171750797 20:29046512-29046534 GTGGAGACACAGCATGGAAATGG + Intergenic
1171778495 20:29394603-29394625 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1171822552 20:29867053-29867075 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1172768724 20:37364618-37364640 ATGGAGGCTCAGAAAGGGAGAGG - Intronic
1173059618 20:39648747-39648769 TTGGAGATTCAGAATGGGGAGGG + Intergenic
1173264601 20:41467759-41467781 ATGAATTCACAGAATGGGAAAGG + Intronic
1173493859 20:43504907-43504929 ATGGGGAAACAGAAGGGGAATGG - Intergenic
1173641250 20:44603623-44603645 ACGGAGGCTCAGAAAGGGCAAGG - Intronic
1173960148 20:47064741-47064763 ACAGAAACTCAGAGTGGGAAAGG - Intronic
1174149524 20:48476308-48476330 CTGGAGACCCAGAAAGGAAATGG - Intergenic
1174149559 20:48476515-48476537 CTGGAGACCCAGAAAGGCAATGG + Intergenic
1174149593 20:48476707-48476729 CTGGAGACCCAGAAAGGAAATGG - Intergenic
1174941809 20:54937747-54937769 ATGGAAACTGAGTCTGGGAATGG + Intergenic
1175343785 20:58254523-58254545 CTGAAGACTCAGAAGGGGAGAGG + Intergenic
1175668173 20:60877974-60877996 ACGGAGACTCATCATGGGATGGG + Intergenic
1175773518 20:61638551-61638573 ATGGAGACCAACAATGGGAAGGG + Intronic
1176313964 21:5224408-5224430 GTGGAGACACAGCATGGAAATGG - Intergenic
1177267710 21:18805880-18805902 TTCGAGTCTCAGAATGGGGAGGG + Intergenic
1177866340 21:26517480-26517502 AAGAAGACTCAGATGGGGAATGG + Intronic
1177991355 21:28039455-28039477 ATGGAGAACAGGAATGGGAATGG - Intergenic
1178604749 21:34025960-34025982 AGGGAGACTCAGACTGGAGAGGG + Intergenic
1178621274 21:34178820-34178842 ATGGAGCCTCACAGTGGGACGGG + Intergenic
1178925849 21:36774316-36774338 GTGGAGACTCAGACAGGGAACGG + Intronic
1179095916 21:38314340-38314362 ATGGGGAGTCAGAAGGGGGATGG - Intergenic
1179133431 21:38660015-38660037 ACTGAGACTGAGAGTGGGAAAGG + Intronic
1180324268 22:11354597-11354619 ATGGAGACTCAGAAGGGTGAAGG + Intergenic
1180872092 22:19151899-19151921 ATTGAGGGTGAGAATGGGAAAGG - Intergenic
1181427074 22:22850695-22850717 AGGGTGACACAGATTGGGAAGGG - Intronic
1181913756 22:26262548-26262570 AAGAAGCCTGAGAATGGGAATGG - Intronic
1182035281 22:27193526-27193548 ACGGAGGCTCAGAAAAGGAAAGG - Intergenic
1182859963 22:33551033-33551055 ATGGAAACTCAGAAGGGTAAAGG + Intronic
1183000960 22:34858384-34858406 ATGGTGCTTTAGAATGGGAATGG - Intergenic
1183343878 22:37296324-37296346 ATGGAGGCCCAGAGTGGGGAAGG - Intronic
1184306275 22:43604574-43604596 AGGGAGCCTCAAGATGGGAAAGG - Intronic
1184933797 22:47703519-47703541 ATGGAGACTCAGGCTGTGCATGG - Intergenic
949147941 3:726187-726209 GTGGGGACTAAGAATGAGAAAGG + Intergenic
949696927 3:6708372-6708394 ATGGAGACTCAGAAATTGAAAGG - Intergenic
950128621 3:10526799-10526821 ATAGAGACTCAGAGAGGGGAAGG - Intronic
950320447 3:12047613-12047635 ATGGAGACGATGAAAGGGAAAGG + Intronic
950488277 3:13285582-13285604 ATGGAGACAGAGAATGAGCAAGG + Intergenic
951438519 3:22693951-22693973 TTGGAGACTCGGAAAGGGGATGG - Intergenic
951778319 3:26335005-26335027 ATGGAGGCTCAGAATTTTAATGG + Intergenic
952199010 3:31106130-31106152 CTGGAGACTCAGAAGGGTGAAGG - Intergenic
952577830 3:34795833-34795855 ATGGAGACTCAGGCTTGGAAAGG - Intergenic
952641651 3:35603800-35603822 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
952643374 3:35625390-35625412 TTGGAGACTCAGAAGTGGGATGG - Intergenic
952973963 3:38678499-38678521 AAAGAGAATCAGAATGGGAAGGG + Intergenic
953135115 3:40175508-40175530 TGGGAGTCTGAGAATGGGAAAGG - Intronic
953277297 3:41514762-41514784 ATGGAGACTCAGAAGGGTGAGGG + Intronic
953380464 3:42467520-42467542 ATGGAGACTCAGAAGGGTGAAGG + Intergenic
953896961 3:46810380-46810402 ATTGAGACCCAGAGTGGGTATGG - Intronic
954517205 3:51189418-51189440 TTAGAGACTCAGAAAGGGGAGGG - Intronic
955019541 3:55105979-55106001 ATGGAGAGTCAGCCTGGGGAGGG + Intergenic
955032548 3:55234811-55234833 TTGGAGACTCAGGAGGGGGATGG - Intergenic
955060774 3:55489726-55489748 ATGGAGACTCAGGAGGTAAAGGG - Intronic
955603856 3:60677315-60677337 CTGGAGACTCAGAATGATGATGG - Intronic
956031075 3:65038772-65038794 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
956390830 3:68771106-68771128 ATGGGGAGTCAGAAGGGGGATGG - Intronic
956695328 3:71914038-71914060 TTAGAGACTCAGAATGAGGAGGG - Intergenic
956819567 3:72941380-72941402 ATGTAAACTCAGAATGCAAAGGG - Intronic
956995463 3:74822453-74822475 ATGGAGACCAAAAATGAGAAGGG - Intergenic
958550794 3:95609362-95609384 ATGGGGACAGAGAATGGCAAGGG - Intergenic
958859930 3:99434354-99434376 TTGGTGACTCAGAAGGAGAAGGG - Intergenic
959096344 3:101960671-101960693 ATGGAGACTAAGAAGAGCAAAGG + Intergenic
959377686 3:105605460-105605482 ATGGAGAACCGGCATGGGAATGG - Intergenic
960076204 3:113488586-113488608 TTGGAGACTCAGAAGGGGGAGGG + Intronic
960840883 3:121957436-121957458 TTGGAGTCTCAGAAGGGGATAGG + Intergenic
961913559 3:130346147-130346169 AGGTAGACTCAGAATTCGAAAGG + Intronic
962159720 3:132986235-132986257 AAAGAGACTCATAAAGGGAAAGG + Intergenic
962256900 3:133877230-133877252 AGGGAGATGCAGAAAGGGAATGG + Intronic
962526672 3:136243585-136243607 ATGGAGTCTGAGAATGGCAGTGG + Intergenic
962704961 3:138034139-138034161 ATGGAGACTCAGAAAGTTTAAGG - Intergenic
962783335 3:138742330-138742352 ATGGTGATTTAGAATGGGATTGG - Intronic
962814464 3:138986154-138986176 ATTGAGTCTCTGAATGGGAAGGG - Intergenic
963047076 3:141110369-141110391 ATAGAGGCTGAGAATGGGAGAGG + Intronic
963208854 3:142666271-142666293 ATGGAGTTTCAGTTTGGGAAAGG - Intronic
963850360 3:150204854-150204876 ATGGTGTCTCAGAGTAGGAAGGG - Intergenic
964116922 3:153146270-153146292 ATGGAGTCTGTGAATGGAAATGG + Intergenic
964162470 3:153662109-153662131 ATGGAGCTACAGAGTGGGAATGG - Intergenic
964773477 3:160249849-160249871 CTGGAGACTCAGGAAGGGGAGGG - Intronic
965535010 3:169814206-169814228 ATGGGGAGCCAGAAAGGGAATGG + Intergenic
965628674 3:170708140-170708162 AGGGAGATTAGGAATGGGAATGG + Intronic
967081026 3:186049597-186049619 CTGGAGACGCAGAGGGGGAAGGG + Intronic
967188817 3:186967764-186967786 ATGGAGGCCCAGAAAGGGGAAGG + Intronic
967673901 3:192272816-192272838 AAGGAGCATCAGACTGGGAAAGG - Intronic
968015451 3:195328151-195328173 ATGGAGGTTCAGAGTTGGAAAGG - Intronic
969897174 4:10316274-10316296 TTGGAGACTCAGAAGGGTCATGG - Intergenic
970024679 4:11610873-11610895 AAGGAGACTGAGAACGTGAAAGG - Intergenic
970221422 4:13815836-13815858 ATGGAGACTCAGAAGGGTGTGGG - Intergenic
970273164 4:14368493-14368515 ATGGAGAGCCAGAAGGGGGATGG + Intergenic
970912529 4:21293807-21293829 ATTTAGACTAGGAATGGGAAGGG + Intronic
971484891 4:27149021-27149043 ATTGAGGCTAAGAATGAGAAAGG - Intergenic
971975679 4:33683311-33683333 TTGGAGACTCAGAATGGGGGAGG - Intergenic
972213191 4:36863235-36863257 TTGGAGACTCAGACGGGGAGAGG + Intergenic
972390251 4:38607010-38607032 ATGGGGAGTCAGAAGGGGGATGG + Intergenic
972408675 4:38769966-38769988 ATGGAGACAAAGCATGGGGAAGG - Intergenic
972600398 4:40566941-40566963 ATGAAGACACAGAATGGGCCGGG - Intronic
972889456 4:43538363-43538385 CTGGAGATTCAGAAAGGGAGAGG + Intergenic
972993178 4:44847472-44847494 CTGGAGACTGAGAATGGTAAAGG - Intergenic
973019959 4:45190740-45190762 ATGGAGACTCTGATTGCTAAAGG + Intergenic
973710821 4:53628962-53628984 ATGGAGGCTCAGAAGGGAAAGGG + Intronic
973712855 4:53646358-53646380 ATAGAGACTGAGAATGGGGTGGG - Intronic
974032797 4:56790990-56791012 ATGGAGACTCAGAAGAGGGAGGG - Intergenic
974574957 4:63706743-63706765 AAAGAGAATCAAAATGGGAAAGG + Intergenic
975290482 4:72672115-72672137 TTGGAGACTCAGAAGTGGGAGGG - Intergenic
975437445 4:74369307-74369329 TTAGAGACTCAGAAGGGGAAGGG - Intronic
975696711 4:77021234-77021256 GTGGAGACGCAAAATGTGAAGGG + Intronic
975905354 4:79204716-79204738 CTGGAGACTCAGAAGGGGAGTGG - Intergenic
976171927 4:82313263-82313285 TTGGAGACTCAGAAGGGGAAGGG + Intergenic
976277553 4:83292845-83292867 TTGGAGACTCAGAAGGGAAGAGG + Exonic
977509533 4:97945214-97945236 TTGGAGACTTAGAAAGGGGAGGG - Intronic
977608358 4:99005905-99005927 TTGGAGACTCAGAAAGGGGGAGG + Intronic
977707636 4:100088998-100089020 CTGGAGACTCAGAACGGGAAGGG - Intergenic
977910285 4:102526325-102526347 ATGGAGATTCAGAAAGGTGAGGG + Intronic
978913685 4:114097081-114097103 TTGGAGACTCAGAATGGGGAAGG - Intergenic
978994061 4:115128116-115128138 ATGGTGACTCAGAAGGGTTAGGG - Intergenic
979281463 4:118872827-118872849 ATGGAGACTCAAAAGGGGGAGGG - Intronic
980747638 4:137040303-137040325 TTGGAAACTCAGAATGGGGGAGG - Intergenic
981361589 4:143852065-143852087 TTGGAGACTCAGAAGGGGGAGGG - Intergenic
981372326 4:143973046-143973068 TTGGAGACTCAGAAGCGGGAGGG - Intergenic
981485304 4:145279707-145279729 CTGGAAATTAAGAATGGGAAGGG - Intergenic
981665877 4:147225691-147225713 ATGTAGACTCCAAGTGGGAATGG - Intergenic
981783215 4:148448364-148448386 AGGGAGAGTCAGAAAGAGAAAGG + Intergenic
981827182 4:148956641-148956663 AAAGAGACTCAGAGGGGGAAAGG - Intergenic
982039455 4:151381337-151381359 TTGGAGACTCAGAAGGGTATAGG + Intergenic
982267369 4:153550853-153550875 TTGGAGACTCAAGATGGGGAAGG + Intronic
982610756 4:157571709-157571731 AGGGAGACTCTGAATGTAAATGG + Intergenic
982765029 4:159336328-159336350 TTGGAGACTCAGAAGGGGAAGGG - Intronic
982887672 4:160802469-160802491 TTGGAGACTCAGAATGGGGATGG + Intergenic
983295603 4:165864364-165864386 ATAGAAACTCAGACTGGGCAAGG + Intergenic
983400527 4:167259000-167259022 CTGGAGACTTAGAAGGGGGAGGG + Intergenic
983739762 4:171114886-171114908 AGGGAGAAGCAGAGTGGGAATGG - Intergenic
984321770 4:178206677-178206699 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
984613409 4:181867370-181867392 ATGGAGACTGAGGATGAGTATGG - Intergenic
984677620 4:182568374-182568396 TTGGAGAAACAGAATGAGAAGGG + Intronic
985042839 4:185909366-185909388 TTGGAGACTCAGAAGGGCTAGGG + Intronic
985141736 4:186846922-186846944 GTGGAAACTCTGAATGGGGAAGG + Intergenic
986227897 5:5834049-5834071 ATGGAGACTCATAATAGGAAGGG + Intergenic
986435845 5:7730038-7730060 ATGGAGACTCCAAAGGGGGAAGG - Intronic
986465756 5:8021282-8021304 CTGGAGATTCAGAATGAGCAAGG - Intergenic
986539946 5:8834415-8834437 CTGGAGACTCAGAACAGGGAAGG + Intergenic
986583621 5:9291948-9291970 ATGGAGACTTGGGATGGGCAGGG - Intronic
986687498 5:10287474-10287496 ATGGAGACTCAGAAGGGGGAGGG + Intronic
988205339 5:28126516-28126538 ATGGAGAGCCAGAAGGGGGATGG - Intergenic
988222331 5:28364241-28364263 ATGGAGACTCAGAAGGGTAGGGG + Intergenic
988261536 5:28892551-28892573 ATGGAGACACAGACGGGAAAGGG + Intergenic
988889025 5:35594338-35594360 TTAGAGACTCAGAATGGGGAGGG - Intergenic
989443432 5:41500411-41500433 ATGGATACTCAGAAGGGTGAGGG + Intronic
989607539 5:43258928-43258950 TTGGAGACTTAGAAGGGGTAGGG - Intronic
990656614 5:57963693-57963715 ATGGAGACACAGAAAGGTAAAGG - Intergenic
990682933 5:58265881-58265903 ATGGAGTATTAGAATTGGAAGGG - Intergenic
991325173 5:65423154-65423176 CTGGAGATTCAGAAGGGGGAAGG + Intronic
991524774 5:67544245-67544267 ATTGAGTGTTAGAATGGGAAGGG - Intergenic
991557859 5:67915572-67915594 ATGTGGTCTCAGAATTGGAAGGG + Intergenic
991648616 5:68828447-68828469 AAAGAGACTGGGAATGGGAAGGG + Intergenic
992232566 5:74677857-74677879 GTGGAGACTCAGAAAGGGGAGGG - Intronic
992276388 5:75124803-75124825 CTGGAGACTCAGAAGGGTAGGGG + Intronic
992403615 5:76434347-76434369 TTGGAGACTCAGAAAGAGGAGGG - Intronic
992638862 5:78751430-78751452 GAGGAGCCTCAGAATGGGAAGGG + Intronic
992712716 5:79476485-79476507 CTGGAGACCCAGACTGGCAACGG - Intronic
993165064 5:84342401-84342423 ATGGAGACTCAGAAAGGTGGGGG + Intronic
993457668 5:88144020-88144042 AAGGAAACTCAGAATGGCAGGGG - Intergenic
993465260 5:88237492-88237514 ATGGGGAATCAGAAAGGGATTGG - Intronic
993540051 5:89138136-89138158 TTGGAGACTCTGAAGGGGGAAGG - Intergenic
993854367 5:93055158-93055180 ATAGAGATGGAGAATGGGAATGG - Intergenic
994228350 5:97281788-97281810 ATGGAGACTCAGATGGGGGCAGG - Intergenic
994388675 5:99163524-99163546 TTGGAGACTCAGAAATGGGAAGG + Intergenic
994958828 5:106571460-106571482 TGGGAGACTCTGAAAGGGAAGGG + Intergenic
995895217 5:117003472-117003494 ATGGAAACTCTGGAGGGGAAAGG - Intergenic
996200806 5:120670106-120670128 ATGCAGATTCACAATGGGATTGG + Intronic
996620413 5:125495036-125495058 TTAGAGACTCAGAAGGGGAAGGG + Intergenic
998231110 5:140361980-140362002 AAGGAGACACAGAATATGAAAGG - Intronic
998980990 5:147701992-147702014 ATATGGACTCAGAATGAGAAGGG - Intronic
999037853 5:148373609-148373631 ATAGGGACTGAGAATGGGGAGGG - Intergenic
999278101 5:150345806-150345828 ACAGAATCTCAGAATGGGAAAGG - Intergenic
999319613 5:150605427-150605449 ATTGAGGCTCAGATAGGGAAGGG + Intronic
999378065 5:151100853-151100875 ATAGAGACTCAGGGAGGGAAAGG + Intronic
999923577 5:156350069-156350091 TTGGAGACTCAGAAGAGGAGAGG + Intronic
999981211 5:156959622-156959644 TTTGAGACTCAGATTGGGGAAGG - Intronic
1000632031 5:163601685-163601707 ATTGAGGCCCAGAATGGAAATGG + Intergenic
1000821004 5:165983167-165983189 TTGGAGACTCTGAATGGGGGAGG + Intergenic
1000839020 5:166193129-166193151 ATGCAGATTAAGAATGGGGAAGG + Intergenic
1000937237 5:167317393-167317415 ATGGAGACTCATAATGCTAGAGG + Intronic
1001214917 5:169846855-169846877 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1001551065 5:172602700-172602722 ATGGAGGCTCAGAGAGTGAAGGG - Intergenic
1001734484 5:173987956-173987978 ATGGAGGCTCAGAGAAGGAAAGG + Intronic
1002475712 5:179464583-179464605 ATGGGGAGCCAGAAGGGGAATGG + Intergenic
1002485718 5:179534904-179534926 ATGGATACCCAAAAAGGGAAGGG + Intergenic
1002904544 6:1438126-1438148 CTGAGGACTCAGAATGGAAAGGG - Intergenic
1002905736 6:1447590-1447612 CTGGAGACTCAGAAGGGGGGAGG - Intergenic
1004170671 6:13293323-13293345 TTGGGGACTCAGAAGGGGGAGGG + Intronic
1004462714 6:15853428-15853450 AAGGAGAAGCAGAAGGGGAAGGG - Intergenic
1004984079 6:21059917-21059939 GTGAAGACTCAGAAGGGGGAGGG - Intronic
1005088321 6:22029839-22029861 ATGGAGACTGAGAAGGAGAGAGG + Intergenic
1005849507 6:29810917-29810939 ATGGAGACCCAGAAGGGTAAGGG + Intergenic
1006021840 6:31121951-31121973 AGTGACACTCAGAATGGGAGTGG + Intronic
1007040357 6:38715747-38715769 TCGGAGACTCAGAAGGGGAAGGG + Intronic
1007221840 6:40284835-40284857 ATTGAGACTCAGAAAGGTTATGG - Intergenic
1007357980 6:41334708-41334730 GCAGAGACTGAGAATGGGAAAGG - Intergenic
1007416188 6:41692656-41692678 ATGGAGGCTCAGAGGGGGAGGGG - Intronic
1007691276 6:43703052-43703074 AGGGAGACTCAGGATGGGTGGGG - Intergenic
1007897974 6:45382034-45382056 TTTGAGAGTCAGAATGGTAAGGG + Intronic
1008019066 6:46555239-46555261 ATTGAGCCTCAGAAAGGGAAAGG - Intronic
1008595277 6:53035785-53035807 CTGCTGACTCAGAAGGGGAAGGG - Intronic
1008921738 6:56850098-56850120 ATGGAGACTGAGAGTGAGCAGGG - Intronic
1009271374 6:61619262-61619284 TTAGAGACTCAGAAGGGGGAGGG - Intergenic
1009327327 6:62369152-62369174 ATGTAGACTCAAAATAGCAAAGG + Intergenic
1009347916 6:62639554-62639576 ATGGAGACTCAGACCGTGTAGGG - Intergenic
1009624394 6:66120542-66120564 TTGGAAACTCAGAAGGGGATAGG - Intergenic
1009929990 6:70165716-70165738 AGTGAGAGTCAGAATGGGTATGG + Intronic
1010073603 6:71773390-71773412 TTGGAGAAGCAGAAGGGGAAAGG - Intergenic
1010815465 6:80353062-80353084 ATGGAGACTCAGAGAGGAGAGGG - Intergenic
1011308188 6:85952511-85952533 CGGGAGACACAGAAGGGGAAGGG - Intergenic
1011490296 6:87884582-87884604 ATGAAGGCTCAGGATGGGGAAGG + Intergenic
1012120711 6:95363256-95363278 TCAGAGACTTAGAATGGGAAGGG + Intergenic
1012164660 6:95933238-95933260 TTAGAGACTCATAAGGGGAAGGG - Intergenic
1012729698 6:102866682-102866704 TTGGAGACTCAAAAGGGGAAAGG + Intergenic
1012823142 6:104114154-104114176 ATGGAAACTCAGAATGATGAGGG - Intergenic
1012902344 6:105020708-105020730 ATAGAGACTCAGAAGGGTGAGGG - Intronic
1013286948 6:108689913-108689935 AAGGAGACTCAACTTGGGAATGG + Intergenic
1013396760 6:109748559-109748581 ATGGGGATTTAGAATGGAAAAGG + Intronic
1013508649 6:110824407-110824429 CTGGAGACTCAGAAAAGGGAGGG + Intronic
1013806796 6:114005381-114005403 ATGGAGTCTCAGAGTTGGGAGGG + Intronic
1014092627 6:117421414-117421436 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1014393648 6:120896133-120896155 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
1014675700 6:124362522-124362544 ATGGAGACAGAGAATAAGAAAGG - Intronic
1015483941 6:133746765-133746787 ATGAAGACTCAGAATTGGGAGGG - Intergenic
1015499577 6:133918607-133918629 TTGGAGACTCGTAAGGGGAAAGG - Intergenic
1015636266 6:135277801-135277823 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
1015734925 6:136388934-136388956 ATTTAGACTCAGAGTGGGTAAGG - Intronic
1015916506 6:138222872-138222894 CTGGAGACTCAGAATGGGGGAGG - Intronic
1016150628 6:140737554-140737576 TTGGAGACTCAGAAAGGAGAGGG - Intergenic
1016385971 6:143531243-143531265 TTGGAGACTCAGAAAGGGGAGGG + Intergenic
1016693040 6:146961360-146961382 CTGGAGACTCAGAAGGGTAAGGG + Intergenic
1016991635 6:149933764-149933786 ATGGAGAGGAAGAGTGGGAAGGG + Intergenic
1017812242 6:157991585-157991607 ATGGAATCTCAGAGTAGGAAAGG - Intronic
1017938360 6:159027334-159027356 TTGGAGACTCAGAATGGGGGAGG + Intergenic
1017993403 6:159509913-159509935 ATGGAGGCACTGAAAGGGAAGGG - Intergenic
1018149684 6:160926362-160926384 AAGGAGACGCATAAAGGGAACGG + Intergenic
1018431342 6:163725279-163725301 AGGAAGACTCAGAATGGCAGGGG + Intergenic
1018952333 6:168387350-168387372 ATTAAAACTCAGGATGGGAAAGG - Intergenic
1019098440 6:169607612-169607634 CTGGAGACTCAGAAGGGTAGAGG + Intronic
1019391927 7:793180-793202 GTGGAGACTCAGAAGGGTGAAGG + Intergenic
1020087155 7:5316702-5316724 AAGGACACAAAGAATGGGAAAGG + Intronic
1020448622 7:8297102-8297124 GTGGAGACCGAGACTGGGAATGG - Intergenic
1020966944 7:14882596-14882618 ATAGAGACTCAGAAGGGAGAAGG - Intronic
1021085121 7:16413476-16413498 TTAGAGATTCAGAATGAGAAAGG - Intronic
1021556494 7:21923932-21923954 ATGGAGACTCAGGCTGACAAAGG - Intronic
1021873132 7:25023194-25023216 TTGGAGACTCTGAAGGGGGAGGG - Intergenic
1021953391 7:25797683-25797705 TTGAAGACTGAGAATGGGATTGG - Intergenic
1023635369 7:42204199-42204221 ATGGAGGCAGAGAATGTGAATGG - Intronic
1023795658 7:43789799-43789821 ATGGAGACTCAGGGTGGGAAAGG - Intronic
1026869156 7:73840344-73840366 ATGGAGGATCAGCAAGGGAAAGG + Intronic
1027122459 7:75531708-75531730 GGGGAGACACAGATTGGGAAAGG - Intergenic
1027223648 7:76230633-76230655 ATTGAGAGTCAGGAAGGGAAGGG + Intronic
1027304201 7:76875505-76875527 AGGGAGACACAGGATGAGAAAGG + Intergenic
1027408103 7:77884388-77884410 ATGGAGACTCAGAAGGGGTAGGG - Intronic
1027609709 7:80345459-80345481 ATGGAGACTCAGAAGGTGGAGGG + Intergenic
1028123910 7:87089354-87089376 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
1028366232 7:90036025-90036047 ATTGAGACTGGGGATGGGAATGG - Intergenic
1028524672 7:91770300-91770322 AGGGTGGTTCAGAATGGGAAGGG - Intronic
1028527009 7:91797646-91797668 ATGGAGACTAAAAGTGGGAAAGG + Intronic
1028538868 7:91920551-91920573 AAGGAGAATCAGACTGGGAATGG + Intergenic
1028607593 7:92671969-92671991 TTGGAGACTCAGAAAGGGGGAGG + Intronic
1029373692 7:100165546-100165568 AGGGAGGCTAAGAAAGGGAAGGG + Intronic
1029805036 7:102987139-102987161 CTGGAGACTCTGAAAGGGAGAGG + Intronic
1029928469 7:104344418-104344440 TTGGAGATTCAGAAGGGGAAGGG - Intronic
1030255151 7:107502170-107502192 TTGGAGATTCAGAAGAGGAAGGG - Intronic
1030401495 7:109057235-109057257 CTGGAGACTCAGAAGGAGAGAGG - Intergenic
1030825230 7:114147831-114147853 GTGGAAACCCAGATTGGGAAGGG + Intronic
1030991544 7:116307143-116307165 ATGGAGACTTAGAAGGGTGATGG + Intronic
1031003674 7:116447250-116447272 TTGGAGACTCAGAAGAGGGAGGG + Intronic
1033194477 7:139315784-139315806 ATGGAGGCTCAGGCTGGGCATGG + Intergenic
1033582858 7:142752581-142752603 TGGGAGCCTCAGCATGGGAAGGG - Intronic
1033585883 7:142774066-142774088 TGGGAGCCTCAGCATGGGAAGGG - Intergenic
1034137881 7:148788129-148788151 ATGGGGCCTCACAATGGGATTGG - Intronic
1035023734 7:155813665-155813687 ATGGCGATTGAGAAGGGGAAGGG - Intergenic
1035138666 7:156734479-156734501 ATGGAGAGTCAGAAGGGAGAGGG + Intronic
1035317816 7:158007616-158007638 ATGAAGACACAGAAGGGGACAGG + Intronic
1035343219 7:158178354-158178376 TTGGAGACTCAGAAGCGGGAGGG - Intronic
1035543755 8:462732-462754 TTGGAGACTCAGAAGAGGGAAGG + Intronic
1036125976 8:6062270-6062292 CTGGAGACACAGAAAGAGAAAGG + Intergenic
1036576805 8:10035152-10035174 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1038167547 8:25100461-25100483 ATGGAGCCCAAGAATGGGCAGGG - Intergenic
1038333249 8:26626431-26626453 ATGGAGACACAGAATGGTAAAGG - Intronic
1039098347 8:33911922-33911944 ATGAAGACTCAGAAGGGTGAGGG + Intergenic
1039208294 8:35182250-35182272 TTGCAGACTCAGAATGGGGGAGG + Intergenic
1040405186 8:47094743-47094765 TTGGAGACTCAGAAGAAGAAAGG + Intergenic
1040406214 8:47105751-47105773 AGGGATACTGATAATGGGAAAGG + Intergenic
1040719859 8:50306051-50306073 TTAGAGACTCAGAAGGGGGAGGG - Intronic
1040723697 8:50356085-50356107 ATGGAAAATCAGAATTGCAAGGG - Intronic
1040858093 8:51970768-51970790 TTGTAGACTCAGAAGTGGAAGGG - Intergenic
1041100208 8:54389196-54389218 GTGGAGACAAAGAATGGAAATGG - Intergenic
1041626258 8:60030773-60030795 ATGTAGGCCCAGACTGGGAAGGG + Intergenic
1041918302 8:63157864-63157886 ATGGGGAGTCAGAAAGGGGATGG + Intergenic
1041937351 8:63348477-63348499 TTGGAGACTCAGAAGAGGCAAGG - Intergenic
1042179067 8:66066709-66066731 TCGGAGACTCAGAAGGGGGAGGG + Intronic
1042784496 8:72533329-72533351 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1043355146 8:79403049-79403071 ATGGGGACTCAGAGTAGAAATGG - Intergenic
1043355621 8:79408858-79408880 TTGGAGACTCAGAAGGGGAGAGG - Intergenic
1043366521 8:79539454-79539476 TTGGAGACTCAGAAGGGTAGTGG - Intergenic
1043367596 8:79553275-79553297 TTGGAGACTCAGAAGGGGAAGGG + Intergenic
1043736315 8:83749771-83749793 TTGGAGACTCAGAAGGGTAAAGG - Intergenic
1044210773 8:89547938-89547960 AGCTAGATTCAGAATGGGAAAGG - Intergenic
1044415804 8:91938059-91938081 ATTTAGACCAAGAATGGGAAAGG - Intergenic
1044879529 8:96709252-96709274 TTGGAGACTCAGAAGCGGAGAGG - Intronic
1046044242 8:108945177-108945199 ATGGAGACTTAGAATTTGCAAGG - Intergenic
1046232951 8:111381475-111381497 TTGGAGACTCAGAAGGGGGCAGG - Intergenic
1046238964 8:111465187-111465209 TTAGAGACTCAGAATGTGGAGGG + Intergenic
1046438727 8:114230671-114230693 AAAGAGACTCTGAGTGGGAAGGG - Intergenic
1046905405 8:119567052-119567074 AGGGAGTCTCAAAATAGGAATGG - Intronic
1046975836 8:120276345-120276367 TTGGAGACTCAGAGTGGGGAGGG + Intronic
1047379629 8:124347421-124347443 TTGGAGACTTAGAATGGAAGAGG + Intronic
1047633817 8:126737490-126737512 TTAGAGACTCAGAAGGAGAAGGG - Intergenic
1048039210 8:130709173-130709195 ATGGAGAATTAGAATGAGGAGGG + Intergenic
1048325682 8:133437146-133437168 ATAGAGGATCAGAATAGGAAAGG + Intergenic
1049101102 8:140579712-140579734 ATAGAGACTGAGAAGGAGAACGG + Intronic
1049790384 8:144469721-144469743 GTGGACACCCAGACTGGGAAGGG - Intronic
1052551488 9:29955834-29955856 ATGGAGACTCAGAATGGGGAGGG - Intergenic
1052768674 9:32667751-32667773 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1052825526 9:33171302-33171324 CTGGAAACTCAGAATGGGTTGGG + Intergenic
1052901597 9:33798633-33798655 TGGGAGCCTCAGCATGGGAAAGG - Intronic
1053107380 9:35422982-35423004 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1053269861 9:36742596-36742618 AGGGAGGCACAGAATGGGAGAGG - Intergenic
1053361023 9:37486592-37486614 AGGGAGTGTCAGAATGGGGATGG - Intronic
1053487411 9:38470431-38470453 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1053524852 9:38818032-38818054 CTGGAGACTCAGAAGCGGGAGGG - Intergenic
1053525064 9:38820818-38820840 TTGGAGACTCAGAAGGGGAAGGG - Intergenic
1053672999 9:40388733-40388755 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1053750139 9:41245072-41245094 ATGGAGACTCAGCAGGGTGAGGG - Intergenic
1053922809 9:43015102-43015124 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1054197086 9:62042448-62042470 CTGGAGACTCAGAAGCGGGAGGG - Intergenic
1054197295 9:62045240-62045262 TTGGAGACTCAGAAGGGGAAGGG - Intergenic
1054255638 9:62809411-62809433 ATGGAGACTCAGCAGGGTGAGGG - Intergenic
1054335673 9:63806196-63806218 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1054384108 9:64528799-64528821 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1054511626 9:65987550-65987572 TTGGAGACTCAGAGCGGGGAGGG + Intergenic
1054641114 9:67543442-67543464 TTGGAGACTCAGAAGGGGAAGGG + Intergenic
1054641322 9:67546246-67546268 CTGGAGACTCAGAAGCGGGAGGG + Intergenic
1055340091 9:75272403-75272425 TTGGAAACTCAGAAGGGGGAAGG - Intergenic
1055370626 9:75594426-75594448 ATGGAGAATAAGAATAGGAAAGG - Intergenic
1055929947 9:81549826-81549848 ATGGGGACTGAGAATGCAAAAGG + Intergenic
1056113435 9:83419122-83419144 TTAGAGACTCGGAAGGGGAAGGG + Intronic
1056819924 9:89832831-89832853 TTAGAAACTCAGAAGGGGAAGGG + Intergenic
1057635487 9:96762044-96762066 TTGGAGACTTAGGGTGGGAAGGG + Intronic
1057741848 9:97718924-97718946 ATTGAGACCCAGACTGGGAAAGG - Intergenic
1057851544 9:98570545-98570567 ATGGAGACAGAGCATGGGAAAGG - Intronic
1057889877 9:98861808-98861830 ATTGAGACTCAGAGAGGGTAAGG + Intergenic
1057908316 9:98999254-98999276 AATGAGACTGAGACTGGGAAGGG - Intronic
1058030011 9:100185707-100185729 TTGGGGACTCAGAAAGGGGAAGG - Intronic
1058201609 9:102049062-102049084 ATAGTGAATCAGAATTGGAAAGG + Intergenic
1058402718 9:104636508-104636530 GTGGAGACTCAGAAATGGAGAGG - Intergenic
1058463933 9:105209617-105209639 ATGGAGACTCAGAAGGAGAAGGG - Intergenic
1058587462 9:106525602-106525624 CTGGAGACTCAGAAGGGGGTGGG + Intergenic
1058728499 9:107826529-107826551 AGCGAGACTCGGAAAGGGAAAGG - Intergenic
1059302017 9:113321422-113321444 GTGGAGAATCAGAGTGGGAATGG + Intronic
1061074805 9:128334607-128334629 ATGGGGACTCAGAGAGGGGAAGG - Intergenic
1061707189 9:132462169-132462191 TTGGAGTCGCAGAAAGGGAATGG + Intronic
1203371924 Un_KI270442v1:315169-315191 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1185926441 X:4152321-4152343 TTGGACACTCAGAAGGGGGAGGG - Intergenic
1186638545 X:11430890-11430912 ATGGACACTCAGAAGGGCAGTGG - Intronic
1186703796 X:12120502-12120524 ATATAGCCTCAGAATGGGATTGG + Intergenic
1186835861 X:13437159-13437181 TTGGAGACTCAGAAGGGTGAGGG + Intergenic
1187080287 X:15979042-15979064 CTGGAGACTCAGAAAGGGGGAGG + Intergenic
1187586657 X:20669993-20670015 TTGGATACTCAGAAGGGGGAAGG - Intergenic
1187660003 X:21534095-21534117 CTGGAGGCTGAGAATGGGAGGGG - Intronic
1187675276 X:21710387-21710409 TTAGAGCCTCAGAAGGGGAAGGG + Intronic
1188072349 X:25732082-25732104 ATGGAACCCCAGTATGGGAAAGG - Intergenic
1188158741 X:26774966-26774988 ATGGAGACTCAGAAAGGGGAAGG + Intergenic
1188206828 X:27370206-27370228 TTGGAGACTCAGAAACAGAAGGG + Intergenic
1188607450 X:32049527-32049549 ATGGAGACTCTGAAGGGATAAGG - Intronic
1189167478 X:38874955-38874977 TTGAAGACTCAGAATGGGGGAGG - Intergenic
1189538777 X:41964640-41964662 GTGGAAACTCATAATGGGATTGG + Intergenic
1189817645 X:44839988-44840010 TTGGAGACTCATAATGGGCGAGG + Intergenic
1189821131 X:44871591-44871613 ATGGAGTATCATAAAGGGAAAGG + Intergenic
1190056340 X:47183215-47183237 ATGGAGACTCAAAAGGTGGAGGG + Intronic
1190681409 X:52830047-52830069 AGGGAGACTCAGAGGGAGAAGGG - Intergenic
1190998502 X:55636087-55636109 AGGGAGACTCAGAGGGAGAAGGG - Intergenic
1191673177 X:63768135-63768157 TTGGAGACTCAGAAGGGGAAGGG - Intronic
1192049627 X:67712212-67712234 ATTGAGACCCAGAAGGGGAAGGG - Intronic
1192058408 X:67797531-67797553 TTGGAGACTAAGAAGGGGGAGGG + Intergenic
1192554539 X:72079455-72079477 ACTGAGGCTCAGAAAGGGAAAGG - Intergenic
1192884445 X:75321994-75322016 TTGGAGACTGAGAAGGGGTAGGG - Intergenic
1193187515 X:78530448-78530470 TTAGAGACTCAGAAGGGGGAGGG - Intergenic
1193218303 X:78891576-78891598 ATGGAGACTTAGAATGATAAGGG + Intergenic
1193470943 X:81902571-81902593 TTGGAGACTCAGAAGGGGGAGGG - Intergenic
1193885267 X:86976489-86976511 ATGTGGTCTCAGAATGGGCATGG - Intergenic
1193979184 X:88159897-88159919 ATGGAGACTCAGAATGATGGTGG - Intergenic
1194088515 X:89558244-89558266 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
1194695109 X:97038013-97038035 CTGGAGACTCAGAAGGGGGTAGG - Intronic
1194903188 X:99540672-99540694 ATGGAGTCCCAGAAGGAGAAAGG + Intergenic
1195010283 X:100726931-100726953 ATGGAGACTCAGAAGGGTGAGGG - Intronic
1195623811 X:106986744-106986766 ACAGAGACTAAGAATTGGAAGGG - Intronic
1195740082 X:108056037-108056059 ACAGAGACTCACAAAGGGAAAGG - Intronic
1196731717 X:118947582-118947604 ATGGAGAATCAGGCTGGGCATGG + Intergenic
1196796847 X:119508749-119508771 CTAGAGACTCAGAAAGGGGAGGG - Intergenic
1197163299 X:123347612-123347634 ATGGAGCCTCCGAGTGGGGAGGG - Intronic
1197176441 X:123491155-123491177 GAGGAGACAAAGAATGGGAATGG - Intergenic
1197618410 X:128719967-128719989 ATGGAGACTCAGAAGGAGGATGG - Intergenic
1197645952 X:129016681-129016703 TTGGAGACTCAGAAGGGGGTAGG - Intergenic
1198036985 X:132810600-132810622 GTGGAGATTCAGAGTGGGAGGGG - Intronic
1198417189 X:136432612-136432634 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1198661753 X:138976533-138976555 ATAAAGACTCAGAAGGGGGATGG + Intronic
1198676451 X:139136354-139136376 TTAGAGACTCAGAACGGGGAGGG - Intronic
1199078096 X:143546956-143546978 TTAGAGACTCAGAAGGGGGAAGG + Intergenic
1199110821 X:143931843-143931865 TTGGAGATTCAGAAGGGGAAGGG - Intergenic
1199242274 X:145561180-145561202 TTGGAGACTTAGAAGGGGAAGGG + Intergenic
1199277298 X:145961498-145961520 AAGTACACTCAGAAGGGGAATGG + Intergenic
1199326733 X:146507430-146507452 TTGGAGAATCAGAAGGGGAGAGG + Intergenic
1199799361 X:151234238-151234260 ATGGAGGCTGGGAAGGGGAAGGG + Intergenic
1200282050 X:154785241-154785263 ATGGACACTCAGAGAGTGAAGGG - Intronic
1200289983 X:154862560-154862582 ATGGACACTCAGGAGGGGAGAGG - Intronic
1200353995 X:155528489-155528511 CTGGAGACTCAGAAGGGGAGAGG - Intronic
1200441191 Y:3214291-3214313 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
1200491400 Y:3827990-3828012 TTGGAGATTCAGAAGGGGGAAGG + Intergenic
1201066423 Y:10099957-10099979 ATGGAGACTCAGGAGGGTGAGGG - Intergenic
1201398708 Y:13578624-13578646 TTGGAAACTCAGAATAGGGAAGG + Intergenic
1201761461 Y:17543930-17543952 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1201840091 Y:18362060-18362082 ATGGAGACTCAGCAGGGTGAGGG - Intergenic
1202117356 Y:21482454-21482476 ATGGGGACCCAGAAGGGAAATGG - Intergenic
1202168240 Y:22014955-22014977 ATGCAGACTCAGATGTGGAAGGG + Intergenic
1202223121 Y:22571413-22571435 ATGCAGACTCAGATGTGGAAGGG - Intergenic
1202319994 Y:23624247-23624269 ATGCAGACTCAGATGTGGAAGGG + Intergenic
1202550774 Y:26045809-26045831 ATGCAGACTCAGATGTGGAAGGG - Intergenic