ID: 933317479

View in Genome Browser
Species Human (GRCh38)
Location 2:80733228-80733250
Sequence AAGCAAAAATACATGGTACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933317476_933317479 1 Left 933317476 2:80733204-80733226 CCAATTACACTACAGAACTACAA No data
Right 933317479 2:80733228-80733250 AAGCAAAAATACATGGTACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933317479 Original CRISPR AAGCAAAAATACATGGTACA GGG Intergenic
No off target data available for this crispr