ID: 933301134

View in Genome Browser
Species Human (GRCh38)
Location 2:80542707-80542729
Sequence CAGCAAGCAGGGATGGTACG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 126}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933301134 Original CRISPR CAGCAAGCAGGGATGGTACG GGG Intronic
900766473 1:4509351-4509373 CAGCAAGCAGGGCTGGCCCGAGG + Intergenic
902247195 1:15128820-15128842 CAGCTGGCAGGGATGGTGGGGGG - Intergenic
905074416 1:35257226-35257248 CAGCAATAAGGGAAGGTATGCGG - Intergenic
906837376 1:49098543-49098565 CAGGAAGCAGGGATTCTAAGAGG + Intronic
910874658 1:91867295-91867317 CAGTACGCACAGATGGTACGAGG + Intronic
911646661 1:100344176-100344198 GAGCAAGGCGGGAGGGTACGTGG - Intergenic
913452647 1:119002436-119002458 CAGCAAGCAGGGAAAGTAGCCGG - Intergenic
919611649 1:199752427-199752449 AAGCAAGCAGGAATTGTACAGGG + Intergenic
921081130 1:211739081-211739103 CAGCAAGCAGGGGTGCTCAGAGG - Intergenic
924919740 1:248615747-248615769 CTGCAAGCAGGGATAGTTTGAGG - Intergenic
1065127424 10:22587049-22587071 CAGCAATCTGGGATGGCAGGTGG - Intronic
1069550319 10:69359823-69359845 CAGGAAGCGGGCATGGTATGTGG + Intronic
1070720504 10:78753684-78753706 GAGCAAGCAGGGATGCTGGGAGG + Intergenic
1077273408 11:1692373-1692395 CAGCAACCGGGGATGGGAAGGGG - Intergenic
1078530357 11:12132123-12132145 CAGGAAGCAGAGGTGGTAGGAGG - Intronic
1079632547 11:22695457-22695479 CAGGAAACAGGGAGGGTACATGG - Intronic
1080433992 11:32223282-32223304 CAGCGGGCAGGGATGCTATGAGG + Intergenic
1080853805 11:36094163-36094185 AAGCAAGCAGTGATGGTGCCAGG - Intronic
1083366384 11:62143907-62143929 CAGCCAGCAGGGATGGGCAGGGG - Intronic
1084534149 11:69746926-69746948 CAGCAAGCAGAGAGGGAAGGTGG - Intergenic
1084548276 11:69825374-69825396 CAGCCACCTGGGCTGGTACGTGG + Intergenic
1088256595 11:107909076-107909098 CAGCAAGAAGAGATGATAAGAGG - Intronic
1090420789 11:126573482-126573504 CAGCAAGGAGGGAAAGTAGGCGG + Intronic
1094225514 12:28040786-28040808 TAGCAAGTAGGGATGGTGGGAGG + Intergenic
1101841313 12:108329276-108329298 CAGGAAGCAGGGATGGCAGGAGG - Intronic
1102247196 12:111362935-111362957 CAGAAGGCAGGGATGGGACTGGG + Exonic
1104406334 12:128520230-128520252 GAGCATGCAGGGGTGATACGTGG - Intronic
1105533632 13:21243511-21243533 CAGAAAGCAGAGATGGGAGGAGG + Intergenic
1105853404 13:24355376-24355398 CAGCAGGCAGGCATGGTCAGAGG + Intergenic
1106689470 13:32098420-32098442 CACCTAGCAGGGATGGTGCTCGG + Intronic
1112870713 13:103967726-103967748 CGGCCAGCAGGGATGGTGCTCGG + Intergenic
1113456803 13:110455172-110455194 CATCAAGGAGGGAGGCTACGCGG - Intronic
1113804334 13:113104550-113104572 CAGCAAGCAGGGAGGCTTTGGGG + Intergenic
1114183510 14:20383684-20383706 AAAAAAGCAGGGGTGGTACGTGG + Intronic
1119889874 14:78174709-78174731 CAAGAAGCAGGGATGGTCAGTGG + Intergenic
1122830745 14:104394456-104394478 CAGCAAGCAGGACTGTTGCGGGG - Intergenic
1122903459 14:104791468-104791490 CAGCTACCAGTGATGGCACGCGG - Intronic
1123486896 15:20748847-20748869 CATTAAGCAGGTGTGGTACGTGG - Intergenic
1123757504 15:23408309-23408331 CAACAAGCAGGGGTGGGACTTGG + Intergenic
1124658353 15:31526263-31526285 CAGCATGGGGGGATGGCACGGGG - Intronic
1125602545 15:40923497-40923519 CAGCAAGCAGGGAGGCTCAGGGG - Intergenic
1128539470 15:68516324-68516346 CAGGAAGCAGAAATGGTATGGGG + Intergenic
1129463442 15:75711308-75711330 CAGCATGCAGGCATGGTGCTAGG - Intronic
1129721445 15:77880094-77880116 CAGCATGCAGGCATGGTGCTAGG + Intergenic
1202951704 15_KI270727v1_random:45030-45052 CATTAAGCAGGTGTGGTACGTGG - Intergenic
1132882318 16:2167921-2167943 AAGCATGCAGGGATGGCACGGGG - Intronic
1134015151 16:10883058-10883080 CAGCAAGCAGGACTGGCTCGTGG + Intronic
1136025535 16:27465892-27465914 CAGCAGGAAGGGATGGGACCAGG - Intronic
1147110431 17:38257318-38257340 CAGCAAGGAGGGATGGAGAGGGG + Intergenic
1147797991 17:43059539-43059561 CAGGAAGCAGGAATGGAACCAGG - Intronic
1150637105 17:66921098-66921120 CAGCAAGAAGGGAAGGTGCAGGG - Intergenic
1151732567 17:75920128-75920150 CAGCAACCAGGGAGGGGAGGTGG + Intronic
1155605639 18:27602462-27602484 CAGCAAGCAGGGCAGGGACAGGG + Intergenic
1157317904 18:46608713-46608735 CAGCAAGCCTGGAGGGTACCAGG - Intronic
1158425299 18:57334587-57334609 CAGCAAGCACAGAAGGTGCGGGG - Intergenic
1159005437 18:63006114-63006136 CATCATGCAGAGATGGTACAAGG - Intergenic
1160678221 19:401552-401574 CAGCAGGCAGGGAGGGTACAGGG + Intergenic
1162826091 19:13253132-13253154 CAGCGAGCAGGGGTGGGAAGTGG + Intronic
1163612826 19:18309957-18309979 CAGCTTGCAGGGGTGGTACGGGG - Intronic
1163677251 19:18661267-18661289 CAGCAAGCAGAGAGGGTGCCCGG - Intronic
1164618842 19:29681928-29681950 CAGCAGGCAGGGAAGGAATGGGG + Intergenic
1164747647 19:30627989-30628011 CGGGAAGCAGGGGTGGTACGGGG - Intronic
1166310361 19:41959060-41959082 CAGCAGGCAGGGAGGGGACTAGG + Intronic
1167575417 19:50315418-50315440 CAGCAAGGCGGGATGGTGGGCGG + Intronic
1168376686 19:55885763-55885785 CAGCAAGCAGGGTGGGTAAAAGG + Intergenic
926640518 2:15230846-15230868 GAGCAGGCAGAGATGCTACGTGG - Intronic
926795997 2:16619201-16619223 CAGCCAGCAGGGGTGATAGGAGG + Intronic
933301134 2:80542707-80542729 CAGCAAGCAGGGATGGTACGGGG + Intronic
934540956 2:95174642-95174664 CAGCAGGGAGGGATGGAAGGAGG - Intronic
935207711 2:100910897-100910919 CAGCATGCAGGGATGCTGCCTGG + Intronic
939103339 2:137921166-137921188 CAAGAAGCAGGGATGGTACTAGG + Intergenic
941875746 2:170430997-170431019 GAGCAATCAGGGATGGTCCTGGG - Intronic
947012163 2:225578329-225578351 CACCAAGCAGGGAAGGGAAGAGG + Intronic
948595822 2:239078763-239078785 CCGCCAGCAGGGATGCCACGGGG + Intronic
948947091 2:241226216-241226238 CACCAAGCAGAGATGGAACTGGG + Intergenic
1171865856 20:30487241-30487263 CAAGAAGCAGGGATGGGCCGTGG + Intergenic
1175974142 20:62701950-62701972 CAGCAAGCTGGGGAGGGACGTGG + Intergenic
1176519252 21:7812519-7812541 CAACAAACAGGGGTGGTACCTGG - Intergenic
1176673773 21:9758104-9758126 CAGGAAGAAGGGATGAGACGGGG - Intergenic
1178653280 21:34442532-34442554 CAACAAACAGGGGTGGTACCTGG - Intergenic
1178971100 21:37177623-37177645 CAGGCAGAAGGGATGGTACTGGG - Intronic
1179174256 21:38995948-38995970 AAGCAAGCAGGGAGGGGCCGGGG - Intergenic
1181453945 22:23044472-23044494 CAACAATTAGGGATGGTACTTGG - Intergenic
1183334338 22:37237997-37238019 CAGGAAGCAGGGAGGGTTCTGGG + Intronic
1184973500 22:48044623-48044645 AATAAAGCAGGGATGGTAGGGGG + Intergenic
949504495 3:4714328-4714350 CAGAAAACAGGGATGGGAGGAGG - Intronic
951350727 3:21603817-21603839 CAGTAGGCAGGGATGGTAGAAGG + Intronic
952629736 3:35452614-35452636 AAGCATGCCGGGAGGGTACGGGG - Intergenic
955788881 3:62568026-62568048 CAGGAAGAAGGGATGGCACTTGG - Intronic
961511563 3:127406913-127406935 CTGCAGCCAGGGATGGGACGTGG - Intergenic
967988873 3:195116517-195116539 CAGCAAGAAGGGAGGGAACTTGG + Intronic
968545479 4:1195590-1195612 CAGCAAGCAGGGCTGGAGGGTGG + Intronic
969397479 4:6931961-6931983 CAGCAAGCAGAGGTGGTACGAGG + Intronic
972285946 4:37648378-37648400 CAGCAAGCTGGCAAGGAACGAGG + Intronic
976208348 4:82642868-82642890 CAGAAAGAAAGGATGGGACGAGG - Intronic
985400941 4:189593567-189593589 CAGGAAGAAGGGATGAGACGGGG + Intergenic
991657022 5:68914285-68914307 CAGCAAGCAGGGCAGGTGCTCGG + Intergenic
995153754 5:108884718-108884740 CAGAAAGCAAAGATAGTACGTGG - Intronic
999967319 5:156823320-156823342 GAGGATGCAGGGATGGTACATGG - Intergenic
1002495592 5:179609305-179609327 CAGGAAGCAGGGAGGGTGTGCGG + Intronic
1003377454 6:5593032-5593054 CAGAAAGCAGAGATGGGAGGAGG - Intronic
1004346305 6:14852391-14852413 AAGCAGGCAGGGATGGAAGGAGG + Intergenic
1006176260 6:32123775-32123797 CAGCAGGGAGGGATGGAAAGTGG - Intronic
1006979860 6:38138541-38138563 CAGCCAGCAGGGCTGGAATGCGG - Intronic
1007748400 6:44057136-44057158 CAGGAACTAGGGATGGTCCGGGG - Intergenic
1009832675 6:68958272-68958294 CAGCATGCAGGGTTGTTAAGAGG + Intronic
1010397503 6:75408933-75408955 CAGCAGGCAGGGATGCCACAGGG - Intronic
1011246927 6:85329274-85329296 CAGCACACGGGGATGGTAAGTGG - Intergenic
1013081268 6:106815562-106815584 CACCAAGAAGGTATGGTATGGGG + Intergenic
1018922984 6:168188598-168188620 CAGCAAGCGGGGATGGGTGGGGG + Intergenic
1019543304 7:1560971-1560993 CAGGAGGCAGGGGTGGCACGTGG - Intergenic
1019850930 7:3556421-3556443 CAGCAAGTAGGGATGGTTAATGG + Intronic
1022496596 7:30856800-30856822 CAGCATGCAGAGCTGGTACAAGG + Intronic
1022885576 7:34639945-34639967 CAGAAAGCAAGGATGGTAATGGG - Intergenic
1023730370 7:43185949-43185971 CAGCAAGCTGGGATGGGATATGG + Intronic
1024254729 7:47532071-47532093 GAGCCAGCAGGGATGGTGGGCGG - Intronic
1024298090 7:47862386-47862408 CAGGCAGGAGGGATGGTAGGAGG + Intronic
1024990548 7:55231807-55231829 CAGTAAGGAGGGATGGACCGGGG + Intronic
1026420406 7:70230959-70230981 CAGGAAGCAGGGGTGGAACTAGG + Intronic
1027188282 7:75984384-75984406 CGGCAAGCAGGGGTGGGGCGAGG - Intronic
1032404037 7:131642932-131642954 CAGAAAACAGGGATGGCAGGAGG + Intergenic
1036149401 8:6283779-6283801 CAGCAGGCAGGGATGGGACATGG - Intergenic
1044336236 8:90987164-90987186 CAGGAAGCAGGGATGGGGGGCGG - Intergenic
1044775231 8:95679794-95679816 CAGCAAGAAGGGATGGAATAGGG - Intergenic
1046496428 8:115020151-115020173 CAGCAATCAGAGCTGGTAAGTGG - Intergenic
1046763023 8:118041242-118041264 CAGAAAGCAGAGATGGTGCAGGG + Intronic
1053225557 9:36352753-36352775 CAGTAAGCTGGGATGATAAGGGG + Exonic
1056784165 9:89577049-89577071 TGGCAGGCAGGGAAGGTACGAGG - Intergenic
1057217785 9:93238951-93238973 CAGTAAGCAGGGATGGATTGTGG + Intronic
1059360260 9:113736667-113736689 CAGGAAGCAGTGATGCTACCTGG + Intergenic
1061723378 9:132567557-132567579 CAGCATGCAGCGATGGTGGGTGG - Intronic
1062491104 9:136805308-136805330 CAGCATGCAGGGATGGCTCAGGG - Intronic
1185809227 X:3089580-3089602 CAGCAAGCATGGCTTGTATGGGG + Exonic
1187454486 X:19429270-19429292 CAGCAAGCAGGGAGTCTACTTGG + Intronic
1192542103 X:71982754-71982776 CATCAAGCAAGGAAGGTATGTGG - Intergenic
1195303906 X:103559614-103559636 CATAAAGCAGGGAGGGTAAGGGG + Intergenic