ID: 933300349

View in Genome Browser
Species Human (GRCh38)
Location 2:80533620-80533642
Sequence GCATTGCCAGAGATGGATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 142}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933300344_933300349 2 Left 933300344 2:80533595-80533617 CCGGATGGTTCAGTGCAGCCCTC 0: 1
1: 0
2: 0
3: 14
4: 133
Right 933300349 2:80533620-80533642 GCATTGCCAGAGATGGATCCTGG 0: 1
1: 0
2: 0
3: 9
4: 142
933300342_933300349 19 Left 933300342 2:80533578-80533600 CCGTTAAATGTCAAGCACCGGAT 0: 1
1: 0
2: 0
3: 6
4: 52
Right 933300349 2:80533620-80533642 GCATTGCCAGAGATGGATCCTGG 0: 1
1: 0
2: 0
3: 9
4: 142
933300340_933300349 28 Left 933300340 2:80533569-80533591 CCTTGGCTTCCGTTAAATGTCAA 0: 1
1: 0
2: 1
3: 9
4: 102
Right 933300349 2:80533620-80533642 GCATTGCCAGAGATGGATCCTGG 0: 1
1: 0
2: 0
3: 9
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933300349 Original CRISPR GCATTGCCAGAGATGGATCC TGG Intronic
904869773 1:33609206-33609228 GCTTTCCCTGAGATGGACCCCGG + Intronic
904997939 1:34645659-34645681 GCACTGCCAGAGCTGAAGCCTGG + Intergenic
906324662 1:44837731-44837753 GTATTGCCAGAGATAGAACAAGG + Intronic
907383730 1:54111833-54111855 GCCTTGCCAGAGAGGGAGGCCGG - Intronic
907844401 1:58190743-58190765 GCATTTCCAAAGATGTTTCCTGG - Intronic
913322696 1:117600264-117600286 ACAGAGCCAGGGATGGATCCCGG + Intergenic
918139695 1:181709928-181709950 GCATTGCTAGAGGTGGCTTCTGG + Intronic
919459019 1:197854730-197854752 ACTTTGCCAGAGATGCCTCCTGG - Intergenic
924478349 1:244402347-244402369 GCATTGCCAGTGTGGGACCCTGG - Intergenic
1064375126 10:14788623-14788645 GCATTGTCAGGGATGGTTCTCGG + Intergenic
1069519550 10:69107797-69107819 GCAAGGTCAGAGATGTATCCAGG + Intergenic
1076622976 10:131804632-131804654 TCACGTCCAGAGATGGATCCTGG - Intergenic
1081646111 11:44791729-44791751 GCGTTGCCAGAGAGGGCTCACGG + Intronic
1087017449 11:93567690-93567712 TCATTGCCAGAGCTGGATTTTGG + Intergenic
1089412558 11:118258654-118258676 GCATTGCTAGAGGTGGGGCCTGG + Intronic
1089931459 11:122317630-122317652 TCATAGCCAGAGATGTTTCCTGG - Intergenic
1095742348 12:45621192-45621214 CCATTGCCATAGAGGGAGCCTGG + Intergenic
1100472768 12:94908475-94908497 GAATTGCCATAGATTGACCCAGG - Intronic
1104736305 12:131137760-131137782 GCAAGGCCTGAGGTGGATCCCGG + Intronic
1105607766 13:21941481-21941503 GCATTTTCCAAGATGGATCCTGG + Intergenic
1106601161 13:31188232-31188254 ATCATGCCAGAGATGGATCCAGG + Intergenic
1107596334 13:41966650-41966672 GCTTTGTCAGAGATGGATATAGG + Intergenic
1110884121 13:80611270-80611292 GCATTGCCACAGTTTGTTCCTGG - Intergenic
1112799636 13:103096366-103096388 CCATTGTCAGTGAAGGATCCTGG - Intergenic
1113422359 13:110180501-110180523 ACGTTGCCAGTGATGGACCCAGG - Intronic
1114529941 14:23389314-23389336 TCAGTGCCAGAAATGGAGCCTGG - Intronic
1118369515 14:65125535-65125557 GCATAGCCAGAGCTGGAGCAAGG + Intergenic
1118865365 14:69698985-69699007 GAATTGTCAGAGAATGATCCTGG + Intronic
1119781066 14:77277232-77277254 GCACTCCCAGAGCTGGGTCCTGG + Exonic
1120094748 14:80375934-80375956 GAATTTCTGGAGATGGATCCAGG + Intronic
1121253627 14:92516415-92516437 GCAGGGCCAGTGATGGATTCAGG + Intronic
1125874677 15:43133683-43133705 GCAGGGCCAGAGCTGGATGCGGG - Exonic
1126343916 15:47673458-47673480 GCATTCCCAGACGTGGATTCTGG - Intronic
1128802975 15:70508768-70508790 CCATTCCCAGAGATGCATTCTGG + Intergenic
1129253810 15:74322803-74322825 GGCCTGCCAGCGATGGATCCTGG + Intronic
1129512524 15:76135360-76135382 ACATGGCCAGAGATGGTGCCGGG + Intronic
1130300350 15:82675883-82675905 GCATCTCCTGAGATGGTTCCAGG - Intronic
1133386122 16:5371739-5371761 GCATTTCCGGAGATGGTCCCTGG + Intergenic
1135575856 16:23585069-23585091 GAATGACCAGAGATGGTTCCAGG - Intronic
1136549691 16:30976407-30976429 GCCTTGCCAGAGCTGGGGCCTGG + Intronic
1137815989 16:51397843-51397865 GGAATGCGAGAGATGGATCTTGG + Intergenic
1138337566 16:56265282-56265304 GCATGGCCAGAGATGACTTCAGG - Intronic
1139330463 16:66185023-66185045 ACATTGCCAACAATGGATCCAGG - Intergenic
1139974751 16:70800764-70800786 GCATAGCCAGGGAGGGGTCCTGG + Intronic
1142371894 16:89687070-89687092 GCAGCGCCCGAGCTGGATCCCGG - Intronic
1143684641 17:8504097-8504119 ACATGGCCAGAGAAGGCTCCTGG - Intronic
1144599721 17:16601063-16601085 GACTTGCCAAAGATGGGTCCAGG - Intergenic
1144785064 17:17826952-17826974 ATATTGTCAGAGATGGATCTGGG - Intronic
1147250355 17:39149567-39149589 GCTTTGACAGAGATTGAGCCAGG - Intronic
1148770444 17:50063186-50063208 GCATCCCCAAAGATGGATTCTGG + Intronic
1150375339 17:64676714-64676736 GCATCTCCAGGGATGGAGCCTGG + Intergenic
1151487436 17:74410024-74410046 GCAGAGCCACAGCTGGATCCAGG - Intergenic
1152161783 17:78673351-78673373 TAATTGACAGAGATGGATCCAGG + Intergenic
1154316030 18:13304045-13304067 GCACCGCCAGGGGTGGATCCAGG + Intronic
1155207377 18:23572149-23572171 ACATTGCCAAAGAAGAATCCTGG + Exonic
1155268915 18:24120632-24120654 GAAGTTCCAGAGATGGATGCTGG - Intronic
1155436614 18:25819199-25819221 GCACTGGCAGAGCTGGATTCTGG - Intergenic
1156949696 18:42880234-42880256 GTATTTCCAGAGATGGAGTCAGG - Intronic
1159420185 18:68208445-68208467 ACATGGCCAGAGAGGGATCAAGG + Intergenic
1162787664 19:13045776-13045798 CCAGTGCAAGAGCTGGATCCAGG + Intronic
1166636149 19:44453206-44453228 GCATTGCCAGATATCTATCGGGG - Intergenic
1167037629 19:47003451-47003473 GCAAAGCCAGAGACTGATCCTGG + Exonic
1167562050 19:50231851-50231873 GGATTGCCACCGATGAATCCAGG + Intronic
926487839 2:13484977-13484999 GCAGAGCCAGAAATGAATCCTGG - Intergenic
926676909 2:15632592-15632614 GCAAGGCCAGAGAGGAATCCTGG + Intergenic
932485397 2:72081479-72081501 GCATGGCCAGATATCCATCCAGG - Intergenic
932883224 2:75523641-75523663 TCATTTCCAGAGATGTATCCTGG + Intronic
933300349 2:80533620-80533642 GCATTGCCAGAGATGGATCCTGG + Intronic
935232547 2:101111498-101111520 GCATTGCAAGGGAGGGATGCTGG + Intronic
936257334 2:110928076-110928098 TCCTTGCCTGAGATGCATCCTGG - Intronic
937979967 2:127609092-127609114 GCATTGGTAGAGAAGGCTCCAGG - Intronic
938900408 2:135794598-135794620 CCTTTTCCAGAGATGGCTCCGGG + Intronic
940662351 2:156562309-156562331 TCATTGCCAGAGATTGTACCAGG + Intronic
942227773 2:173831959-173831981 GCATTGCCAGAGCCAGCTCCTGG - Intergenic
946189298 2:217999445-217999467 GCAATGCCTGGGCTGGATCCCGG - Intronic
946463589 2:219891538-219891560 GCATGGCCAGAGAGGGATTGAGG + Intergenic
947337735 2:229104684-229104706 GGATTCCCAGACATGGAACCTGG + Intronic
1175265564 20:57701408-57701430 GCATTGCCAGAGCTTGCTGCAGG - Intronic
1175667365 20:60871773-60871795 GGATTGGCAGAGAGGGCTCCAGG - Intergenic
1176334921 21:5587458-5587480 GCCCTGCCAGAAAAGGATCCAGG - Intergenic
1176392836 21:6233490-6233512 GCCCTGCCAGAAAAGGATCCAGG + Intergenic
1176405130 21:6355989-6356011 GCCCTGCCAGAAAAGGATCCAGG - Intergenic
1176432027 21:6633115-6633137 GCCCTGCCAGAAAAGGATCCAGG + Intergenic
1176468583 21:7082684-7082706 GCCCTGCCAGAAAAGGATCCAGG - Intronic
1176492144 21:7464462-7464484 GCCCTGCCAGAAAAGGATCCAGG - Intergenic
1176508498 21:7673921-7673943 GCCCTGCCAGAAAAGGATCCAGG + Intergenic
1178101408 21:29272283-29272305 GCTTTGCCAGAAATTGAGCCAGG - Intronic
1178389723 21:32188408-32188430 ACATTGCAAGAGAGGGACCCTGG + Intergenic
1178417282 21:32413822-32413844 GCCTTGCCAGAGGGAGATCCAGG - Intronic
1181992368 22:26847196-26847218 GTTTTGACAGAGAGGGATCCCGG - Intergenic
1183975589 22:41510214-41510236 ACAGAACCAGAGATGGATCCAGG + Intronic
949693650 3:6668535-6668557 TCAATGCTGGAGATGGATCCTGG + Intergenic
949802698 3:7920945-7920967 GTATTGGCAGAGATGGAGCCAGG - Intergenic
950121106 3:10483064-10483086 GGATTCCCAGAGGTGGATTCAGG + Intronic
950181260 3:10915093-10915115 ACATTGCCACAGATGGAGCGTGG + Intronic
950565243 3:13765797-13765819 CCTTTGCCAGGGATGGGTCCAGG + Intergenic
950893326 3:16424887-16424909 GCATTACCAGTGATGGGTCCTGG - Intronic
951457126 3:22905056-22905078 GCACTGCCAAAGCTGGGTCCAGG - Intergenic
954665236 3:52248044-52248066 TCATGGACAGAGCTGGATCCTGG + Intronic
956037289 3:65107935-65107957 GAACTGCCAGAGATGCTTCCAGG + Intergenic
960053706 3:113261246-113261268 TCAGAGCCAGAGCTGGATCCTGG - Intronic
961312877 3:126014974-126014996 GCAGTGCCTGAGACAGATCCAGG - Intronic
967091496 3:186138432-186138454 GCCTTCCCAGAGATGGATGCTGG - Intronic
968459796 4:718836-718858 GCCTGGCCAGAGATGGAGCAGGG + Intronic
971290186 4:25330491-25330513 GCATGGCCAGAGTTGGCTACAGG - Intronic
971929423 4:33061047-33061069 GCTTTGCCAGAGAAGGGTCTAGG - Intergenic
972010923 4:34180972-34180994 GCATGTCCAGAGATGTGTCCTGG - Intergenic
976453018 4:85213982-85214004 GCATTCCAAGAGATTTATCCTGG + Intergenic
978440682 4:108730253-108730275 GCAATGGCAGGGATGGAACCAGG + Intergenic
980742985 4:136975542-136975564 GCATTTTGAGAGATGGAGCCAGG + Intergenic
987278864 5:16391932-16391954 GGATTGTCAGAGATGGATCAGGG - Intergenic
996757528 5:126950192-126950214 GAGTTGACAGAGTTGGATCCTGG - Intronic
997585195 5:135039684-135039706 CCAGAGCCAGAGCTGGATCCGGG - Intronic
999197256 5:149790876-149790898 TCCCTGCCAGAGATGGATTCAGG + Intronic
1002043191 5:176528892-176528914 GCATTTCCAGAGCTGGTGCCAGG - Exonic
1002416583 5:179123990-179124012 GCATTGCCACACATGGGTGCAGG + Intronic
1003264293 6:4551968-4551990 GCATTGCCTGAAAAGGATCCCGG - Intergenic
1004214440 6:13688580-13688602 GGATTGACAGAGATGGAGACAGG - Intronic
1005706006 6:28454017-28454039 GGGATGTCAGAGATGGATCCAGG - Intergenic
1007993832 6:46285288-46285310 CTATTTCCAGAGATGGAGCCTGG + Intronic
1008067190 6:47062084-47062106 GCATTGCAGGAGAAGGACCCTGG + Intergenic
1012672506 6:102073181-102073203 GCATTACCATAGATTAATCCAGG + Intergenic
1015754962 6:136597649-136597671 GCATTGCAAGAGATCCATGCAGG + Intronic
1017775963 6:157681008-157681030 GAATTGCCAGAGAGGGAGACAGG - Intergenic
1019365890 7:632587-632609 GCCTTGGTACAGATGGATCCAGG + Intronic
1019784250 7:2964363-2964385 GCATTGCAAAAGATGGAACGTGG - Intronic
1021372076 7:19861551-19861573 TCAGTGCCAGATATGGATGCTGG - Intergenic
1023004383 7:35847334-35847356 GCATTGCCCCTGATGGATGCTGG - Intronic
1024764397 7:52640098-52640120 GCATGGCTAGAGAAAGATCCAGG + Intergenic
1025964193 7:66252950-66252972 GTATTTCCATAGATGGTTCCGGG - Intronic
1026609369 7:71844032-71844054 GCATTTATAGAGATGGACCCTGG + Intronic
1028000680 7:85494424-85494446 GCATTGCCAGCTGTGGGTCCTGG - Intergenic
1028743921 7:94306589-94306611 GCCCTGGCAGAGATGGGTCCAGG + Intergenic
1029039270 7:97555993-97556015 GAAGAGCCAGGGATGGATCCAGG + Intergenic
1033843615 7:145404496-145404518 CCATTGCCAGAGGTGGCACCGGG + Intergenic
1039439407 8:37584357-37584379 CCATGGCTTGAGATGGATCCTGG - Intergenic
1040604379 8:48915884-48915906 GCATTGCCAGAAATGTACACAGG + Intergenic
1041932364 8:63300819-63300841 GCACTGCCAGAGCTGGGTGCTGG + Intergenic
1043577657 8:81676580-81676602 TCATCTCCAGAGATGGATCCTGG + Intronic
1046870322 8:119198249-119198271 ACATTGCCAGAACTGGATCAAGG - Intronic
1048029262 8:130615677-130615699 GCAGTGGAAGAGATGGAGCCCGG - Intergenic
1048209650 8:132444099-132444121 GTATTGCCAGAGGTGGACCCTGG - Intronic
1052686426 9:31763854-31763876 GCACTGGCAGTGGTGGATCCTGG + Intergenic
1058935329 9:109764501-109764523 GAACTGCCAGAGAAGGGTCCAGG - Intronic
1061759866 9:132843162-132843184 CCATTGCTAGAGGTGGAGCCTGG + Intronic
1203426717 Un_GL000195v1:47461-47483 GCCCTGCCAGAAAAGGATCCAGG + Intergenic
1203439512 Un_GL000195v1:175597-175619 GCCCTGCCAGAAAAGGATCCAGG - Intergenic
1186230377 X:7447194-7447216 GCATTGTCTGAGATGAAGCCTGG + Intergenic
1189055668 X:37697175-37697197 CAATTTCCAGAGATGAATCCTGG - Intronic
1190395202 X:49975357-49975379 GAATTACCAGAGATGGATATAGG + Intronic
1200773106 Y:7145437-7145459 GAATTTCCAGAGATGGATGGTGG + Intergenic
1201070618 Y:10144586-10144608 GCACAGCCAGAGATGGAGCTTGG - Intergenic