ID: 933307319

View in Genome Browser
Species Human (GRCh38)
Location 2:80618591-80618613
Sequence TGTACATGGTCCTCTACTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 83}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933307319_933307324 -4 Left 933307319 2:80618591-80618613 CCCTTAGTAGAGGACCATGTACA 0: 1
1: 0
2: 0
3: 5
4: 83
Right 933307324 2:80618610-80618632 TACAGAGGTTGGATGTGCAGAGG 0: 1
1: 0
2: 0
3: 17
4: 227
933307319_933307329 26 Left 933307319 2:80618591-80618613 CCCTTAGTAGAGGACCATGTACA 0: 1
1: 0
2: 0
3: 5
4: 83
Right 933307329 2:80618640-80618662 CTTAAGGAAGGTCACACAGCAGG 0: 1
1: 1
2: 4
3: 90
4: 636
933307319_933307325 3 Left 933307319 2:80618591-80618613 CCCTTAGTAGAGGACCATGTACA 0: 1
1: 0
2: 0
3: 5
4: 83
Right 933307325 2:80618617-80618639 GTTGGATGTGCAGAGGCCAAAGG 0: 1
1: 0
2: 1
3: 15
4: 262
933307319_933307327 14 Left 933307319 2:80618591-80618613 CCCTTAGTAGAGGACCATGTACA 0: 1
1: 0
2: 0
3: 5
4: 83
Right 933307327 2:80618628-80618650 AGAGGCCAAAGGCTTAAGGAAGG 0: 1
1: 0
2: 0
3: 27
4: 231
933307319_933307326 10 Left 933307319 2:80618591-80618613 CCCTTAGTAGAGGACCATGTACA 0: 1
1: 0
2: 0
3: 5
4: 83
Right 933307326 2:80618624-80618646 GTGCAGAGGCCAAAGGCTTAAGG 0: 1
1: 0
2: 1
3: 17
4: 211
933307319_933307330 27 Left 933307319 2:80618591-80618613 CCCTTAGTAGAGGACCATGTACA 0: 1
1: 0
2: 0
3: 5
4: 83
Right 933307330 2:80618641-80618663 TTAAGGAAGGTCACACAGCAGGG 0: 1
1: 0
2: 7
3: 46
4: 336

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933307319 Original CRISPR TGTACATGGTCCTCTACTAA GGG (reversed) Intronic
908045113 1:60160506-60160528 TGTTCCTGGCCCTGTACTAAGGG - Intergenic
908964673 1:69744947-69744969 TTTACATGGTTCTCTTATAATGG + Intronic
911503599 1:98720320-98720342 TATACATAGTAGTCTACTAACGG - Intronic
916701775 1:167303260-167303282 TCTCCATGGTCCTTTAGTAAGGG + Intronic
923344612 1:233039325-233039347 TGTTCATGCTCCTCTACCACTGG + Intronic
1064061372 10:12140413-12140435 TGTACATGATCCTCTAGCTATGG + Intronic
1066111332 10:32199760-32199782 AGTACAAGGTCCTCAGCTAAAGG - Intergenic
1068414052 10:56693952-56693974 TGGACATGGGACTCTACTTAAGG + Intergenic
1073276370 10:102315210-102315232 TGTTCATGGTCCTCTACTTCAGG + Intronic
1075636399 10:124033853-124033875 TTTACTGGGTCCTCTACTTAAGG - Intronic
1078634750 11:13038996-13039018 TGTAGATATTCCTGTACTAAAGG + Intergenic
1088736795 11:112734400-112734422 TGTCCATGGTCCTGGACTCAGGG + Intergenic
1092405286 12:8217542-8217564 TGTACATTGTCCTTCACTTAGGG + Intergenic
1096428728 12:51525707-51525729 TCAACAGGGTCCTCTACTCAGGG + Intergenic
1099177014 12:79433843-79433865 TGTACTTGCCCCTCTACTAAGGG + Intronic
1101140326 12:101789245-101789267 TGAATATGGTGCTCTAGTAACGG - Intronic
1107092669 13:36499037-36499059 TTTACATGGCTCTATACTAATGG + Intergenic
1108087276 13:46806405-46806427 TGTACATGCAACTCTACTGAAGG - Intergenic
1114862985 14:26549736-26549758 TGTACATGGTGCTGTACAGAAGG - Intronic
1120224260 14:81772871-81772893 TGTACATGGTATTCAAGTAATGG - Intergenic
1124954266 15:34349682-34349704 TGTACATGGTGCTCTTCCAGTGG + Intronic
1127739334 15:61884750-61884772 TGTAAATGTTCATCTATTAATGG + Intronic
1137661345 16:50209605-50209627 TGTAAATCATCCTCTACGAAAGG + Intronic
1144593524 17:16545652-16545674 TGTAGATTTTCCTCTACTAGAGG - Intergenic
1146492916 17:33294894-33294916 TGTACTGGGGCCTCTACCAAAGG + Intronic
1146851022 17:36221685-36221707 TGTACATGGACCTCTCTGAATGG + Intronic
1149198224 17:54149899-54149921 TGTTCAGGGTACTCTCCTAAAGG + Intergenic
1150906105 17:69339668-69339690 TGCACAAGGAACTCTACTAAAGG + Intergenic
1151761526 17:76106076-76106098 AGTACATGGTATTGTACTAATGG - Intronic
1156530699 18:37812318-37812340 TGTGTAGGGTCCTCTTCTAAAGG - Intergenic
1156793685 18:41012635-41012657 TGTACATTTTTTTCTACTAATGG + Intergenic
1157813735 18:50716546-50716568 TCACCATGGTCCTCTACCAACGG - Intronic
1158139282 18:54240714-54240736 TTCACTGGGTCCTCTACTAATGG + Intergenic
1158500731 18:57998528-57998550 TCTATATGATCCTATACTAATGG + Intergenic
1159091072 18:63850069-63850091 TGATCATGGTTCTCAACTAAGGG + Intergenic
925110819 2:1335147-1335169 TGTTCAAGGTCCTCTACGCAAGG - Intronic
926823020 2:16874064-16874086 TGTGCATGCTCCTGTCCTAAGGG + Intergenic
931660101 2:64552511-64552533 TTTACATTGTTCTCTCCTAATGG - Exonic
933307319 2:80618591-80618613 TGTACATGGTCCTCTACTAAGGG - Intronic
935654625 2:105411516-105411538 TGTAAATGGTCCTGAACTTAGGG + Intronic
943426833 2:187748558-187748580 TGTTCATTGTGCTATACTAATGG - Intergenic
1169475147 20:5924210-5924232 TGAAAATGGTGCTCTAGTAATGG + Intronic
1170777482 20:19390501-19390523 TCTTCATGGTCCTATACTACAGG - Intronic
1175718960 20:61273901-61273923 TGTACATGGTACTCCCCTAAAGG - Intronic
1182626205 22:31648385-31648407 TGTGCCTGGTCCCCTACTGAGGG - Intronic
949623501 3:5843473-5843495 TGTAGTTGGTCCTTTGCTAATGG + Intergenic
954910693 3:54104845-54104867 TGTACCTGCTTCTCCACTAAAGG + Intergenic
955952371 3:64255377-64255399 TTTACAGGGCCCTCCACTAAAGG + Intronic
969245313 4:5928100-5928122 TGTTTATGGTCCTCTATAAAGGG + Intronic
969760829 4:9180429-9180451 TGTACATTGTCCTTCACTTAGGG - Intergenic
970363338 4:15332779-15332801 TGCATTTGGTCTTCTACTAAGGG - Intergenic
974098619 4:57392710-57392732 TGTACATGCTCCCCTCCTAAGGG + Intergenic
975116888 4:70689463-70689485 TGTACTTGGTCCTCAAGTATTGG - Exonic
982079319 4:151772224-151772246 TGTGGTAGGTCCTCTACTAAAGG - Intergenic
987947580 5:24631603-24631625 GGAACATGGTCTTCTACTCATGG - Intronic
999352835 5:150893078-150893100 TATACATTGTCCTCTATTATAGG + Intronic
999353280 5:150898470-150898492 TGTACAGGGTCCTCTGAGAAGGG + Exonic
1005146855 6:22701411-22701433 TCTACATGGTCCACTGGTAAAGG + Intergenic
1008623625 6:53296385-53296407 TTGACATGATCATCTACTAATGG - Intronic
1011739389 6:90344627-90344649 TGTACATTGTCCTACATTAATGG - Intergenic
1012289888 6:97440217-97440239 TTTAGATGGTCCACAACTAAAGG + Intergenic
1014880071 6:126712543-126712565 TGTGCATGGACTTCTACCAATGG - Intergenic
1015946744 6:138510390-138510412 TGTACTTGGTTTTCTAGTAATGG + Intronic
1016968683 6:149742487-149742509 TGTACATGGTGCACTGCTATAGG + Exonic
1017975590 6:159354046-159354068 TGAAAATGGTCCTCTAGTGAAGG + Intergenic
1020960456 7:14796218-14796240 TGTGTATGGTCCTCTACTGTGGG - Intronic
1021002414 7:15349101-15349123 TGTCCATGTGCCTCTAGTAAAGG - Intronic
1022019135 7:26381646-26381668 TGTATATGGTCCCCAACTTAGGG - Intergenic
1022057965 7:26759837-26759859 TTTAAATGGTTCTCTACAAATGG - Intronic
1024035250 7:45502625-45502647 TGTAAATTGTCCTCCAGTAAGGG - Intergenic
1031423904 7:121583201-121583223 TGTATATAGTCTTCTACTGATGG - Intergenic
1034938015 7:155212116-155212138 TGGACAAGGTCCTCTCCTACTGG - Intergenic
1036845678 8:12168489-12168511 TGTACATTGTCCTTCACTTAAGG + Intergenic
1036867046 8:12410808-12410830 TGTACATTGTCCTTCACTTAAGG + Intergenic
1037194243 8:16168017-16168039 TATACATGGTCCTCACCTTAAGG - Intronic
1038633103 8:29263784-29263806 TGTTTATGGGTCTCTACTAAAGG - Intergenic
1038925297 8:32132507-32132529 TCTACTTGGCCCTCGACTAAAGG + Intronic
1039788886 8:40858371-40858393 TGCACATGGCCTTGTACTAAGGG - Intronic
1042494378 8:69439901-69439923 TGTGCATGTCACTCTACTAAAGG + Intergenic
1046100973 8:109613767-109613789 TGTGCATGAACCTCTATTAAGGG + Intronic
1047667292 8:127105945-127105967 TGTGCCTGGTTCTCTAATAATGG - Intergenic
1053429104 9:38030242-38030264 TGTACATGGTCCAGGACTAATGG - Intronic
1055650884 9:78405741-78405763 TGTGCATGGTCCTGTGGTAAGGG + Intergenic
1056343257 9:85660639-85660661 TATATATTTTCCTCTACTAATGG + Intronic
1058199307 9:102019025-102019047 TGTGGATGGTCCTCTCCTATTGG + Intergenic
1194578863 X:95646384-95646406 TGCACATGGTGCTATGCTAAAGG - Intergenic
1195619867 X:106942307-106942329 TATACATATTCCTCTACTTATGG + Intronic
1197092206 X:122552840-122552862 TATACATGCTCCTCTGCAAAAGG + Intergenic
1198263005 X:134983236-134983258 TGTGGTTGGACCTCTACTAATGG - Intergenic