ID: 933306560

View in Genome Browser
Species Human (GRCh38)
Location 2:80607424-80607446
Sequence CATCAAGCACACACAGAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 239}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933306560_933306562 -5 Left 933306560 2:80607424-80607446 CCAAGCTCTGTGTGTGCTTGATG 0: 1
1: 0
2: 0
3: 21
4: 239
Right 933306562 2:80607442-80607464 TGATGGACACCCGCCTACTTCGG 0: 1
1: 0
2: 0
3: 1
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933306560 Original CRISPR CATCAAGCACACACAGAGCT TGG (reversed) Intronic
903880086 1:26502175-26502197 CATGAGCCACACACAGAGCCCGG - Intergenic
904027299 1:27512640-27512662 CCTCAAGGTCACACAAAGCTGGG - Intergenic
904610032 1:31720788-31720810 CATCACACAGACACAGAACTGGG + Intergenic
904862608 1:33550087-33550109 CATCAATCACACTCACACCTTGG + Intronic
905731327 1:40301158-40301180 CATCAGGCCCAGACAGAGCCTGG - Exonic
906724481 1:48033971-48033993 CATCAGGCTCACATATAGCTGGG - Intergenic
907306291 1:53514844-53514866 CATCAGGCACACACAGCTCCTGG - Intronic
908053326 1:60256528-60256550 AAGGAAGCACACACAGACCTTGG + Intergenic
909562798 1:77024590-77024612 CATCCAGAGCACACAGTGCTAGG - Intronic
910853974 1:91676288-91676310 CATCAAGCAGATAGGGAGCTAGG - Intergenic
912920549 1:113862378-113862400 TATCAAGCACACACAGAATCTGG - Intronic
914446295 1:147753272-147753294 CATCAAGTACACAGAGAGGTGGG - Intergenic
914906421 1:151749701-151749723 CATCATGCACACAGAGAGGAGGG + Intergenic
915204310 1:154258307-154258329 CAGCAAACACACTCAGAGTTAGG - Intronic
915307606 1:154989632-154989654 GTTGAAGCCCACACAGAGCTGGG - Exonic
915951476 1:160192390-160192412 GATCAACCCCACACTGAGCTTGG + Intronic
916662109 1:166932104-166932126 CACCCAGCATACACAGAGATAGG + Intronic
919157440 1:193784967-193784989 CACCAAGCACACAGAGAACCTGG + Intergenic
921601051 1:217106892-217106914 CATCATGGACACGCAGAGCTTGG - Intronic
924010591 1:239660939-239660961 AATAATGCACACATAGAGCTTGG - Intronic
924274322 1:242370169-242370191 AGTCAAGCACACCCAGGGCTAGG + Intronic
1062951699 10:1508341-1508363 CTTCATGCTCACACATAGCTTGG - Intronic
1063367190 10:5498684-5498706 CACCAAGCACACATGGAACTCGG + Exonic
1063973851 10:11399919-11399941 CAGCAAGGACGCAGAGAGCTTGG - Intergenic
1064722543 10:18244680-18244702 TACCAAGCACACACAGATGTGGG + Intronic
1067661693 10:48240913-48240935 CATAAAGCACACAGAGATGTTGG - Intronic
1067768379 10:49106712-49106734 CATCAAGCCTGCACAGACCTGGG + Intronic
1068711172 10:60135659-60135681 CATCAAGCACACAAAAGGCAAGG - Intronic
1070710082 10:78674851-78674873 CATGAAAAACACACAGAGATTGG + Intergenic
1071166172 10:82810181-82810203 CATGAAGCACACAAAGAATTAGG - Intronic
1073883407 10:108008917-108008939 CAGCAAGCAAAGACAGAGCTTGG + Intergenic
1081586172 11:44385500-44385522 CAGGAAGCAGACCCAGAGCTAGG + Intergenic
1081973448 11:47215559-47215581 AATCCAGCACACACAGCGCCAGG - Intronic
1082942932 11:58727128-58727150 CATAAAGCACTGGCAGAGCTGGG + Intronic
1084167907 11:67385122-67385144 CATCATGCACACACAGGGACTGG - Intronic
1085418842 11:76338161-76338183 CCTCAAGCCCACTCAGGGCTTGG + Intergenic
1085689342 11:78652740-78652762 CATTAAGAACACACAGAGGCGGG + Intergenic
1086119231 11:83288033-83288055 CATCAAAAAGACACAGAGCTGGG - Intergenic
1086177721 11:83912506-83912528 CATCAAGAACACACAGTGGCAGG + Intronic
1089793529 11:120961894-120961916 CATCATGCAAACACAGAGTTTGG + Intronic
1091290286 11:134435697-134435719 CTTCAACCTCACACAGATCTGGG + Intergenic
1091324896 11:134678763-134678785 CTTCAGGCAAACACAGAGGTGGG + Intergenic
1093206493 12:16257794-16257816 CATCCAGCACTCACAGGCCTGGG - Exonic
1097192352 12:57225594-57225616 CACCGAGCACACGCAGAGCCAGG + Exonic
1098208178 12:68134735-68134757 CACAAAGCAGTCACAGAGCTTGG + Intergenic
1098572097 12:71999457-71999479 TATCTATCACACACAGACCTCGG - Intronic
1098888045 12:75980203-75980225 CATCAAGCACACATAGAAAGGGG + Intergenic
1099994786 12:89766667-89766689 CAACAAGAATACACTGAGCTTGG - Intergenic
1101161784 12:101984969-101984991 CTTGGAGCACACACAGGGCTGGG + Intronic
1102825208 12:115943255-115943277 CTTCAAGCACACACAGGAGTAGG + Intergenic
1103000228 12:117379958-117379980 GGTCAGCCACACACAGAGCTTGG - Intronic
1103059604 12:117847908-117847930 CATCTGGCACACACAGTGTTGGG - Intronic
1103308593 12:119987452-119987474 CATCAAGAACAAACAGGGCCAGG - Intergenic
1103704128 12:122862283-122862305 CCTCTAGCCCACACAGAGCCTGG - Exonic
1103843222 12:123882331-123882353 CAGCCTGCACACACAGATCTGGG + Intronic
1104272579 12:127295192-127295214 CAGCCAGCACACACAGGGCCAGG - Intergenic
1104303355 12:127586494-127586516 CATCAAGCACACAGAGCACCTGG - Intergenic
1104701707 12:130909516-130909538 CTTAGAGCACACACAGGGCTGGG + Intergenic
1105216121 13:18286641-18286663 CAGGAAGCACACACAGGGCATGG + Intergenic
1105289527 13:19041991-19042013 AAACAAACACACACACAGCTGGG - Intergenic
1105421354 13:20255293-20255315 GAACTAGCACACACGGAGCTGGG + Intergenic
1106216887 13:27709933-27709955 CATTAAGCAAACAAGGAGCTGGG - Intergenic
1108592525 13:51924005-51924027 CATCAGGCACCCTCAGGGCTTGG + Intergenic
1111494497 13:89030708-89030730 CCTCAAGCACACATAGAGGTTGG - Intergenic
1112767205 13:102758047-102758069 GACCAAGCAAACACTGAGCTAGG - Intronic
1114732195 14:25004858-25004880 TAACAAGCACACACACAGCCTGG + Intronic
1119643010 14:76328912-76328934 GATCAAACACACACAGCTCTTGG - Intronic
1120293351 14:82606044-82606066 CATTAAGCCTACACAGGGCTAGG + Intergenic
1120819512 14:88899244-88899266 TATCAAGTACACACACAGGTTGG - Intergenic
1121237413 14:92402698-92402720 CAGCAGGCAAAGACAGAGCTTGG + Intronic
1121741525 14:96255742-96255764 CATCACACAAACAGAGAGCTAGG - Intronic
1122852850 14:104546263-104546285 CAGGAAGCACACGCAGGGCTGGG + Intronic
1123941709 15:25219775-25219797 CACCTCACACACACAGAGCTGGG - Intergenic
1125031455 15:35079796-35079818 CATCAAAAACACACATCGCTTGG + Intergenic
1126866954 15:52947279-52947301 AATTAAGCACACAAATAGCTTGG - Intergenic
1127419717 15:58793198-58793220 CCTCAAGCACCCAAAGTGCTGGG - Intronic
1128027387 15:64449742-64449764 TATAAAGCAGACACAGAGCCAGG - Intronic
1128714765 15:69900205-69900227 CATGAAGCAAACACTGACCTTGG - Intergenic
1128780196 15:70354153-70354175 CATTAAACACAAACAAAGCTGGG - Intergenic
1129719102 15:77868180-77868202 GATAAAGCACAGACAGAGCCAGG + Intergenic
1130459833 15:84152692-84152714 GATAAAGCACAGACAGAGCCAGG - Intergenic
1130893523 15:88152766-88152788 CACCAAGCATAGACAGAGCAAGG - Intronic
1132300352 15:100771449-100771471 TATGAAGGACACACAGGGCTGGG + Intergenic
1132627492 16:898482-898504 CCTCAAGGACACCCAGAGCCGGG - Intronic
1132896272 16:2230770-2230792 CATCAATGCCACTCAGAGCTCGG + Intronic
1133200866 16:4203812-4203834 CAGGGAGCACACACAGAGGTGGG - Intronic
1133235493 16:4385605-4385627 TACCAAGCACACAAAGTGCTGGG + Intronic
1134896288 16:17889780-17889802 CAAGATGCACAGACAGAGCTTGG - Intergenic
1135035835 16:19076041-19076063 CATACAGCACAGACAGAGCTGGG + Intronic
1135245718 16:20855314-20855336 AATTAAGCACAGACGGAGCTGGG + Exonic
1136033277 16:27519039-27519061 CTTTAAGCACGCACAGAGTTTGG + Intronic
1137570624 16:49564021-49564043 CATCAAGGAAACACAAACCTAGG - Intronic
1138446762 16:57069658-57069680 CATTAAGCCACCACAGAGCTTGG - Intronic
1138474746 16:57264077-57264099 CCTAGAGCACAGACAGAGCTGGG + Intronic
1138937567 16:61748102-61748124 TATAAAGAATACACAGAGCTTGG - Intronic
1139303211 16:65962526-65962548 GACCAAGCACACACAGCGGTAGG + Intergenic
1139477666 16:67210775-67210797 GGTCAAGGACACACAGGGCTGGG + Exonic
1142638461 17:1271600-1271622 CATCGAGAACACACAGGGCTCGG - Intergenic
1143130918 17:4676429-4676451 CCTGAAGCACACCGAGAGCTGGG - Exonic
1148575510 17:48707949-48707971 GATTCTGCACACACAGAGCTGGG + Intergenic
1148630704 17:49106171-49106193 GCTCAAGGACACACAGAGCTGGG + Intergenic
1148923035 17:51056407-51056429 CATCAAAGACACACTGAGGTGGG - Exonic
1150116238 17:62552376-62552398 CATCCAGCACAGACAGACCCAGG + Exonic
1150644159 17:66967850-66967872 CCTTAAGCACACAGAGGGCTGGG - Intronic
1152021693 17:77783004-77783026 CACCATGCACTCACATAGCTGGG + Intergenic
1152514268 17:80813425-80813447 CATAAAGCACACACACATGTCGG - Intronic
1153006587 18:502563-502585 CATCAGCCTCACAAAGAGCTGGG + Intergenic
1153312710 18:3692865-3692887 CCTGAAGCCAACACAGAGCTGGG + Intronic
1153346540 18:4032388-4032410 CATTAAGCACACAGATACCTTGG + Intronic
1153642413 18:7168110-7168132 CTTCAGGCACACACACAGCTGGG - Intergenic
1157033506 18:43942900-43942922 CCTCAAGCTCACAAAGTGCTGGG - Intergenic
1158961489 18:62591332-62591354 TAGAAAGCACACACAGACCTTGG + Intergenic
1159405221 18:67993080-67993102 CAGCAAGCAAAAAGAGAGCTTGG + Intergenic
1160427743 18:78790027-78790049 CACCCAGCACCCACAGAGCTTGG + Intergenic
1161141919 19:2653316-2653338 CAACAGACAAACACAGAGCTGGG + Intronic
1162412641 19:10515630-10515652 CACCAAACACACACACGGCTGGG + Intronic
1162854632 19:13459015-13459037 CATCTAGCACACACAGGCCAGGG - Intronic
1164569951 19:29366618-29366640 ATGCACGCACACACAGAGCTAGG - Intergenic
1165125119 19:33589382-33589404 CATTAAGCACTCTGAGAGCTGGG - Intergenic
1165393853 19:35553338-35553360 GGTCAAGGACACACAGAGCCAGG + Intronic
1167675105 19:50878984-50879006 CATGAGGCACACACACAGCAAGG + Exonic
1167772765 19:51531161-51531183 CATCACACGCACAGAGAGCTTGG + Exonic
925103936 2:1272980-1273002 CGTATAGCACACACAGACCTAGG - Intronic
926354268 2:12025458-12025480 CAGAAAGCAAACACAGAGTTGGG - Intergenic
926686360 2:15701352-15701374 CAGCAAGTGCAGACAGAGCTGGG - Exonic
927192210 2:20524520-20524542 CATCACGTACACATAGAGCTTGG - Intergenic
927203029 2:20590197-20590219 CAAAAAACACACACAGAGCCCGG - Intronic
928913451 2:36446281-36446303 AATCAAGCTCACACAGAAATGGG - Intronic
929916861 2:46143655-46143677 CATCACCCACAGCCAGAGCTGGG + Intronic
933306560 2:80607424-80607446 CATCAAGCACACACAGAGCTTGG - Intronic
934298206 2:91760084-91760106 CAGGAAGCACACACAGGGCATGG - Intergenic
935680393 2:105630946-105630968 CATCAAGCACACCCAATGCAGGG + Intergenic
938387784 2:130880039-130880061 AACCACGCTCACACAGAGCTTGG + Intronic
941020737 2:160406159-160406181 CATCAAGGGCACACAGACCACGG + Intronic
941827961 2:169920825-169920847 CCTCAACCACACACAGAGATTGG - Intronic
943432980 2:187827270-187827292 CAGAAAGCAGACACAGAGTTGGG - Intergenic
945044055 2:205766380-205766402 CATCAAGCACACACACACCAGGG - Intronic
945984979 2:216346323-216346345 CCTCATGAACACACATAGCTAGG + Intronic
946532829 2:220590920-220590942 CATCAACCTCTCAAAGAGCTGGG - Intergenic
948119119 2:235515810-235515832 AATTAAACACGCACAGAGCTGGG + Intronic
948949630 2:241240570-241240592 GACCAAGCACACACAAATCTGGG + Intronic
1169004886 20:2198531-2198553 CAACAATCACGCACAGAGCATGG + Intergenic
1169428297 20:5513006-5513028 TGTCAAGATCACACAGAGCTGGG - Intergenic
1171089769 20:22273174-22273196 CAGAAAGCAAACACAGAGTTGGG + Intergenic
1173430352 20:42982393-42982415 CAAGAAATACACACAGAGCTTGG + Intronic
1173562007 20:44012910-44012932 CATGCTGCACACACAGGGCTAGG + Intronic
1174400114 20:50271431-50271453 AATGAAGCACCCACTGAGCTGGG + Intergenic
1178885518 21:36481935-36481957 CCACAGGCACACACAGAGCGAGG + Intronic
1180199776 21:46217363-46217385 CATGAGGCACACACAGACCCTGG - Intronic
1184846363 22:47090258-47090280 CACCCGGCACACACTGAGCTGGG + Intronic
1184976875 22:48068534-48068556 CACGAGGCACACACTGAGCTTGG - Intergenic
950583710 3:13879086-13879108 CAACAAACACACACAAAGGTGGG - Intronic
950659464 3:14457927-14457949 CTTGAAGCAAACACAGAGCCAGG - Intronic
951365673 3:21779091-21779113 AATCAACCACAGTCAGAGCTGGG + Intronic
951875549 3:27420823-27420845 CATCATACACCCACAAAGCTAGG + Intronic
954404813 3:50339753-50339775 CTCCATGCACACACAGACCTGGG + Intronic
957221005 3:77382017-77382039 CATCAAGGACAAACTTAGCTTGG - Intronic
957282542 3:78172095-78172117 CATATAGCACACATAAAGCTGGG + Intergenic
958722417 3:97860589-97860611 CATCAGGCACACACCCACCTTGG - Intronic
960619995 3:119628233-119628255 CATGAAGCGCAGACAGAGTTGGG - Intronic
961039412 3:123666761-123666783 TAACAAGGACACACAGAGCTGGG + Intronic
961958632 3:130830530-130830552 CATCAAGTAAACACAGAAATGGG - Intergenic
962412364 3:135152464-135152486 CATGAAGCAGACACAAAGATGGG + Intronic
963024674 3:140907712-140907734 CATTTAGCACACACAGTGCCTGG - Intergenic
963134895 3:141893302-141893324 CATCAAGAATAAAGAGAGCTGGG - Intronic
963342096 3:144048718-144048740 GAACAAGCAAACACAGAGGTTGG + Intronic
964246335 3:154658290-154658312 CAACAAACACACACATAGCAGGG - Intergenic
964707456 3:159634643-159634665 CATCAGCCACACACAGTGCAGGG - Intronic
966767472 3:183476243-183476265 CATAAAGAAAACACAAAGCTGGG - Intergenic
967954920 3:194870634-194870656 CATGAAACACACACAGGCCTCGG - Intergenic
971316721 4:25573828-25573850 CATCACACACACACAGCCCTGGG - Intergenic
975227799 4:71894424-71894446 CATGAAGCATACACAAAGCAGGG - Intergenic
975241761 4:72067382-72067404 CATCAAACACCCAGAGTGCTAGG - Intronic
976203540 4:82602707-82602729 CAGCAAGCTCACACCGACCTAGG + Intergenic
976837879 4:89396440-89396462 CCTGAAGCTCACACAGAGCTGGG - Intergenic
977398212 4:96498055-96498077 GATCAAGCAAACAAAAAGCTGGG + Intergenic
978008542 4:103650288-103650310 CATAAAGCAAACACAGCACTGGG + Intronic
978466682 4:109016227-109016249 GATCATGCACACACCCAGCTTGG - Intronic
979323958 4:119357289-119357311 CAACAAACACACAAAAAGCTAGG - Intergenic
979866919 4:125767652-125767674 CAACAAGCACAAAATGAGCTTGG + Intergenic
981366036 4:143904480-143904502 CATGAGGAACACACAGAACTGGG - Intronic
983241800 4:165241973-165241995 CAACAAACACACAAAAAGCTAGG - Intronic
986445562 5:7817987-7818009 CATCAAGTCAACACACAGCTTGG + Intronic
986670434 5:10138824-10138846 CCTCCAGCACGCACAGAACTGGG + Intergenic
987430682 5:17829143-17829165 CATCAAGCAAATACAGGGGTAGG - Intergenic
991170483 5:63619334-63619356 CATACAGCACATGCAGAGCTGGG + Intergenic
991995437 5:72381953-72381975 CAGCATACACACAGAGAGCTTGG - Intergenic
993902281 5:93592722-93592744 CAGCAATCAGACACAAAGCTAGG - Intronic
993904606 5:93608978-93609000 AATTAACAACACACAGAGCTCGG + Intergenic
994536920 5:101043024-101043046 CAAGAGGCACAGACAGAGCTGGG - Intergenic
994738909 5:103594061-103594083 CATCAGAAACTCACAGAGCTGGG - Intergenic
995148385 5:108811983-108812005 CCTCAAAGACACACAGAGATGGG + Intronic
999904047 5:156119779-156119801 CATAAAGCACACACAGACACGGG - Intronic
1000359066 5:160431141-160431163 CCTGAAGCCCACACAGGGCTGGG - Intergenic
1000442813 5:161283367-161283389 CATACAGCACATGCAGAGCTTGG - Intergenic
1000828502 5:166075134-166075156 CAGCAATCACACACAATGCTGGG + Intergenic
1001128052 5:169038611-169038633 CACCAGTCCCACACAGAGCTTGG - Intronic
1001395652 5:171418552-171418574 CATCAGGCTCAAGCAGAGCTTGG + Intergenic
1003646601 6:7917758-7917780 CATCTAGCAGACAAAGAGCTGGG - Intronic
1004084102 6:12427306-12427328 CATGAAGCAAAGAAAGAGCTTGG - Intergenic
1004572049 6:16856026-16856048 CATGAAGAACACACAGGTCTTGG - Intergenic
1007832384 6:44648260-44648282 CAGCAAGCCCACTCAGAGCCTGG - Intergenic
1008615182 6:53219473-53219495 CTTCAAGCACTCTCAGAACTTGG - Intergenic
1008879112 6:56362813-56362835 GATCAAACACACAAACAGCTAGG - Intronic
1010713224 6:79199260-79199282 CATCAAACACACAAAGATCAGGG - Intergenic
1011187150 6:84690049-84690071 CATCAAGCAAACATAGCCCTAGG - Intronic
1011621802 6:89250410-89250432 AGACAAGCACCCACAGAGCTTGG - Intergenic
1012690775 6:102308286-102308308 CAACAAGCCAACATAGAGCTTGG - Intergenic
1015373098 6:132478572-132478594 CATCAAGGACAGAAAGAGCAGGG + Intronic
1017345829 6:153379673-153379695 CATTAGGCAATCACAGAGCTGGG + Intergenic
1017936005 6:159005899-159005921 CATAAAGCACAAACACAGCGTGG - Intergenic
1018027496 6:159817456-159817478 AATCAAGCACACACCAGGCTGGG - Intronic
1019557779 7:1641205-1641227 CATCAGACAGACACAGAGCTGGG + Intergenic
1023558880 7:41451511-41451533 CCTGAGGCACACACAGAGCTTGG - Intergenic
1024977281 7:55125509-55125531 CATAAAGCAAACACATACCTAGG + Intronic
1025194081 7:56919056-56919078 AACCAACCACACTCAGAGCTGGG + Intergenic
1025677867 7:63657888-63657910 AACCAACCACACTCAGAGCTGGG - Intergenic
1026847140 7:73704643-73704665 CCTCACACACACGCAGAGCTTGG - Intronic
1029061258 7:97800194-97800216 CAGCAAGTACTCACAGAGGTGGG - Intergenic
1029263079 7:99316737-99316759 CATCAGGCACCCAAAGTGCTGGG - Intergenic
1031006360 7:116476931-116476953 CTTCAACCAAACTCAGAGCTTGG + Intronic
1032045971 7:128608192-128608214 CATCCAGCACAGACAGACCCAGG + Intergenic
1032588276 7:133168566-133168588 CAGAAAGCAAACACAGAGTTGGG + Intergenic
1033145945 7:138870099-138870121 CATCAAGCTCCCAAAGTGCTGGG + Intronic
1034437179 7:151068405-151068427 AAGCAAGCAAACACAGGGCTTGG - Intronic
1034452870 7:151146900-151146922 CAGCTAGGACACACAGAGCTAGG - Intergenic
1034488313 7:151380064-151380086 ACTTAAGCACACACAGACCTCGG - Intronic
1035446001 7:158943649-158943671 AGTCCATCACACACAGAGCTGGG - Intronic
1035631656 8:1111292-1111314 CCTTCAGCACACACAGTGCTGGG - Intergenic
1035723240 8:1808583-1808605 CATGTAGCACACACACAGATAGG - Intergenic
1036613624 8:10371574-10371596 CATCAAGCAGAGACAGTGTTTGG + Intronic
1037065254 8:14568604-14568626 CTACCAGCAAACACAGAGCTAGG + Intronic
1038010816 8:23474626-23474648 CATCAGACAGACACAGAGGTCGG - Intergenic
1038197926 8:25385101-25385123 CAGCAGGCACAGAGAGAGCTGGG + Intronic
1039511556 8:38096079-38096101 CCTCAGCCACACACATAGCTGGG + Intergenic
1040512951 8:48111529-48111551 CAAGAAGCAATCACAGAGCTGGG - Intergenic
1041440758 8:57893997-57894019 CAAGAAGCACACTTAGAGCTCGG - Intergenic
1044235544 8:89826077-89826099 CCTCAACCACCCACAGTGCTGGG + Intergenic
1046015443 8:108599316-108599338 CATCCAGGATACACAGAGGTTGG + Intergenic
1047158993 8:122355388-122355410 CATCTACTACACACAAAGCTGGG + Intergenic
1047992014 8:130296367-130296389 CAACAAAGGCACACAGAGCTCGG + Intronic
1050995567 9:12212981-12213003 CATCCAGCACACACAGAGGCAGG - Intergenic
1051014844 9:12462190-12462212 CATCAAGCACACTCAAAGACTGG - Intergenic
1051094014 9:13444295-13444317 CATCTAGCACACACACACCCAGG + Intergenic
1052730509 9:32279701-32279723 TATCAATCCTACACAGAGCTGGG + Intergenic
1053342626 9:37350624-37350646 CATCTAGAACACACACAGTTTGG - Intronic
1055900829 9:81234857-81234879 GATAAAGCTCACACAGAGTTAGG - Intergenic
1059347448 9:113639208-113639230 CAGTAAGCACACCCAGGGCTGGG + Intergenic
1059464420 9:114458713-114458735 CATGATGCAGACACAGATCTAGG - Intronic
1059993947 9:119891507-119891529 AATCAAGCACACACAGGGGCTGG - Intergenic
1186223720 X:7375617-7375639 CCTCAAGCACACACACACCCAGG + Intergenic
1186227002 X:7410136-7410158 CATCAAGGACACAGACAACTAGG + Intergenic
1190124247 X:47689448-47689470 CACTAAGCACACACATATCTGGG + Intergenic
1192034657 X:67548725-67548747 CATCAAGTAGACAACGAGCTTGG + Intronic
1195273822 X:103258919-103258941 CAACTAGTACACACAGAGCCTGG + Intergenic
1197552921 X:127917063-127917085 CATCAATCACACACACACTTGGG + Intergenic
1200010097 X:153114315-153114337 CACCAGGCACACAGAGAGGTAGG - Intergenic
1200029503 X:153285607-153285629 CACCAGGCACACAGAGAGGTAGG + Intergenic
1200069729 X:153522250-153522272 CCTGAAGCAAACACAGAGCCTGG - Intronic
1200560196 Y:4691488-4691510 CATGAAGGAAACACAGAACTGGG - Intergenic
1201593228 Y:15637868-15637890 AAGCATGCACACACACAGCTGGG + Intergenic