ID: 933315809

View in Genome Browser
Species Human (GRCh38)
Location 2:80713646-80713668
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933315806_933315809 27 Left 933315806 2:80713596-80713618 CCTTTAATGAGCAATAGAAGAAA No data
Right 933315809 2:80713646-80713668 AAGTGATAAGAAAAGTTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr