ID: 933321723

View in Genome Browser
Species Human (GRCh38)
Location 2:80783639-80783661
Sequence CTCAATATCTGCTCTGTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933321721_933321723 16 Left 933321721 2:80783600-80783622 CCTGTGAGTTCTCCTAAAGCTCT No data
Right 933321723 2:80783639-80783661 CTCAATATCTGCTCTGTGTCTGG No data
933321722_933321723 4 Left 933321722 2:80783612-80783634 CCTAAAGCTCTGATAGCTTCTCT No data
Right 933321723 2:80783639-80783661 CTCAATATCTGCTCTGTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933321723 Original CRISPR CTCAATATCTGCTCTGTGTC TGG Intergenic
No off target data available for this crispr