ID: 933301518

View in Genome Browser
Species Human (GRCh38)
Location 2:80546085-80546107
Sequence CTTACAAGGCAGCTGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 330}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933301508_933301518 28 Left 933301508 2:80546034-80546056 CCTCAGTGGATGACTTCCTCTCT 0: 1
1: 0
2: 4
3: 14
4: 187
Right 933301518 2:80546085-80546107 CTTACAAGGCAGCTGGAGGAGGG 0: 1
1: 0
2: 3
3: 32
4: 330
933301510_933301518 12 Left 933301510 2:80546050-80546072 CCTCTCTGTCTCAGGTAATCATC 0: 1
1: 0
2: 5
3: 39
4: 616
Right 933301518 2:80546085-80546107 CTTACAAGGCAGCTGGAGGAGGG 0: 1
1: 0
2: 3
3: 32
4: 330

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933301518 Original CRISPR CTTACAAGGCAGCTGGAGGA GGG Intronic
901275312 1:7986671-7986693 CATACCAGGCAGCAGGAGCAGGG + Intergenic
901829316 1:11882439-11882461 CTTAGGAGGCAGCTGGGGAAAGG + Intergenic
902959608 1:19953795-19953817 CACACAAGGCAGGTGGAGCAGGG - Intergenic
904385878 1:30141768-30141790 CTTGCATGGAAGCTGCAGGAGGG - Intergenic
904604291 1:31690471-31690493 CTTCCAAGGCCTCTGGAGGGAGG - Intronic
904814110 1:33182179-33182201 CTTCCCTGGGAGCTGGAGGATGG - Intergenic
905285997 1:36880770-36880792 CTTCCAACGCAGCTGGATGTGGG + Exonic
905811630 1:40917375-40917397 CGTACAAGGGGGCAGGAGGAGGG - Intergenic
906250627 1:44308209-44308231 TCTACAAGGCAGCTGGATCAGGG - Intronic
906519533 1:46458941-46458963 CTTGCCAGACAACTGGAGGAAGG - Intergenic
907079553 1:51608762-51608784 TTTATAAGGTAGGTGGAGGAAGG - Intronic
907257734 1:53192484-53192506 CTTACATGGCTGGAGGAGGAAGG + Intergenic
907923350 1:58933194-58933216 TGTCCCAGGCAGCTGGAGGAAGG - Intergenic
908671831 1:66556534-66556556 CTTGCAATGGAGCTGGAGGAGGG + Intronic
909308364 1:74112043-74112065 CTTACAAGTGATCTGGAGTAAGG - Intronic
910220974 1:84889207-84889229 CTGGCAAGCCAGCTGGAGGGTGG - Intronic
910414180 1:86981081-86981103 CTTACAAGGCAGCAGGAGAGGGG + Intronic
910605613 1:89080453-89080475 ATCACAAGGCAGTTGGAGGCAGG - Intergenic
911184224 1:94887221-94887243 CTTGTCAGGCAGCTGGAAGATGG - Intronic
912496860 1:110097489-110097511 CTTACCAGGCACCAGGAGAAGGG - Intergenic
912684693 1:111753121-111753143 CTTTCCAGGGAGCTAGAGGAGGG - Intronic
913186187 1:116372932-116372954 CATGCAGGGCAGCGGGAGGAGGG + Intronic
915318123 1:155041193-155041215 CAGACAAGGCAGCTGGTGGGGGG + Intronic
915462741 1:156079970-156079992 CTAACACTGCAGCAGGAGGAGGG + Intronic
915624946 1:157108777-157108799 TTTCCAGGGAAGCTGGAGGAGGG + Intergenic
915759003 1:158292073-158292095 CTTCAAAGGGATCTGGAGGAAGG - Exonic
917488862 1:175480155-175480177 CTGACTATGCAGCTGGAGAATGG - Intronic
917612640 1:176704060-176704082 CTTCCAAGGCAGCTGTCTGATGG + Intronic
919377745 1:196815773-196815795 CTTACAAGGGATGTGAAGGACGG - Intergenic
919986473 1:202679237-202679259 CCATCAAGGCAGCTGTAGGAAGG - Intronic
920062238 1:203235308-203235330 ATTACAAGGCAAATGGAGGCAGG - Intronic
923405572 1:233655690-233655712 CTCACAAGGCAGAAGGAGGAAGG - Intronic
923858789 1:237872128-237872150 GTTATAGGGCAGCTGGTGGAGGG + Intergenic
923893236 1:238238892-238238914 CTTGCAAGGCAACAGGAAGAGGG + Intergenic
924346590 1:243078030-243078052 ATCACAAGGCAGATGGAGGCAGG - Intergenic
1063008300 10:1996009-1996031 CTTACATGGCAGCAGGAGCGAGG - Intergenic
1063105625 10:2989206-2989228 CTTCCAAGGGACCTGGAGGGTGG - Intergenic
1063619008 10:7627726-7627748 CTTCCAGGGCATGTGGAGGAAGG + Intronic
1064156040 10:12904102-12904124 ATTTCATGGGAGCTGGAGGAGGG + Intronic
1064299590 10:14111850-14111872 CCTGCAGGGCAGGTGGAGGAGGG + Intronic
1065003750 10:21361173-21361195 CTCACAAGGCGACAGGAGGAAGG + Intergenic
1066435850 10:35396369-35396391 CTTACAACTCAGCTGTAGGGTGG - Intronic
1066664000 10:37764439-37764461 ATTACAAGGCAAATGGAGGCAGG - Intergenic
1068364267 10:56025147-56025169 TTTACAAGCCATCTGGAGGAAGG + Intergenic
1068647078 10:59479956-59479978 CTGCCTAGGCAACTGGAGGATGG - Intergenic
1068786995 10:60987564-60987586 CCTACATGGGAGATGGAGGATGG - Intronic
1070804252 10:79261466-79261488 CTTCCAGAGCAGCTGGGGGAGGG - Intronic
1072473144 10:95732885-95732907 ATTACAAGGCAAATGGAGGCAGG + Intronic
1072494666 10:95945026-95945048 CTCACATGGCAGATGGTGGAAGG - Intergenic
1074374517 10:112928273-112928295 CTGACAAAGGAGCTGGAGGCGGG - Intergenic
1076140723 10:128077020-128077042 CTGAGAAGGCACCTGGAGGAGGG - Intronic
1078127508 11:8582486-8582508 TTCACAAGGCAGCAGGAAGAGGG + Intronic
1078839288 11:15063215-15063237 ATTACAAGGCAAATGGAGGCAGG + Intronic
1078840028 11:15069733-15069755 ATTACAAGGCAAATGGAGGCAGG + Intronic
1080401205 11:31937617-31937639 CTCACAAGGCAGCAGGAGAGAGG + Intronic
1081324676 11:41729481-41729503 CTTACATGGCAGCAGCAAGAGGG - Intergenic
1081461219 11:43274472-43274494 ATTACAAGGCAAGTGGAGGCAGG + Intergenic
1084160723 11:67348325-67348347 AATACAATGCAGCGGGAGGAAGG + Intronic
1084172365 11:67406701-67406723 CTGACATGGGGGCTGGAGGAAGG + Intronic
1084694477 11:70745463-70745485 TTTTCAAGGCAGCAGGAGGAGGG - Intronic
1085818984 11:79771697-79771719 CTTACATGGCAGCAGGAGGGAGG - Intergenic
1085959233 11:81440170-81440192 CTTACATGGCAGCAGGTGGAAGG + Intergenic
1086861712 11:91932242-91932264 CATCCAGTGCAGCTGGAGGAGGG - Intergenic
1087933268 11:104002429-104002451 TTTACATGGCAGCAGGAGGCAGG - Intronic
1090390149 11:126382909-126382931 CTGGCGGGGCAGCTGGAGGAAGG + Intronic
1090487691 11:127128736-127128758 CTTTCAAGGCAGCTTCAGAAGGG - Intergenic
1090619796 11:128550310-128550332 CTACCAAGGCAGCAGGAGGTGGG + Intronic
1090804460 11:130194262-130194284 CATCCTAGGCAGCTGGAAGAAGG - Exonic
1091491325 12:935243-935265 CTAACAAGATAGCTGGAGGGAGG + Intronic
1091768610 12:3137582-3137604 CTTTCCAGCCAGATGGAGGAGGG + Intronic
1092243255 12:6848575-6848597 CTTATAAAGCAGCTGGATAAAGG + Intronic
1093074709 12:14745908-14745930 CTCACAAGGCAAATGGAGGCAGG + Intergenic
1093347929 12:18062845-18062867 ATTACAAGGCAAATGGAGGCAGG + Intergenic
1093426495 12:19034247-19034269 CTTACATGGCAGCAGGGGGAAGG + Intergenic
1093602056 12:21039333-21039355 CTTAAAAGGGAGATGGAGAAAGG - Intronic
1096004393 12:48157310-48157332 CTTAGAAGGCAGATCGAAGAGGG - Intronic
1097461953 12:59872993-59873015 CTTACATGGCAGCAGGAGAAAGG - Intergenic
1098960582 12:76735950-76735972 ATCACAAGGCAAATGGAGGAGGG - Intergenic
1099176107 12:79424196-79424218 CTTTCAAGGCAACTGGCTGAGGG - Intronic
1099652473 12:85445792-85445814 CTTCCAGGGCAGCTGCAAGAAGG + Intergenic
1099993691 12:89753586-89753608 CTTAGAGGGCAGCTGGATAACGG - Intergenic
1100335264 12:93623249-93623271 CTTACATGGCAGCAGGAGAAAGG - Intergenic
1100467327 12:94857899-94857921 CTTACATGGCAGCAGGAGAGAGG + Intergenic
1101979472 12:109393178-109393200 CTTACATGGCAGGTGTATGAGGG - Intronic
1102666259 12:114576012-114576034 CTTTCAGGGCATTTGGAGGAAGG - Intergenic
1103327044 12:120128647-120128669 CTTTCAAGGCTGCTGGGGGCTGG + Intronic
1103998904 12:124847697-124847719 TTTAGAAAGCAGGTGGAGGAAGG + Intronic
1107330577 13:39295622-39295644 TTTACATGGCAGCAGGAGGTGGG - Intergenic
1108348613 13:49569969-49569991 CTTACAAAACAGATGGAGAAAGG + Intronic
1109119289 13:58433742-58433764 CTCACATGGCAGAAGGAGGAAGG + Intergenic
1109392058 13:61706404-61706426 CTTACAAGGCAACTGTATCAGGG - Intergenic
1109629787 13:65031835-65031857 CTTACATGGTGGCAGGAGGAAGG + Intergenic
1110955851 13:81551221-81551243 CTTACATGGCAATAGGAGGAGGG + Intergenic
1112249115 13:97762617-97762639 CTTACAAGGCTGCAGGGGGGCGG + Intergenic
1112967995 13:105222927-105222949 CTGACAAGGCAGCTGCTGGAAGG + Intergenic
1113711429 13:112467610-112467632 CTTACACTGCATCTGAAGGAGGG + Intergenic
1113797100 13:113064870-113064892 CTTTCAGGGCAGCAGGAGGTGGG + Intronic
1114504175 14:23196331-23196353 CTTGGAAGCCAGCTGGAGGTTGG - Intronic
1115122205 14:29951068-29951090 CTTACATGGTAGCAGGAGGGTGG - Intronic
1115172851 14:30528583-30528605 TTTACAAGGCAATTGGAGCATGG + Intergenic
1115576930 14:34720380-34720402 TTTACTAGGCAGATGAAGGAAGG + Intergenic
1117220239 14:53596943-53596965 CTTCCAGGCCAGCTGGAGTATGG - Intergenic
1117643624 14:57827342-57827364 CTTTCACGGGAGCTGGGGGAGGG + Intronic
1119772359 14:77228190-77228212 CTTACAAGAAAGATGGAGAAAGG + Intronic
1120687433 14:87554418-87554440 ATTACAAAGCAGGTGGAAGAAGG + Intergenic
1120930712 14:89845600-89845622 CTTACAAGAGAGCTGAAGAATGG - Intronic
1121007482 14:90499610-90499632 CTTCCCAGGCAGCTGAAAGAAGG + Intergenic
1121424241 14:93837107-93837129 CTCACATGGCAGCAGGAGCAAGG + Intergenic
1121775776 14:96589663-96589685 CTCAGAAGGCAGCTGCAAGAGGG + Intergenic
1125038411 15:35154149-35154171 ATTACAAAACAGCTGGAAGAGGG + Intergenic
1126804519 15:52333008-52333030 CTTACATGGCAGAAGGTGGAAGG - Intronic
1127289727 15:57559643-57559665 CTGACAATGCAGCTGGGGGTAGG - Intergenic
1127492084 15:59474407-59474429 CTTACATGGCAGAAGGTGGAAGG + Intronic
1127525639 15:59790108-59790130 CTTACATGGCAGCAGCAAGAGGG - Intergenic
1129057097 15:72827954-72827976 ACTTCATGGCAGCTGGAGGATGG + Intergenic
1131405027 15:92157344-92157366 GTTACAAGGGAGCTTGATGATGG - Intronic
1131498253 15:92934067-92934089 CTTAGAAGACATCTGGAAGAGGG - Intronic
1132071666 15:98783054-98783076 CTGCCTAGGCTGCTGGAGGATGG + Intronic
1132701685 16:1224820-1224842 CATAAACGGCAGCTGGAGGCCGG + Intronic
1133998181 16:10763085-10763107 AGTACAAGTCACCTGGAGGAGGG + Intronic
1134053795 16:11156551-11156573 CTGAAACGGCAGCAGGAGGAAGG - Intronic
1141156653 16:81601712-81601734 CTTCCATGGGAGCTGGAGAATGG - Intronic
1141178385 16:81735566-81735588 CTCACACGGCTGCTGCAGGATGG + Intergenic
1141657716 16:85424974-85424996 CATGCCAGGCAGCTGGAGCAGGG + Intergenic
1143120096 17:4600983-4601005 CCTGTAAGGGAGCTGGAGGATGG - Intronic
1143287666 17:5802277-5802299 CTTGCAAGGCAGCTCGCGGTGGG - Intronic
1143635116 17:8159970-8159992 CTTACATACCAGCTGGGGGAGGG + Exonic
1143941025 17:10541569-10541591 ATTACAAGGCAAATGGAGGCAGG - Intronic
1144227499 17:13164211-13164233 CTTACATGGCTGTTGGAGGGAGG - Intergenic
1146139966 17:30357266-30357288 CTGAGAAGGCAGCAGGGGGATGG + Intergenic
1146263945 17:31438773-31438795 CTGACAAGGAAGCGGGAGGGAGG - Intronic
1147937785 17:44023529-44023551 AGGTCAAGGCAGCTGGAGGAGGG - Intronic
1150807673 17:68331915-68331937 ATTACAAGGCAAATGGAGGCAGG + Intronic
1151257793 17:72892830-72892852 CCAACAAGTCAGTTGGAGGAAGG - Intronic
1151360757 17:73587366-73587388 GTTACTTGGCAGCTGGAGCAAGG - Intronic
1151718439 17:75843111-75843133 CAGACAGGGCAGCTGCAGGAAGG + Intronic
1152658829 17:81533068-81533090 CTTCCAAGGCAGCTGCAGCGTGG + Intronic
1152795558 17:82304485-82304507 CTCAGAGGGCAGCTGGAAGAAGG - Intergenic
1153711052 18:7799212-7799234 CTCACATGGCAGAAGGAGGAAGG + Intronic
1153901062 18:9617136-9617158 CTTACAATGCAGCTCGTGGATGG + Intergenic
1156499035 18:37545318-37545340 GCTACTAGGCAGCAGGAGGAAGG - Intronic
1158031287 18:52968146-52968168 CTCAGAGGGTAGCTGGAGGATGG - Intronic
1158317252 18:56224916-56224938 CTTACAACGCCCCTGGAGCAAGG + Intergenic
1158863833 18:61618608-61618630 CTTATAGGGCACCTGGAGCAAGG - Intergenic
1158903015 18:61984005-61984027 CTTACATGGCAGCAGGAGGTGGG + Intergenic
1159905873 18:74091790-74091812 CATTAAAGGCAGCTGGGGGAAGG - Intronic
1160294923 18:77629300-77629322 CACACAATGCAGCTGGAGGAAGG + Intergenic
1160960984 19:1720735-1720757 ATTTCCAGGCAGTTGGAGGAAGG - Intergenic
1163431634 19:17271507-17271529 CAGACAAGGCAGCTTGAAGAGGG + Intronic
1164332526 19:24273249-24273271 ATCACAAGGCAACTGGAGGCAGG - Intergenic
1164969133 19:32515814-32515836 CTTCCAAGAGATCTGGAGGAAGG + Intergenic
1165600083 19:37047342-37047364 CTCACATGGCAGAAGGAGGAAGG - Intronic
1166287475 19:41840444-41840466 CCTACAGGGAAACTGGAGGAAGG + Intronic
1166912008 19:46165576-46165598 CCTACATGACAGCTGAAGGAGGG + Intergenic
1167178034 19:47879487-47879509 CTCACAAGGCGGCAGGAGGGAGG + Intronic
1167756091 19:51414819-51414841 CTAACCTGGCAGCTGCAGGATGG + Exonic
1168244741 19:55106529-55106551 CATCCAAGTCAGCTGGAAGAGGG - Intronic
925897449 2:8483602-8483624 CTTACATGGCAGCAGGAGTCAGG + Intergenic
926631095 2:15136861-15136883 CTTACATGGCAGCAGGAGAGAGG - Intergenic
929810797 2:45187970-45187992 CTTGCAAAGCAGCAGGAAGAAGG - Intergenic
930141334 2:47954003-47954025 CTTAGAAGGGAGCAGGAGGAAGG + Intergenic
932634449 2:73376160-73376182 CTTACATGGCAGAGGGAGGGAGG - Intergenic
933301518 2:80546085-80546107 CTTACAAGGCAGCTGGAGGAGGG + Intronic
933307580 2:80620785-80620807 CTTACCTGGCAGCTGTATGAGGG - Intronic
933600850 2:84328481-84328503 CTTACATGGGATCTGGAGGATGG - Intergenic
934759810 2:96848270-96848292 CTTTAAAGGCAGCTGGAGATAGG + Exonic
935955597 2:108373793-108373815 ATTACAAGGCAAATGGAGGCAGG - Intergenic
937055410 2:118930907-118930929 CTCACATGGCAGATGGTGGAAGG + Intergenic
939141028 2:138354786-138354808 CTCACAATGCAACTGGAGGGTGG - Intergenic
939555877 2:143672665-143672687 GTTCCAAGGCAAGTGGAGGAAGG - Intronic
942570681 2:177311037-177311059 TTCACAAGGCAGCAGGAGGGAGG + Intronic
943491540 2:188560779-188560801 CTTACATGGCAGGAGCAGGATGG + Intronic
943736062 2:191355853-191355875 CTCACAATGGAGATGGAGGATGG + Intronic
943932025 2:193867446-193867468 CTTACATGGCAGCAGGATGCGGG + Intergenic
944611509 2:201413420-201413442 CACACGTGGCAGCTGGAGGAGGG + Intronic
945536525 2:211025079-211025101 ATTACAAGGCAAATGGAGGTAGG + Intergenic
946025921 2:216671575-216671597 CTTACAAGGCAGTGGGAGGAGGG + Intergenic
946496904 2:220204126-220204148 CTGCCCAGGAAGCTGGAGGAGGG + Intergenic
947178691 2:227392822-227392844 CTTACAAGTCAGTGGGGGGATGG + Intergenic
947542415 2:230988134-230988156 CTTCCAAGCCAGCAGGAGGATGG - Intergenic
948310574 2:236982668-236982690 GGTACAAGACAGCTGGAGAAGGG + Intergenic
948644900 2:239398397-239398419 CTCACAATGAAGCTGGAGAATGG + Intronic
1169379827 20:5096703-5096725 CCTGCTAGGCAGCTGGTGGAAGG + Intronic
1169462955 20:5812389-5812411 CTTAACAGGCAACTGGAAGATGG + Intronic
1169902475 20:10567403-10567425 CTCACACGGCAGAAGGAGGAAGG - Intronic
1170595022 20:17798744-17798766 CCTCCAGGGCAGCTGGAGGCAGG - Intergenic
1172113321 20:32560065-32560087 TTCACAAAGGAGCTGGAGGATGG + Intronic
1173989910 20:47293947-47293969 TTTACATGGCAGCAGGAGAAGGG - Intronic
1175242099 20:57557175-57557197 CATACAAGGCCCCTGCAGGAGGG - Intergenic
1176040033 20:63060504-63060526 CTTCCCAGGCAGCCTGAGGAGGG - Intergenic
1176160040 20:63643096-63643118 CAGACAGGGAAGCTGGAGGAAGG - Intronic
1177557000 21:22703703-22703725 CTTACATGGCAGCAGGAGGGTGG - Intergenic
1177760105 21:25393579-25393601 CTTCCAAAACAGCTGGAAGATGG + Intergenic
1179425277 21:41273160-41273182 ATTACAAGGCAAATGGAGGCAGG + Intronic
1179878845 21:44285174-44285196 CTTCTAAAGCACCTGGAGGAAGG + Intergenic
1179973155 21:44847474-44847496 CTGAGAAGGCAGCAGGAGGGTGG - Intergenic
1180091248 21:45534780-45534802 CTTACAAGGCTGCTGGGGGAGGG + Intronic
1180140696 21:45892022-45892044 ATTCAAAGGCAGCTGGAGGCTGG + Intronic
1180883499 22:19223407-19223429 CTTCCCAGTCAGCTAGAGGAAGG - Intronic
1181049451 22:20231661-20231683 CTTACAAGGAGGCTGGGGGTGGG - Intergenic
1181377222 22:22469217-22469239 ATTACAAGGCAAATGGAGGCAGG - Intergenic
1181467898 22:23120111-23120133 CTCACAAGGCAGCTGGAGGTGGG - Intronic
1182416600 22:30225293-30225315 TTTACCAGGCAGCTGGAGAGGGG + Intergenic
1182648738 22:31832982-31833004 CTGAGAAGAAAGCTGGAGGAAGG - Intronic
1182886777 22:33780455-33780477 CACTCCAGGCAGCTGGAGGATGG + Intronic
950367336 3:12496894-12496916 CCTACAGTGTAGCTGGAGGAAGG - Intronic
950819010 3:15738404-15738426 ATTACAAGGCAAATGGAGGCAGG + Intronic
951541171 3:23783416-23783438 ATGAGAAGGCAGCTGGTGGAGGG + Intergenic
953185109 3:40630294-40630316 TTCACAAGGCAGCAGGAGGTGGG - Intergenic
954389640 3:50261833-50261855 CTGACCAGGCAGCTGGAGTCAGG - Intergenic
955020824 3:55119634-55119656 AGGACAAGGCTGCTGGAGGAGGG - Intergenic
956105665 3:65815462-65815484 CTTTCAAGTGAGCTGGGGGAGGG - Intronic
960584484 3:119308471-119308493 CTTTGAAGACAGATGGAGGAAGG - Intronic
961853032 3:129840706-129840728 CTTACATGGCAGCAGGAGTGGGG - Intronic
962628092 3:137247530-137247552 ATTACAAAACAGCTGGAAGAGGG - Intergenic
963785978 3:149534829-149534851 CTTTCCTAGCAGCTGGAGGACGG + Intronic
964501925 3:157357469-157357491 CTTACAATGCAGATGGACAAAGG - Intronic
964509143 3:157431175-157431197 CTTACATGGCAGCAGGAGTGAGG - Intronic
964880390 3:161417080-161417102 ATTACAAGGCAAATGGAGGCAGG + Intergenic
965317533 3:167210451-167210473 CTTACAGGGGAGCTAGAGAAAGG + Intergenic
965928903 3:174017791-174017813 ATTACAAGGCAACTGGAGGCAGG + Intronic
967302777 3:188032011-188032033 CTTCCAGGGCAGGTGGAAGATGG - Intergenic
968005255 3:195238275-195238297 CTTACCAGGCAGATGGGGGCTGG - Intronic
968192877 3:196683306-196683328 ATCACAAGGCAAGTGGAGGAAGG + Intronic
968262546 3:197336799-197336821 CTTCCTAGTCAGCTGGTGGAGGG + Intergenic
970411297 4:15810445-15810467 TTTACAAGGGAGTTGGAGTATGG + Intronic
970949599 4:21738345-21738367 CATTCAAGGCAACTGGAAGAGGG + Intronic
972038202 4:34553986-34554008 ATTACAAGGCAAATGGAGGCAGG + Intergenic
972419082 4:38869342-38869364 TTTGCCAGGCAGCTGGAGGAAGG + Intronic
972906091 4:43749133-43749155 TTGACAAGGCAGCTTTAGGAAGG + Intergenic
973943721 4:55936298-55936320 ATTACAAGGCAAATGGAGGCAGG - Intergenic
974800214 4:66807660-66807682 CTGACAAGACAGCAGAAGGAAGG + Intergenic
975587526 4:75965409-75965431 ATTACAAGGCAAATGGAGGCAGG - Intronic
975945238 4:79697483-79697505 CAAATAAGGCACCTGGAGGAGGG + Intergenic
976587843 4:86818955-86818977 CTTACAAGGAAGCTATAGGTGGG + Intergenic
976693030 4:87889155-87889177 ATTACAAGGCAAATGGAGGCAGG + Intergenic
976803115 4:89015258-89015280 ATTACAAGGCAAATGGAGGCAGG - Intronic
976983690 4:91265955-91265977 CTTACATGGCAGCAGCAAGAGGG + Intronic
977077951 4:92482321-92482343 CTTAGAGGGCAGAGGGAGGAAGG + Intronic
977282041 4:95051895-95051917 ATTACAGGGCAGTTGGAGAATGG - Intronic
979913703 4:126404294-126404316 CTGCCAAGCCAGCTGGAGGAGGG - Intergenic
979931869 4:126641763-126641785 GTTACATGGCAGGTGGGGGAGGG - Intergenic
980313164 4:131162088-131162110 ATTACAAGGCAAATGGAGGCAGG + Intergenic
981356238 4:143792530-143792552 CTCACATGGCAGAAGGAGGAAGG - Intergenic
981362384 4:143862623-143862645 CTTACAATCCAACGGGAGGAGGG + Intergenic
981377556 4:144033412-144033434 CTCACATGGCAGAAGGAGGAAGG - Intergenic
982208759 4:153018305-153018327 CTTACATGGCAGTAGGAGGTAGG + Intergenic
982714338 4:158791081-158791103 GTAACAAGGGAGGTGGAGGAGGG + Intronic
982797389 4:159662869-159662891 CTTACATGGCAGCAGGAGAGAGG + Intergenic
982830681 4:160055717-160055739 ATTACAAGGCAAGTGGAGGCAGG + Intergenic
984629314 4:182043898-182043920 CTTACAAGACAAGGGGAGGATGG - Intergenic
985144446 4:186880162-186880184 CTTACATGGCAGCAGGAGATGGG - Intergenic
985262461 4:188127795-188127817 GTTCCCAGGCAGCTGGAGGCTGG - Intergenic
988175927 5:27724807-27724829 CTTACATGGCAGCAGGAGGGCGG - Intergenic
988245491 5:28675230-28675252 ATTACAAGGCAAATGGAGGCAGG + Intergenic
991244403 5:64494313-64494335 CTTACAATACATCTGGCGGAAGG + Intergenic
991258997 5:64646490-64646512 CATGCAAAGCAGCAGGAGGAGGG + Intergenic
991977805 5:72199952-72199974 CTTGCACGGGAGCTGGAGGTGGG - Exonic
992138230 5:73768988-73769010 CTTACATGGCAGCGGCAAGAGGG - Intronic
992212865 5:74497477-74497499 CTTACATGGCAGAAGGAAGAGGG - Intergenic
993653972 5:90555838-90555860 ATTACTAGGCACCTGGAGGTGGG - Intronic
993775852 5:91994579-91994601 CTTACATGGTGGCAGGAGGAAGG + Intergenic
996013760 5:118508313-118508335 CTTAGAAAGGAGCTGGAGGAGGG + Intergenic
997631475 5:135372335-135372357 CTTACATGGAATCTGGTGGAGGG + Intronic
999065652 5:148683103-148683125 CTTACATGGCAGCAGGAGAGAGG + Intergenic
999433902 5:151547593-151547615 CTAACCAGTCAGCTGGAGAAGGG - Intronic
1000093419 5:157949816-157949838 CTTACAAGGGAGGTTGAGGCTGG + Intergenic
1000543485 5:162569876-162569898 CTTACATGGCAGCAGCGGGAGGG + Intergenic
1001487088 5:172127545-172127567 CTCCCAAGGCAGGAGGAGGAAGG - Intronic
1001521537 5:172397383-172397405 ATTACAAGGCAAATGGAGGCAGG - Intronic
1002947740 6:1779141-1779163 CTGAGAGGGCTGCTGGAGGAAGG - Intronic
1003516755 6:6824581-6824603 ATGACAGGGCAGCTGGAGGCAGG + Intergenic
1004573397 6:16869704-16869726 CTTAGAAGGAATCTGAAGGAGGG + Intergenic
1005101254 6:22174367-22174389 CTTACATGGCAGCAGGAGAAAGG - Intergenic
1005719288 6:28585370-28585392 CTTCCAAGACAGCCAGAGGAAGG + Intronic
1006349948 6:33513625-33513647 CTCAGAAGGCAGCAGGTGGAGGG - Intergenic
1006929425 6:37678738-37678760 CTCAGAAGACAGCTGAAGGAAGG - Intronic
1007596740 6:43055557-43055579 CTTAGAGGGCAGCTGGATAATGG + Exonic
1007697868 6:43744948-43744970 CATGAAAGGGAGCTGGAGGAGGG + Intergenic
1008169124 6:48180721-48180743 CCTACAAGTGAGCTGGAGCAGGG - Intergenic
1008975528 6:57421017-57421039 ATTACAGGGCAGATGGTGGAAGG + Intronic
1009274421 6:61657004-61657026 ATCACAAGGCACCTGGAGAAAGG + Intergenic
1009714145 6:67366422-67366444 TTTACAAGGCAGCAGGAGAGAGG + Intergenic
1009857310 6:69281378-69281400 CTAAGTAGGAAGCTGGAGGAGGG + Intronic
1011153415 6:84300800-84300822 CTTACATGGCAGGAGCAGGAGGG - Intergenic
1011343627 6:86345824-86345846 CTTACATGGCAGCAGCAGGGAGG + Intergenic
1011684855 6:89815863-89815885 CCTACCAGGGACCTGGAGGAAGG + Intronic
1011700380 6:89949922-89949944 CTTTCAAAGCAGGTGTAGGAGGG + Intronic
1014213511 6:118731081-118731103 CTGACAAGCCAGATGCAGGATGG + Intergenic
1014633342 6:123814138-123814160 CCTACAAGGCAGGGGGTGGAGGG + Intronic
1014806650 6:125837730-125837752 CTTAGGAGGCAGCATGAGGAAGG + Intronic
1016184042 6:141178844-141178866 CTTCCATAGCTGCTGGAGGAAGG - Intergenic
1017206276 6:151807607-151807629 ATTACAAAGGTGCTGGAGGACGG - Intronic
1017790954 6:157799079-157799101 TTCACAAGGCAGCAGGAGGGAGG + Intronic
1017963285 6:159240766-159240788 CTTCCAAAGCAGCTTGAGCAGGG - Intronic
1018245277 6:161816604-161816626 CTCACAATGCAGCTGGAGGGAGG + Intronic
1018449330 6:163892487-163892509 CTTACAATGCAGTTGGAGAAAGG - Intergenic
1019455325 7:1123815-1123837 CTTCCGAGGGAGCTGGCGGAGGG - Intronic
1020033182 7:4947349-4947371 CTTACATGGGAGCAGGAGGAAGG + Intronic
1024892823 7:54223057-54223079 CTAACAAGGCAAGTGGAGGCAGG + Intergenic
1024901094 7:54319330-54319352 CTAACAAGGCAAGTGGAGGCAGG - Intergenic
1025207261 7:57001047-57001069 CTCACTAGGGAGCTGGAGGTCGG + Intergenic
1025664674 7:63575839-63575861 CTCACTAGGGAGCTGGAGGTCGG - Intergenic
1026035159 7:66825235-66825257 CAAACAGGGCAGCTGGAGGGGGG + Intergenic
1026730590 7:72908422-72908444 ATTACAAGGCAAATGGAGGCAGG + Intronic
1028351301 7:89852939-89852961 CTTAAATGGCAGCAGGAGAAAGG - Intergenic
1028435108 7:90794217-90794239 ATTACAAGGCAAATGGAGGCAGG + Intronic
1028746676 7:94335370-94335392 ATTACAAAGCGGCTGGAGCAGGG + Intergenic
1030683639 7:112459840-112459862 CTTACCAGCCACCTGGAGGCTGG + Intronic
1031350211 7:120721982-120722004 CTTACATGGCAGCTGGCAAAGGG - Intronic
1031642016 7:124176169-124176191 CTTACATGGCAGCCTGAGGGTGG - Intergenic
1031799254 7:126222519-126222541 CTTACATGGCAGCAGGAGGCAGG + Intergenic
1032743437 7:134762646-134762668 CTTACATGGCTGGAGGAGGAGGG + Intronic
1036085861 8:5611974-5611996 CCTTCATGGCACCTGGAGGATGG - Intergenic
1036293905 8:7519558-7519580 ATGACAAGGCAGCTTGATGAGGG + Intergenic
1036298628 8:7555535-7555557 CTTGCAATTCAGATGGAGGAAGG + Intergenic
1036299933 8:7563185-7563207 CTTGCAATTCAGATGGAGGAAGG + Intergenic
1036328657 8:7801433-7801455 ATGACAAGGCAGCTTGATGAGGG - Intergenic
1036773504 8:11594285-11594307 CTTTCAAGGCTGCTGATGGATGG + Intergenic
1038085490 8:24192231-24192253 GTTTCAAGGCAGCAGGAGAAAGG - Intergenic
1038919253 8:32064479-32064501 CTACCAAGACAGCTGAAGGATGG - Intronic
1039703776 8:39987191-39987213 CTTACATGGCGGCAGGAGGTGGG - Intronic
1039823604 8:41155060-41155082 CTCACATGTCAGCTGGAGGATGG - Intergenic
1039869470 8:41533399-41533421 CTTGAAAGGCAGCTAGAGGATGG + Intronic
1041102960 8:54415146-54415168 CAGACAACACAGCTGGAGGAGGG - Intergenic
1041815171 8:61962299-61962321 CTTACATGGCAGAAGGTGGAAGG + Intergenic
1042092159 8:65170312-65170334 CTAACAAAACACCTGGAGGAGGG - Intergenic
1043028921 8:75106633-75106655 CTTCCCAGGCACCTGGGGGAAGG + Intergenic
1043436211 8:80238408-80238430 TTTCCAACGCAGCTGGGGGATGG - Intergenic
1043928206 8:86061580-86061602 CTTACATGACAGCTGAGGGAAGG - Intronic
1044859680 8:96510657-96510679 CCTACAATGGAGTTGGAGGAGGG + Intronic
1045954333 8:107889371-107889393 ATTACAAGGCAAATGGAGGCAGG + Intergenic
1046352322 8:113031967-113031989 CTTACAGGGCAGCAGGAGAGAGG - Intronic
1049126950 8:140799239-140799261 TTTACAAAGCAGTTTGAGGAAGG - Intronic
1049562887 8:143320909-143320931 CTCCCAGGGCTGCTGGAGGAAGG - Intronic
1049982917 9:921163-921185 ATTACCAGGGGGCTGGAGGAGGG - Intronic
1050401402 9:5259670-5259692 ATTACAAGGCAAATGGAGGCAGG - Intergenic
1053552366 9:39097458-39097480 CTTACAAGTAAGCTGGAGTGAGG + Intronic
1053816488 9:41917621-41917643 CTTACAAGTAAGCTGGAGTGAGG + Intronic
1054106748 9:61061303-61061325 CTTACAAGTAAGCTGGAGTGAGG + Intergenic
1054614109 9:67269822-67269844 CTTACAAGTAAGCTGGAGTGAGG - Intergenic
1055209901 9:73779225-73779247 TTCACCAGGCAGCAGGAGGAGGG - Intergenic
1057640565 9:96816229-96816251 GTTAGAAGGCAGCAGGAGAAAGG + Intergenic
1057761265 9:97876497-97876519 CTTAAGAGGGAGATGGAGGAAGG + Intergenic
1058350654 9:104017769-104017791 CTTACAATGCAGGTGGAGCATGG + Intergenic
1059233744 9:112744851-112744873 CTTAAAAGGCATCTGAAGGCTGG - Intergenic
1060660819 9:125404232-125404254 CTTCCTAGGCAGCTGGAGCTGGG + Intergenic
1061009788 9:127948159-127948181 CTTACACGTCAGCTGCAGGGAGG + Exonic
1061723744 9:132570027-132570049 CCTAAAAGGCAGCTAGAGGCTGG - Intronic
1062730003 9:138103437-138103459 CTCAGAGGGCTGCTGGAGGATGG + Intronic
1186142980 X:6596559-6596581 CTTACATGGCAGCAGGAGACAGG + Intergenic
1186182534 X:6986968-6986990 CTTGGCAGGCAGCTGGAGGGAGG - Intergenic
1186803599 X:13117568-13117590 ATTACAAGGCAAATGGAGGCAGG + Intergenic
1188947646 X:36326838-36326860 CTGACAATGCAACTGGGGGAAGG + Intronic
1189499325 X:41540617-41540639 CTTAATAGGCAGCTGGAGATAGG - Intronic
1189509542 X:41648408-41648430 ATTACAAGGCAAGTGGAGGCAGG - Intronic
1190973136 X:55371985-55372007 CTTATATGGCAGAAGGAGGAAGG + Intergenic
1193722506 X:85003762-85003784 TTGCCAAGGCGGCTGGAGGAGGG + Intergenic
1195265920 X:103179643-103179665 CTTACATGGCAGAAGGTGGAAGG + Intergenic
1195271163 X:103232434-103232456 CTTACAAGGGACCTTGAGGCAGG + Intergenic
1195275394 X:103276124-103276146 CCTGCAAGGCAGCGGGAGGCGGG - Intronic
1196238081 X:113306302-113306324 ATCACAAGGCAGGTGGAGGCAGG + Intergenic
1197071687 X:122306449-122306471 ATTACAAGGCAAATGGAGGCAGG - Intergenic
1197538386 X:127722793-127722815 CTTACATGGCAGTGGGGGGAGGG - Intergenic
1197951714 X:131904711-131904733 TTGACGAGGCAGATGGAGGATGG - Intergenic
1199306060 X:146268867-146268889 CTTACATGGCAGCAGGAGAGAGG - Intergenic